Abstract

Phototransduction machinery in vertebrate photoreceptors is contained within the membrane discs of outer segments. Daily renewal of 10% of photoreceptor outer segments requires stringent control of gene expression. Rhodopsin constitutes over 90% of the protein in rod discs, and its altered expression or transport is associated with photoreceptor dysfunction and/or death. Two cis-regulatory sequences have been identified upstream of the rhodopsin transcription start site. While the proximal promoter binds to specific transcription factors, including NRL and CRX, the rhodopsin enhancer region (RER) reportedly contributes to precise and high-level expression of rhodopsin in vivo. Here, we report the identification of RER-bound proteins by mass spectrometry. We validate the binding of NonO (p54nrb), a protein implicated in coupling transcription to splicing, and three NonO-interacting proteins—hnRNP M, Ywhaz and Ppp1ca. NonO and its interactors can activate rhodopsin promoter in HEK293 cells and function synergistically with NRL and CRX. DNA-binding domain of NonO is critical for rhodopsin promoter activation. Chromatin immunoprecipitation followed by deep sequencing (ChIP-seq) analysis demonstrates high occupancy of NonO at rhodopsin and a subset of phototransduction genes. Furthermore, shRNA knockdown of NonO in mouse retina leads to loss of rhodopsin expression and rod cell death, which can be partially rescued by a C-terminal NonO construct. RNA-seq analysis of the NonO shRNA-treated retina revealed splicing defects and altered expression of genes, specifically those associated with phototransduction. Our studies identify an important contribution of NonO and its interacting modulator proteins in enhancing rod-specific gene expression and controlling rod homeostasis.

INTRODUCTION

Development and homeostasis require quantitatively precise expression of genes in distinct spatiotemporal patterns. The regulatory information necessary for the transcription of a gene is largely confined to the proximal promoter region, upstream of the transcription start site (TSS); however, distal regulatory elements (such as enhancers) are frequently needed for accurate and cell-type-specific expression (1,2). Enhancer sequences can exert their influence over a long genomic distance (3) and associate with transcriptional co-activators to augment RNA polymerase II-mediated gene expression (4). The combinatorial interaction of specific proteins that bind to promoter and/or enhancer elements determines the activation or repression of a gene (5). The evolution of enhancers in developmentally regulated genes seems to exert a major drive for tissue specification during vertebrate development (6,7). Notably, a vast majority of variations associated with complex traits and common diseases are identified in non-coding, intronic or intergenic regions, and many of these may be present within potential enhancer sequences (8).

The distinctive architecture and functional organization, together with easier accessibility, of the mammalian retina make it an ideal prototype for dissecting gene regulatory networks underlying neuronal development and homeostasis. The rod and cone photoreceptors constitute over 70% of cells in mature retina and are responsible for vision in dim and bright light, respectively. The visual process is initiated in the photoreceptor outer segment discs that provide high density of opsin visual pigment and other phototransduction components for maximal photon capture (9). Approximately 10% of outer segment discs in the mammalian photoreceptors are shed daily at light onset (10–13). The renewal that accompanies shedding of membrane discs (14,15) requires precise yet high synthesis and transport of phototransduction proteins, specifically rhodopsin, which constitutes >90% of the protein in rod outer segments (16). Whether rhodopsin transcripts exhibit a light dependent or circadian-associated pattern of expression in mammalian rods is debatable (17–19). Nonetheless, abnormal expression and/or trafficking of rhodopsin have been associated with the death of rod photoreceptors (20–23).

The expression of rhodopsin is primarily regulated at the level of transcription. Two distinct sequence elements have been defined upstream of rhodopsin TSS: rhodopsin proximal promoter region (RPPR) and rhodopsin enhancer region (RER) (24). RPPR harbors binding sites for the basic motif neural retina leucine zipper protein NRL and cone rod homeobox CRX and is shown to direct expression (though somewhat leaky) of a reporter gene to rod photoreceptors in transgenic mice (25). NRL and CRX are two key transcription factors that work synergistically to activate rhodopsin expression (26). Loss of Nrl in mice results in a cone-only retina with no rods and no rhodopsin expression (27), whereas ectopic Nrl expression can lead to rhodopsin expression in cones (28). The loss of Crx results in abnormal rods with no outer segments and minimal rhodopsin expression (29).

Transgenic mouse studies using murine or bovine RPPR have revealed the requirement of a longer upstream sequence for rod photoreceptor-specific expression of rhodopsin in vivo (30). Footprinting of bovine rhodopsin promoter had previously identified a highly conserved RER, ∼2 kb upstream of TSS (24). Though rod-specific interaction of RER with RPPR and its relevance to rhodopsin expression has been inferred through long-range chromosomal looping (31), RER-binding proteins have not been identified yet, and molecular mechanisms that control quantitatively precise expression of rhodopsin are poorly understood.

In this report, we have identified RER-binding proteins by mass spectrometry; the most abundant protein is non-POU domain-containing Octamer-binding protein (NonO/p54nrb), which has been implicated in coupling of transcription to splicing (32,33). In addition, three previously reported NonO-interacting proteins were detected among RER-bound proteins. In HEK293 cells, NonO and its interactors activated rhodopsin promoter activity synergistically with NRL and CRX. To test the hypothesis that NonO facilitates high-level transcription of rhodopsin and other phototransduction genes, we performed NonO-ChIP-seq and NonO knockdown in mouse retina in vivo. In addition, we did RNA-seq analysis of the retina after NonO-knockdown in vivo to evaluate the role of NonO in splicing. Our studies demonstrate a significant contribution of NonO and its interacting proteins in modulating rod-specific gene expression and splicing.

RESULTS

Identification of NonO as a major RER-binding protein

Phylogenetic analysis of bovine RER sequence using MacVector (version 11.11.1) revealed several evolutionarily conserved elements (Fig. 1A). To identify RER-binding proteins (strategy shown in Fig. 1B), a biotin-tagged RER oligonucleotide (nucleotides −2155 to −2027 upstream of the bovine rhodopsin TSS), encompassing the conserved regions, was incubated with bovine retinal nuclear extract. RER-bound proteins were separated by Streptavidin-tagged magnetic beads and eluted in high salt buffer after several washings. The eluted proteins were resolved on SDS–PAGE and visualized by silver staining (Fig. 1C). Five protein bands detectable in the RER-bound fraction (shown by asterisks in Fig. 1C), but absent in the control, were excised from the gel for mass spectrometry. The analysis of identified peptides revealed a number of proteins that reportedly participate in splicing, transcription or signal transduction (data not shown). In our mass spectrometry analysis, the maximum number of unique peptides was obtained for non-POU domain-containing Octamer-binding protein, NonO/p54nrb. In addition, we identified three known NonO-interacting proteins—hnRNP M, protein phosphatase 1 (Ppp1ca) and Ywhaz among the RER-bound proteins, but not in the control. The presence of NonO, hnRNP M and Ywhaz in RER-bound fraction was validated by immunoblot analysis using specific antibodies (Fig. 1D). We could not independently confirm the presence of Ppp1ca since the available antibody did not cross-react with the cognate bovine protein. However, the interaction of Ppp1ca with NonO has been reported earlier (34).

Figure 1.

Isolation of RER-binding proteins from bovine retina. (A) Proximal and distal elements in the bovine rhodopsin promoter and conservation (shaded region) of the distal RER in mammals. CRS-1, RET-1, BAT-1, NRE and RET-4 are cis-elements within RPPR. (B) A schema for purifying RER-bound proteins from bovine retina. (C) Silver-stained SDS–PAGE gel showing the proteins that bound to rhodopsin RER or the control oligonucleotide. Lanes: 1, input nuclear fraction (10 μg); 2, RER-bound proteins; and 3, control oligonucleotide-bound proteins. Asterisks indicate the protein bands submitted for mass spectrometry. NonO (55 kDa) is indicated by the arrow. (D) Validation of NonO and NonO-interacting proteins. Immunoblots of RER and control oligonucleotide-bound fractions were probed with anti-NonO, anti-hnRNP M and anti-Ywhaz antibodies. Arrows indicate the respective protein bands.

Figure 1.

Isolation of RER-binding proteins from bovine retina. (A) Proximal and distal elements in the bovine rhodopsin promoter and conservation (shaded region) of the distal RER in mammals. CRS-1, RET-1, BAT-1, NRE and RET-4 are cis-elements within RPPR. (B) A schema for purifying RER-bound proteins from bovine retina. (C) Silver-stained SDS–PAGE gel showing the proteins that bound to rhodopsin RER or the control oligonucleotide. Lanes: 1, input nuclear fraction (10 μg); 2, RER-bound proteins; and 3, control oligonucleotide-bound proteins. Asterisks indicate the protein bands submitted for mass spectrometry. NonO (55 kDa) is indicated by the arrow. (D) Validation of NonO and NonO-interacting proteins. Immunoblots of RER and control oligonucleotide-bound fractions were probed with anti-NonO, anti-hnRNP M and anti-Ywhaz antibodies. Arrows indicate the respective protein bands.

NonO augments rhodopsin promoter activity

To examine the functional relevance of NonO binding to RER, we performed reporter assays in HEK293 cells using 2.2 kb bovine rhodopsin promoter (including both RPPR and RER) driving a firefly luciferase gene (2.2 kb bRho-Luc; Fig. 2A). A plasmid containing CMV promoter driving renilla luciferase was used as an internal control. Transfection of NonO expression construct produced a relatively small dose-dependent increase in rhodopsin promoter activity, which was significantly enhanced (almost 80-fold) by co-transfection with two known transcriptional activators of rhodopsin—NRL and CRX (Fig. 2A). A synergistic augmentation in rhodopsin promoter activity was also evident when Ppp1ca or Ywhaz was co-transfected with NRL, CRX and/or NonO (Fig. 2B). Notably, when transfected alone, Ppp1ca and Ywhaz did not exhibit a significant increase in rhodopsin promoter activity. NonO also enhanced the activity of 130 bp rhodopsin promoter, which lacks RER but includes RPPR, though to a much lesser extent (Supplementary Material, Fig. S1), presumably because of its direct effect on RNA Pol II (33,35) or additional NonO binding near the TSS in RPPR (see NonO ChIP-seq data later).

Figure 2.

NonO and NonO interactors enhance rhodopsin promoter activity synergistically with NRL and CRX. (A) Luciferase reporter assays showing transactivation of the bovine rhodopsin promoter by NonO. HEK293 cells were co-transfected with 2.2 kb bovine rhodopsin promoter driving firefly luciferase reporter (0.2 μg) and increasing concentrations (0.1–0.6 μg) of NonO, alone or in combination with 0.1 μg of NRL, CRX or both. CMV-renilla (0.001 μg) was used as transfection control to normalize firefly luciferase activity. RLA indicates relative luciferase activity compared with the mock vector control, and FC is fold change. All experiments were carried out in triplicate. Student's t-test was performed using Prism software v5, and P-values < 0.05 were considered significant. Two asterisks show P < 0.05 and three P < 0.01. (B) Transactivation of the rhodopsin promoter activity by NonO interactors. Ywhaz (0.05 and 0.1 μg) and Ppp1ca (0.1 μg) were co-transfected with NRL, CRX and NonO. Other details are similar to (A). (C) Co-immunoprecipitation of NonO with NRL, CRX and Pol II from bovine retinal nuclear extract. Anti-NonO, anti-NRL, anti-CRX, anti-Pol II or anti-Brn3b (Pou4f2) antibodies were used for immunoprecipitation. IgG was used as control. Immunoblot of immunoprecipitated samples was probed with anti-NonO antibody. The arrow indicates NonO and the asterisk IgG heavy chain. (D) DNA-binding domain of NonO is required for enhancer activity. NonO deletion mutants used in the study (above). NOPS, no on or off transient A/paraspeckle; RRM, RNA-recognition motif. Evaluation of NonO domains for enhancer activity (below). HEK293 cells were co-transfected with 2.2 kb bovine rhodopsin promoter driving firefly luciferase reporter (0.2 μg) and 0.6 μg of NonO deletion mutant alone or together with 0.1 μg each of NRL and CRX, as indicated. Dashed line represents the fold change (FC) of rhodopsin promoter activity in the presence of NRL and CRX. RLA (FC) represents fold change relative to the mock vector control. All experiments were done in triplicate. Student's t-test was used for statistical analysis.

Figure 2.

NonO and NonO interactors enhance rhodopsin promoter activity synergistically with NRL and CRX. (A) Luciferase reporter assays showing transactivation of the bovine rhodopsin promoter by NonO. HEK293 cells were co-transfected with 2.2 kb bovine rhodopsin promoter driving firefly luciferase reporter (0.2 μg) and increasing concentrations (0.1–0.6 μg) of NonO, alone or in combination with 0.1 μg of NRL, CRX or both. CMV-renilla (0.001 μg) was used as transfection control to normalize firefly luciferase activity. RLA indicates relative luciferase activity compared with the mock vector control, and FC is fold change. All experiments were carried out in triplicate. Student's t-test was performed using Prism software v5, and P-values < 0.05 were considered significant. Two asterisks show P < 0.05 and three P < 0.01. (B) Transactivation of the rhodopsin promoter activity by NonO interactors. Ywhaz (0.05 and 0.1 μg) and Ppp1ca (0.1 μg) were co-transfected with NRL, CRX and NonO. Other details are similar to (A). (C) Co-immunoprecipitation of NonO with NRL, CRX and Pol II from bovine retinal nuclear extract. Anti-NonO, anti-NRL, anti-CRX, anti-Pol II or anti-Brn3b (Pou4f2) antibodies were used for immunoprecipitation. IgG was used as control. Immunoblot of immunoprecipitated samples was probed with anti-NonO antibody. The arrow indicates NonO and the asterisk IgG heavy chain. (D) DNA-binding domain of NonO is required for enhancer activity. NonO deletion mutants used in the study (above). NOPS, no on or off transient A/paraspeckle; RRM, RNA-recognition motif. Evaluation of NonO domains for enhancer activity (below). HEK293 cells were co-transfected with 2.2 kb bovine rhodopsin promoter driving firefly luciferase reporter (0.2 μg) and 0.6 μg of NonO deletion mutant alone or together with 0.1 μg each of NRL and CRX, as indicated. Dashed line represents the fold change (FC) of rhodopsin promoter activity in the presence of NRL and CRX. RLA (FC) represents fold change relative to the mock vector control. All experiments were done in triplicate. Student's t-test was used for statistical analysis.

The synergy between NonO, NRL and CRX in activating rhodopsin promoter activity suggested an interaction among these regulatory proteins. Consistent with this prediction, NonO protein could be co-immunoprecipitated with anti-NRL, anti-CRX and anti-RNA Pol II (positive control (33)) antibodies, but not with anti-Brn3b (official name, Pou4f2), a retinal ganglion cell-specific transcription factor, or IgG (both negative controls) (Fig. 2C). Notably, NonO could be immunoprecipitated with anti-NRL or anti-CRX antibodies only if the bovine retina was cross-linked before preparing the nuclear extracts.

DNA-binding domain of NonO is essential for rhodopsin promoter activation

The NonO protein of 473 amino acid residues includes two RNA-recognition motifs (RRM-1 and RRM-2) and a DNA-binding region with no on or off transient A/paraspeckle (NOPS) and charged coiled coil domains (36,37) (Fig. 2D). Co-transfection of 2.2 kb bRho-Luc construct with NRL, CRX and different NonO deletion mutants in HEK293 cells demonstrated the requirement of DNA-binding region for activating rhodopsin promoter (Fig. 2D). Although RRMs could not activate reporter gene expression on their own, only partial NonO-mediated transactivation was observed in their absence. We also noted that full-length NonO and ΔC225-NonO proteins are exclusively localized in the nucleus, while the other truncated proteins were detected in both the nucleus and cytosol to varying extent (Supplementary Material, Fig. S2).

ChIP-seq analysis reveals binding of NonO to rhodopsin and a subset of phototransduction genes

To further assess the role of NonO in photoreceptor homeostasis, we performed ChIP-seq analysis to map genome-wide NonO occupancy in P28 mouse retina (see www.nei.nih.gov/intramural/nnrl/nonochipseq/ for complete sequence reads). We identified 3989 NonO-binding sites (hereafter referred to as ‘peaks’); of these, 19% of NonO peaks were detected within the promoter regions (Fig. 3A), and almost 30% overlapped with the reported Nrl and Crx ChIP-seq peaks (38,39) (Fig. 3B and C). NonO peaks were enriched around TSS (Fig. 3D).

Figure 3.

Genome-wide occupancy of NonO by ChIP-Seq. (A) Venn diagram showing the percentage of NonO ChIP-seq peak distribution in different genomic regions. (B) Overlap of NonO ChIP-seq peaks with Nrl ChIP-seq peaks. (C) Overlap of NonO ChIP-seq peaks with Crx ChIP-seq peaks. (D) The correlation of global NonO ChIP-seq peaks with TSS. (E) The correlation of NonO ChIP-seq peaks with global expression levels. The NonO-associated genes were grouped based on the levels of expression (as indicated by FPKM values) from RNA-seq data obtained from adult mouse retina. Enrichment score was calculated as a ratio of NonO-associated genes within each group to the total number of NonO genes. Highly expressed genes (FPKM > 25) show 2-fold or more enrichment among NonO-bound genes at P < 0.01.

Figure 3.

Genome-wide occupancy of NonO by ChIP-Seq. (A) Venn diagram showing the percentage of NonO ChIP-seq peak distribution in different genomic regions. (B) Overlap of NonO ChIP-seq peaks with Nrl ChIP-seq peaks. (C) Overlap of NonO ChIP-seq peaks with Crx ChIP-seq peaks. (D) The correlation of global NonO ChIP-seq peaks with TSS. (E) The correlation of NonO ChIP-seq peaks with global expression levels. The NonO-associated genes were grouped based on the levels of expression (as indicated by FPKM values) from RNA-seq data obtained from adult mouse retina. Enrichment score was calculated as a ratio of NonO-associated genes within each group to the total number of NonO genes. Highly expressed genes (FPKM > 25) show 2-fold or more enrichment among NonO-bound genes at P < 0.01.

Integrated analysis of NonO ChIP-seq peaks with RNA-seq data from the adult mouse retina (40) revealed a positive correlation between NonO-binding and gene expression levels (Fig. 3E). Among the highly expressed retinal genes, photoreceptor-specific functions were more enriched in NonO-associated genes compared with non-NonO occupied genes (Supplementary Material, Tables S1 and S2). NonO ChIP-seq peaks were present near most photoreceptor genes, including Nrl and Crx, and their targets such as rhodopsin (Rho), orphan nuclear receptor Nr2e3 and estrogen-related receptor β (Esrrβ) (Fig. 4A and B). An independent qPCR analysis of NonO ChIP-DNA from mouse retina further validated several distinct NonO ChIP-seq peaks in the rhodopsin gene, including one near TSS and another in RER (Fig. 4B). Thus, our data demonstrate specific binding of NonO to rhodopsin and other phototransduction genes in the mature retina in vivo.

Figure 4.

Visualization of NonO ChIP-seq peaks on rod-expressed genes and their correlation with Nrl and Crx ChIP-seq peaks. (A) NonO ChIP-seq peaks at transcription factor genes expressed in rod photoreceptors—Crx, Nrl, Nr2e3 and Esrrb. Gene structures are shown below the peaks. (B) NonO Chip-seq peaks at the rhodopsin promoter (left), and validation of different NonO peak regions in rhodopsin by ChIP-qPCR (right). A genomic DNA region of MyoD (non-retinal gene) was used as a negative control.

Figure 4.

Visualization of NonO ChIP-seq peaks on rod-expressed genes and their correlation with Nrl and Crx ChIP-seq peaks. (A) NonO ChIP-seq peaks at transcription factor genes expressed in rod photoreceptors—Crx, Nrl, Nr2e3 and Esrrb. Gene structures are shown below the peaks. (B) NonO Chip-seq peaks at the rhodopsin promoter (left), and validation of different NonO peak regions in rhodopsin by ChIP-qPCR (right). A genomic DNA region of MyoD (non-retinal gene) was used as a negative control.

NonO is required for rod photoreceptor survival

To directly investigate the role of NonO in rhodopsin gene regulation, we used shRNA to knockdown NonO in postnatal day (P)0 mouse retina by in vivo electroporation. The efficacy of NonO shRNA was first assessed in HEK293 cells (Supplementary Material, Fig. S3). P0 mouse retina was transfected in vivo with two constructs—2.2 kb bovine rhodopsin promoter driving DsRed reporter (to mark the transfected rods) and either control or NonO shRNA-GFP plasmid carrying a GFP reporter under the control of a ubiquitous promoter (to mark all transfected cells). At P5, almost all of the cells expressing the GFP transgene in the outer nuclear layer (ONL) were also positive for the DsRed reporter in both NonO shRNA-GFP and control-shRNA-GFP transfected retina. However, at P10, only 40% of the GFP+ cells in ONL revealed DsRed reporter expression in NonO shRNA-GFP transfected retina compared with the control (Fig. 5A and B), and only few co-labeled cells remained at P21. These results can be explained by reduced rhodopsin promoter activity and/or by progressive rod death in NonO-knockdown retina; the latter was validated by a strong immunostaining of active caspase-3 in P7 NonO shRNA-GFP transfected retina (data not shown). No change was detected in transfected cells between P10 and P21 retina when control-shRNA-GFP was electroporated. Co-transfection of NonO shRNA-GFP with ΔN224-NonO expression construct (see Fig. 2B) partially rescued the rod cell death (Fig. 5C and D), confirming the specificity of NonO knockdown.

Figure 5.

NonO knockdown leads to rod photoreceptor death. (A) Temporal effect of shRNA on transfected photoreceptors. The bovine rhodopsin promoter (2.2 kb) driving DsRed (Rho-DsRed) and either control or NonO shRNA-GFP construct expressing both shRNA and GFP were co-transfected in P0 mouse retina by in vivo electroporation. Expression of reporter genes was assessed in P5, P10 and P21 retina. All transfected cells expressing either shRNA are green, but only rods among those transfected cells would express rhodopsin promoter driven DsRed and are red. Nuclei were stained with DAPI. Left and right panels show results of control and NonO shRNA, respectively. White arrowheads indicate GFP and DsRed double-positive cells. ONL, outer nuclear layer of photoreceptors; INL, inner nuclear layer; GCL, ganglion cell layer. Scale bar: 20 μm. (B) A bar graph showing quantification of the relative number of DsRed (transfected rods) and GFP (total number of transfected cells) positive cells that remain in the ONL at P5, P10 and P21. (C) Rescue of NonO knockdown induced rod death by ΔN224-NonO. Neonatal pups were co-electroporated with Rho-DsRed, ΔN224-NonO and either NonO shRNA-GFP or control-shRNA-GFP. Retinas were harvested at P10 and examined for GFP and DsRed reporter expression in the ONL. Other details are same as in (A). (D) A bar graph showing quantification of the relative number of DsRed and GFP-positive cells that remain in the ONL at P10.

Figure 5.

NonO knockdown leads to rod photoreceptor death. (A) Temporal effect of shRNA on transfected photoreceptors. The bovine rhodopsin promoter (2.2 kb) driving DsRed (Rho-DsRed) and either control or NonO shRNA-GFP construct expressing both shRNA and GFP were co-transfected in P0 mouse retina by in vivo electroporation. Expression of reporter genes was assessed in P5, P10 and P21 retina. All transfected cells expressing either shRNA are green, but only rods among those transfected cells would express rhodopsin promoter driven DsRed and are red. Nuclei were stained with DAPI. Left and right panels show results of control and NonO shRNA, respectively. White arrowheads indicate GFP and DsRed double-positive cells. ONL, outer nuclear layer of photoreceptors; INL, inner nuclear layer; GCL, ganglion cell layer. Scale bar: 20 μm. (B) A bar graph showing quantification of the relative number of DsRed (transfected rods) and GFP (total number of transfected cells) positive cells that remain in the ONL at P5, P10 and P21. (C) Rescue of NonO knockdown induced rod death by ΔN224-NonO. Neonatal pups were co-electroporated with Rho-DsRed, ΔN224-NonO and either NonO shRNA-GFP or control-shRNA-GFP. Retinas were harvested at P10 and examined for GFP and DsRed reporter expression in the ONL. Other details are same as in (A). (D) A bar graph showing quantification of the relative number of DsRed and GFP-positive cells that remain in the ONL at P10.

We further evaluated the expression of endogenous rhodopsin, by immunocytochemistry, in dissociated cells from P7 retina transfected at P0 with NonO or control-shRNA-GFP. As predicted, NonO shRNA-GFP-expressing cells had reduced or no rhodopsin immunostaining, whereas strong rhodopsin expression was detected in control-shRNA transfected cells (Fig. 6A and B).

Figure 6.

NonO knockdown decreases endogenous rhodopsin expression in in vivo transfected rods. (A) Rhodopsin staining in dissociated retinal cells transfected in vivo with control or NonO shRNA-GFP. Mouse retinas, electroporated at P0 with either control or NonO shRNA-GFP construct, were isolated at P7, and the dissociated cells were immunostained for endogenous rhodopsin. Left and right panels indicate results from control and NonO shRNA-GFP, respectively. Green fluorescence of GFP indicates total number of transfected cells, whereas red shows rhodopsin staining. Nuclei are stained with DAPI. Arrowheads indicate the transfected cells (GFP-positive) that show reduced rhodopsin in NonO shRNA panel compared with control. Scale bar: 20 μm. (B) Quantification of rhodopsin positive cells among the total transfected cells. Total number of pixels in each cell was calculated using ImageJ software for endogenous rhodopsin and for GFP (from A). Scatter plots were generated for control-shRNA-GFP (above) and NonO shRNA-GFP (below) transfected cells. Three-independent experiments were performed with five animals in each set. The data presented here are from one representative experiment.

Figure 6.

NonO knockdown decreases endogenous rhodopsin expression in in vivo transfected rods. (A) Rhodopsin staining in dissociated retinal cells transfected in vivo with control or NonO shRNA-GFP. Mouse retinas, electroporated at P0 with either control or NonO shRNA-GFP construct, were isolated at P7, and the dissociated cells were immunostained for endogenous rhodopsin. Left and right panels indicate results from control and NonO shRNA-GFP, respectively. Green fluorescence of GFP indicates total number of transfected cells, whereas red shows rhodopsin staining. Nuclei are stained with DAPI. Arrowheads indicate the transfected cells (GFP-positive) that show reduced rhodopsin in NonO shRNA panel compared with control. Scale bar: 20 μm. (B) Quantification of rhodopsin positive cells among the total transfected cells. Total number of pixels in each cell was calculated using ImageJ software for endogenous rhodopsin and for GFP (from A). Scatter plots were generated for control-shRNA-GFP (above) and NonO shRNA-GFP (below) transfected cells. Three-independent experiments were performed with five animals in each set. The data presented here are from one representative experiment.

Knockdown of NonO in developing retina leads to aberrant splicing in a subset of phototransduction genes

To investigate whether NonO can alter splicing efficiency in vivo, we knocked down NonO expression in P1 mouse retina and performed RNA-seq analysis (Supplementary Material, Table S3). As complete loss of NonO initiates cell death (see Fig. 5) by P10, we reduced the amount of NonO shRNA-GFP for electroporation and analyzed transfected area of the retinas at P8. We estimate that ∼25% of cells received the transgene based on the reported electroporation efficiency and rod cell numbers in the developing retina. As predicted, the knockdown of NonO under these conditions led to splicing defects and altered gene expression (Supplementary Material, Table S4). Gene ontology analysis revealed that phototransduction genes are highly enriched among those with splicing defects (Fig. 7A). In particular, increased intron inclusion and slight increase in total transcript levels were apparent in rhodopsin (Rho) and other phototransduction genes such as Gnb1 and Cnga1 (Fig. 7B and Supplementary Material, Table S4). However, we did not observe such defects in ubiquitously expressed genes (e.g. Hprt) or those expressed specifically in other retinal neurons (such as Grm6, a bipolar marker, or Pou4f, a ganglion cell marker) (Fig. 7C). Our data demonstrate an important role of NonO in regulation of splicing in vivo of highly expressed rod-specific genes such as rhodopsin.

Figure 7.

NonO knockdown causes splicing defects in phototransduction genes. (A) Top 10 biological processes enriched among genes that exhibit splicing defect upon NonO knockdown. Phototransduction genes are overrepresented. (B and C) RNA-seq results of P8 mouse retina transfected with NonO shRNA-GFP (blue) or control shRNA-GFP (green) and NonO occupancy in the wild-type P28 retina (black). Increased intron inclusion is apparent in a subset of phototransduction genes, such as rhodopsin (Rho), Gnb1 and Cnga1. Intronic regions with splicing defects are indicated with gray shades (B). Non-photoreceptor genes with no splicing defect by NonO knockdown (C); these are exemplified by Grm6 (bipolar neurons), Pou4f2 (ganglion cells) and Hprt (housekeeping). Two independent experiments were performed with different litters in each set. The data presented here are from one representative experiment.

Figure 7.

NonO knockdown causes splicing defects in phototransduction genes. (A) Top 10 biological processes enriched among genes that exhibit splicing defect upon NonO knockdown. Phototransduction genes are overrepresented. (B and C) RNA-seq results of P8 mouse retina transfected with NonO shRNA-GFP (blue) or control shRNA-GFP (green) and NonO occupancy in the wild-type P28 retina (black). Increased intron inclusion is apparent in a subset of phototransduction genes, such as rhodopsin (Rho), Gnb1 and Cnga1. Intronic regions with splicing defects are indicated with gray shades (B). Non-photoreceptor genes with no splicing defect by NonO knockdown (C); these are exemplified by Grm6 (bipolar neurons), Pou4f2 (ganglion cells) and Hprt (housekeeping). Two independent experiments were performed with different litters in each set. The data presented here are from one representative experiment.

Discussion

Daily turnover of 10% of photoreceptor outer segments requires a homeostatic balance of many structural and functional components that include the major disc protein rhodopsin. The expression and transport of rhodopsin must be controlled stringently; thus, multiple levels of regulation are expected. While the fundamental role of key transcription factors (including NRL, CRX and NR2E3) in controlling rod gene expression and rod differentiation is becoming clearer (38,39,41,42), the regulatory mechanisms of temporal and quantitatively precise expression of rhodopsin and other phototransduction genes are poorly understood. We now report the identification of NonO and three NonO-interacting proteins that bind to RER and modulate the expression of rhodopsin. ChIP-seq data strongly argues for the involvement of NonO and probably its interactors in controlling the expression of many rod-specific genes. Analysis of RNA-seq data also revealed aberrant splicing of a subset of phototransduction genes when NonO is knocked down in the retina in vivo. Our studies thus define additional transcriptional control components and would help in constructing gene regulatory network underlying development and homeostasis in mammalian rod photoreceptors.

NonO is a widely expressed multifunctional protein of Drosophila behavior/human splicing family, implicated in transcriptional regulation and splicing (33,37,43,44). Functional integration of transcription to splicing provides a greater control in regulatory networks (32,45,46). RNA polymerase II and transcription factors can physically or functionally interact with splicing factors and control cell-type-specific gene expression patterns (47–50). Combined analyses of ChIP-seq and gene profiling data from knockout mouse retina have demonstrated that NRL and CRX together activate the expression of most, if not all, rod photoreceptor genes (38); thus, we propose that the binding of NonO to enhancer elements (such as RER in rhodopsin) in rod-expressed genes would augment NRL- and CRX-mediated transcriptional activation (represented schematically in Fig. 8). NonO occupancy on highly expressed phototransduction genes, such as rhodopsin, in the retina indicates its role in augmenting expression levels that might be needed at the time of outer segment renewal.

Figure 8.

A schematic representation of RPPR- and RER-bound transcriptional regulatory proteins in the rhodopsin promoter-enhancer region. RER-bound transcriptional complexes containing NonO are proposed to interact with RPPR proteins (including NRL and/or CRX) by chromosomal looping and enhance the recruitment of basic transcription machinery (including RNA Pol II) to the rhodopsin promoter.

Figure 8.

A schematic representation of RPPR- and RER-bound transcriptional regulatory proteins in the rhodopsin promoter-enhancer region. RER-bound transcriptional complexes containing NonO are proposed to interact with RPPR proteins (including NRL and/or CRX) by chromosomal looping and enhance the recruitment of basic transcription machinery (including RNA Pol II) to the rhodopsin promoter.

Our model is consistent with the suggestion that RER comes in contact of RPPR by chromosome looping in rod photoreceptors but not in other cell types which do not express rhodopsin (31). In addition, the binding of NonO to transcriptional complexes (including RNA polymerase II) may accelerate accurate and concurrent splicing of rhodopsin and other NonO-bound transcripts in photoreceptors. In concordance, NonO knockdown in the developing retina in vivo revealed an enrichment of rod phototransduction genes among those showing aberrant splicing patterns by RNA-seq analysis. As an example, rhodopsin transcripts showed enhanced inclusion of intron 2 in NonO shRNA-treated retina compared with controls.

Identification of three NonO-interacting proteins, Ywhaz, Ppp1ca and hnRNP M (34,51,52), among the RER-bound proteins further argues in support of NonO's role in linking transcriptional complex(es) to splicing factors to accelerate rhodopsin expression when higher synthesis of phototransduction proteins might be required. Our data show that DNA-binding domain of NonO is essential for rhodopsin promoter transactivation, but RRMs that facilitate splicing (34) are required for complete augmentation. RRMs contain consensus binding domains for Ppp1ca that modulates distinct functions of NonO in RNA transcription and splicing (34). Activation of the rhodopsin promoter activity by Ppp1ca in the presence of NRL, CRX and NonO in HEK293 cells provides evidence in support of the hypothesis that NonO shuttles from the splicing complex to the transcriptional complex upon hypophosphorylation by Ppp1ca. Further enhancement in rhodopsin promoter activity by Ywhaz indicates its potential role in preventing dephosphorylation of NonO and other factors. The importance of splicing in photoreceptor homeostasis is illustrated by the fact that mutations in splicing factors are associated with photoreceptor degeneration (53).

Our ChIP-seq data show a number of NonO target genes that belong to circadian feedback regulatory loop, in agreement with the recent findings of abnormal circadian and neurological changes in NonO gene-trap mutant mice (54). These results are consistent with a possible role of NonO in augmenting gene expression at the time of outer segment renewal. Since loss of NonO is reported to lead to enhanced cell proliferation and decreased senescence (54,55), shRNA knockdown of NonO in neonatal retinal progenitors may hamper cell cycle exit and consequently the birth of rod photoreceptors. More significantly, altered expression and splicing of rhodopsin (and other rod genes), resulting from NonO knockdown, would likely lead to accumulation of aberrantly spliced transcripts and trigger death of rods that are already born.

In summary, we have identified NonO as a novel enhancer-binding protein that activates rhodopsin expression synergistically with two key photoreceptor transcription factors, NRL and CRX. We hypothesize that NonO and its three RER-bound interactors (Ppp1ca, Ywhaz and HnRNP M) facilitate long-range chromosome looping between RER and RPPR to enhance rhodopsin expression. In vivo occupancy of NonO on rhodopsin and selected rod phototransduction genes suggests its role in fine-tuning the expression of rod genes that are associated with outer segment morphogenesis.

MATERIALS AND METHODS

Oligonucleotides

Oligonucleotides were procured from Integrated DNA Technologies (Coralville, IA, USA). Bovine RER fragment (−2155 to −2027) was generated by PCR using the following oligonucleotides: GTCCCTCTGTCTGGCCACCAG (sense, biotin-labeled) and GGCAGGTGTGGCGGGTGGGTG (antisense). PCR-amplified RER was purified by extraction after gel electrophoresis and sequence verified. A biotin-labeled 39-mer scrambled oligonucleotide (GCAACTTCCGCTTGCAACTTCCGCTTGCAACTTCCGC TT) was used as control.

Isolation of RER-bound protein complexes

Bovine retinal nuclear fraction was prepared by differential centrifugation. Nuclear extract (300 μg) was incubated with equimolar amount of biotin-labeled RER or control oligonucleotide in binding buffer (final conc. 12 mm HEPES, pH 7.9, 60 mm KCl, 4 mm MgCl2, 1 mm EDTA, 1 mm DTT, 12% glycerol and protease inhibitor cocktail) containing poly dI-dC and salmon sperm DNA for 16 h at 4°C. Thirty microliters of mixture (50:50) of Dynabeads MyOne™ Streptavidin C1 and Dynabeads MyOne™ Streptavidin T1 (Invitrogen, Carlsbad, CA, USA) was added to the reaction for 2 h. After 10× washing of beads with binding buffer, bound proteins were eluted with 1 m KCl, separated on SDS–PAGE, and visualized by silver staining. Proteins detected in RER but not in control reaction were excised and subjected to mass spectra analysis.

Plasmid construction

Total RNA was isolated from 1-month-old C57Bl/6J mouse retina using QIAGEN kit (Qiagen, Valencia, CA, USA), and cDNA was prepared using Superscript III First-Strand Synthesis System (Invitrogen). Coding region of NonO was PCR-amplified using ATGCGGATCCATGCAGAGCAATAAAGCCTT (sense) and ATGCGCGGCCGCCTAATATCGGCGGCGTTTATTT (antisense) primers. Amplified product was gel purified and cloned into pGemT-Easy vector (Promega, Madison, WI, USA). NonO cDNA was then subcloned into pcDNA4C, a mammalian expression vector (Invitrogen). NonO deletion fragments were amplified using the primer pairs listed below and cloned in pcDNA4C.

ΔN323-NonO: ATGCGGATCCATGAGGCAGGATTTGATGAG (sense) and ATGCGCGGCCGCCTAATATCGGCGGCGTTTATTT (antisense); ΔN224-NonO: ATGCGGATCCGTGACTGTGGAGCCTATGGA (sense) and ATGCGCGGCCGCCTAATATCGGCGGCGTTTATTT (antisense); ΔC225-NonO: ATGCGGATCCATGCAGAGCAATAAAGC-CTT (sense) and ATGCGGATCCCACAGGCCGAGGAAATGTAG (antisense); DBD-NonO: TGCGGATCCGTGACTGTGGAGCCTATGGA (sense) and TTCTTGACGTCTCATCAAATCC (antisense); ΔM-NonO was constructed by cloning ΔC225-NonO fragment into ΔN323-NonO construct. Ppp1ca and Ywhaz were amplified using the primer pairs listed below and cloned in pcDNA4C.

Ppp1ca: ATGCGGATCCATGTCCGACAGCGAGAAGCT (sense) and ATGCGCGGCCGCCTATTTCTTGGCTTTGGC (antisense); Ywhaz: ATGCGGATCCATGGATAAAAATGAGCTGGT (sense) and ATGCGCGGCCGCTTAATTTTCCCCTCCTTC (antisense).

Bovine rhodopsin promoter (25) was cloned into pGL3 basic vector (Promega). GFP-expressing NonO shRNA vector (NonO shRNA-GFP) against NonO exon 2 target sequence (GACCTTTACACAGCGTAGC) and control-shRNA-GFP vector by scrambling the target sequence (AGATAACTGCGCCGTACTC) were generated in pG-Super vector (56) using the following oligonuclotides: NonO shRNA-GFP: GATCCCCGACCTTTACACAGCGTAGCTTCAAGAGAGCTACGCTGTGTAAAGGTCTTTTTGGAAA (sense) and AGCTTTTCCAAAAAGACCTTTACACAGCGTAGCTCTCTTGAAGCTACGCTGTGTAAAGGTCGGG (antisense).

Control-shRNA-GFP: GATCCCCAGATAACTGCGCCGTACTCTTCAAGAGAGAGTACGGCGCAGTTATCTTTTTTGGAAA (sense) and AGCTTTTCCAAAAAAGATAACTGCGCCGTACTCTCTCTTGAAGAGTACGGCGCAGTTATCTGGG (antisense).

All constructs were verified by sequencing.

Luciferase reporter assays

Dual luciferase reporter assays (Promega) were performed using HEK293 cells as described (57). The data from three-independent experiments was analyzed using Student's t-test, and P < 0.05 was considered significant.

Immunoprecipitation

Bovine retinas were cross-linked with 5 mm dimethyl 3,3′-dithiobis propionimidate *2HC (Thermo Scientific Pierce, Rockford, IL, USA) on ice for 1 h. The reaction was stopped by adding 1 m Tris (pH 7.5) for 20 min. Retinas were washed with PBS and homogenized, and nuclear fraction was prepared by differential centrifugation in the presence of protease and phosphatase inhibitors (Roche Applied Bioscience, Indianapolis, IN, USA). For immunoprecipitation, nuclear fraction was incubated with a specific antibody or IgG (control) at 4°C. After overnight incubation, Protein A Dynabeads (30 μl) were added for 2 h to allow the binding of protein complexes. Beads were washed five times, and bound protein complexes were eluted in 0.2 m glycine (pH 2.5) and neutralized by 1 m Tris (pH 9.0). Immunoblot analysis of eluted proteins was performed as described (57). The following antibodies were used: rabbit anti-NonO (Protein Tech, Chicago, IL, USA), anti-hnRNPM (Santa Cruz Biotechnologies, Santa Cruz, CA, USA), RNA Pol II (Abcam, Cambridge, MA, USA). Anti-Pou4f2 antibody was a gift from Tudor Badea.

In vitro knockdown of NonO in HEK293 cells

We designed an shRNA targeting the exon 2 of the mouse NonO gene as reported earlier (58) and a scrambled control-shRNA. The shRNA constructs contained a GFP reporter driven by signal recognition particle receptor promoter, while the shRNA hairpin was driven by histone H1 promoter. HEK293 cells were transfected with either NonO shRNA-GFP or control shRNA-GFP along with NonO-pcDNA4c expression construct. After 48 h, cells were harvested, washed with PBS and lysed in RIPA buffer. Immunoblots (10 μg of protein) were probed with anti-Xpress or anti-NonO antibodies. Anti-β-actin antibody was used as control.

In vivo electroporation

Neonatal CD-1 mice (Charles River, Wilmington, MA, USA) were used for in vivo transfection by electroporation (59). Equimolar amounts of plasmids (10 μg/μl; 0.2 μl) were used for co-transfection studies. Transfected eyeballs were harvested at different times for immunohistochemical analysis. For some experiments, P0 retinas (electroporated with NonO or control-shRNA-GFP) were collected at P7 and subjected to dissociation protocols using trypsin. An equal number of cells on eight-chamber slides were then stained for endogenous rhodopsin. GFP (green, which marks the shRNA transfected cells) and rhodopsin (red) signals were recorded using confocal microscope, and pixel intensity of green and red signal in each cell was calculated using ImageJ software (rsbweb.nih.gov/ij/). Total numbers of green (shRNA-GFP) and red (endogenous rhodopsin) pixel intensity in each cell were plotted for control and NonO shRNA-GFP electroporated cells.

Immunohistochemistry

Cryosections were probed with specific antibodies as described (60) and visualized using Leica SP5 confocal laser scanning unit (Leica Microsystem Inc., Buffalo Grove, IL, USA).

ChIP-seq

C57Bl/6J mice were housed in 12 h light and 12 h dark cycles. The retinas were dissected at light onset and fixed with formaldehyde. ChIP was performed using anti-NonO antibody, followed by deep sequencing using Illumina GAIIx. ChIP-seq libraries were constructed and sequenced, as previously described (38). Raw sequencing reads from NonO ChIP DNA and input DNA were mapped to the mouse genome (NCBI build 37) using Genomatix Mining Station (GMS), and ChIP-seq peaks were called using MACS (61). NonO ChIP-seq peaks were compared with NRL ChIP-seq (38) and CRX ChIP-seq peak regions (39) using GenomeInspector (Genomatix). NonO ChIP-seq peaks were assigned to nearby genes by proximity (within 5 kb). Enriched biological processes were analyzed using Genomatix software and ranked by P-value.

RNA-seq

P1 retinas of C57Bl/6J mice were transfected in vivo with NonO or control-shRNA-GFP (2.5 µg/µl; 0.2 µl) by electroporation, as described above, and harvested at P8. The transfected area of the retina was identified by GFP fluorescence and excised out for RNA-seq analysis. Total RNA was extracted using TRIzol reagent (Life Technologies, Gaithersburg, MD, USA), followed by RNeasy mini columns (Qiagen). Directional RNA-seq libraries were constructed with 30 ng RNA and sequenced on Illumina GAIIx platform, as previously described (62). Sequence reads were aligned to the mouse genome (NCBI build 38) using GMS, and uniquely mapped reads were used for subsequent analysis. Differential expression analysis was carried out using Genomatix Genome Analyzer, and sequence reads over splice junctions were viewed in SeqMonk software.

SUPPLEMENTARY MATERIAL

Supplementary Material is available at HMG online.

FUNDING

This work was supported by intramural research program of the National Eye Institute.

ACKNOWLEDGEMENTS

We are grateful to Garry G. Borisy for the generous gift of shRNA vector pG-Super. We thank Douglas Forrest, Tiziana Cogliati, Tudor Badea, Chunqiao Liu, Jerome Roger, Shobi Veleri, Radu Cojocaru and James Friedman for constructive advice and comments.

REFERENCES

1
Bulger
M.
Groudine
M.
Enhancers: the abundance and function of regulatory sequences beyond promoters
Dev. Biol.
 , 
2010
, vol. 
339
 (pg. 
250
-
257
)
2
Roy
A.L.
Sen
R.
Roeder
R.G.
Enhancer-promoter communication and transcriptional regulation of Igh
Trends Immunol.
 , 
2011
, vol. 
32
 (pg. 
532
-
539
)
3
Banerji
J.
Rusconi
S.
Schaffner
W.
Expression of a beta-globin gene is enhanced by remote SV40 DNA sequences
Cell
 , 
1981
, vol. 
27
 (pg. 
299
-
308
)
4
Visel
A.
Rubin
E.M.
Pennacchio
L.A.
Genomic views of distant-acting enhancers
Nature
 , 
2009
, vol. 
461
 (pg. 
199
-
205
)
5
Ravasi
T.
Suzuki
H.
Cannistraci
C.V.
Katayama
S.
Bajic
V.B.
Tan
K.
Akalin
A.
Schmeier
S.
Kanamori-Katayama
M.
Bertin
N.
, et al.  . 
An atlas of combinatorial transcriptional regulation in mouse and man
Cell
 , 
2010
, vol. 
140
 (pg. 
744
-
752
)
6
Boffelli
D.
Nobrega
M.A.
Rubin
E.M.
Comparative genomics at the vertebrate extremes
Nat. Rev. Genet.
 , 
2004
, vol. 
5
 (pg. 
456
-
465
)
7
Levine
M.
Tjian
R.
Transcription regulation and animal diversity
Nature
 , 
2003
, vol. 
424
 (pg. 
147
-
151
)
8
Manolio
T.A.
Collins
F.S.
Cox
N.J.
Goldstein
D.B.
Hindorff
L.A.
Hunter
D.J.
McCarthy
M.I.
Ramos
E.M.
Cardon
L.R.
Chakravarti
A.
, et al.  . 
Finding the missing heritability of complex diseases
Nature
 , 
2009
, vol. 
461
 (pg. 
747
-
753
)
9
Lamb
T.D.
Collin
S.P.
Pugh
E.N.
Jr
Evolution of the vertebrate eye: opsins, photoreceptors, retina and eye cup
Nat. Rev. Neurosci.
 , 
2007
, vol. 
8
 (pg. 
960
-
976
)
10
Teirstein
P.S.
Goldman
A.I.
O'Brien
P.J.
Evidence for both local and central regulation of rat rod outer segment disc shedding
Invest. Ophthalmol. Vis. Sci.
 , 
1980
, vol. 
19
 (pg. 
1268
-
1273
)
11
LaVail
M.M.
Rod outer segment disk shedding in rat retina: relationship to cyclic lighting
Science
 , 
1976
, vol. 
194
 (pg. 
1071
-
1074
)
12
Young
R.W.
Visual cells and the concept of renewal
Invest. Ophthalmol. Vis. Sci.
 , 
1976
, vol. 
15
 (pg. 
700
-
725
)
13
Bobu
C.
Hicks
D.
Regulation of retinal photoreceptor phagocytosis in a diurnal mammal by circadian clocks and ambient lighting
Invest. Ophthalmol. Vis. Sci.
 , 
2009
, vol. 
50
 (pg. 
3495
-
3502
)
14
Young
R.W.
Visual cells, daily rhythms, and vision research
Vision Res.
 , 
1978
, vol. 
18
 (pg. 
573
-
578
)
15
Besharse
J.C.
Hollyfield
J.G.
Turnover of mouse photoreceptor outer segments in constant light and darkness
Invest. Ophthalmol. Vis. Sci.
 , 
1979
, vol. 
18
 (pg. 
1019
-
1024
)
16
Palczewski
K.
G protein-coupled receptor rhodopsin
Annu. Rev. Biochem.
 , 
2006
, vol. 
75
 (pg. 
743
-
767
)
17
Yu
C.J.
Gao
Y.
Li
P.
Li
L.
Synchronizing multiphasic circadian rhythms of rhodopsin promoter expression in rod photoreceptor cells
J. Exp. Biol.
 , 
2007
, vol. 
210
 (pg. 
676
-
684
)
18
von Schantz
M.
Lucas
R.J.
Foster
R.G.
Circadian oscillation of photopigment transcript levels in the mouse retina
Brain Res. Mol. Brain Res.
 , 
1999
, vol. 
72
 (pg. 
108
-
114
)
19
Korenbrot
J.I.
Fernald
R.D.
Circadian rhythm and light regulate opsin mRNA in rod photoreceptors
Nature
 , 
1989
, vol. 
337
 (pg. 
454
-
457
)
20
Sung
C.H.
Davenport
C.M.
Nathans
J.
Rhodopsin mutations responsible for autosomal dominant retinitis pigmentosa. Clustering of functional classes along the polypeptide chain
J. Biol. Chem.
 , 
1993
, vol. 
268
 (pg. 
26645
-
26649
)
21
Price
B.A.
Sandoval
I.M.
Chan
F.
Nichols
R.
Roman-Sanchez
R.
Wensel
T.G.
Wilson
J.H.
Rhodopsin gene expression determines rod outer segment size and rod cell resistance to a dominant-negative neurodegeneration mutant
PLoS ONE
 , 
2012
, vol. 
7
 pg. 
e49889
 
22
Tan
E.
Wang
Q.
Quiambao
A.B.
Xu
X.
Qtaishat
N.M.
Peachey
N.S.
Lem
J.
Fliesler
S.J.
Pepperberg
D.R.
Naash
M.I.
, et al.  . 
The relationship between opsin overexpression and photoreceptor degeneration
Invest. Ophthalmol. Vis. Sci.
 , 
2001
, vol. 
42
 (pg. 
589
-
600
)
23
Mendes
H.F.
van der Spuy
J.
Chapple
J.P.
Cheetham
M.E.
Mechanisms of cell death in rhodopsin retinitis pigmentosa: implications for therapy
Trends Mol. Med.
 , 
2005
, vol. 
11
 (pg. 
177
-
185
)
24
Nie
Z.
Chen
S.
Kumar
R.
Zack
D.J.
RER, an evolutionarily conserved sequence upstream of the rhodopsin gene, has enhancer activity
J. Biol. Chem.
 , 
1996
, vol. 
271
 (pg. 
2667
-
2675
)
25
Zack
D.J.
Bennett
J.
Wang
Y.
Davenport
C.
Klaunberg
B.
Gearhart
J.
Nathans
J.
Unusual topography of bovine rhodopsin promoter-lacZ fusion gene expression in transgenic mouse retinas
Neuron
 , 
1991
, vol. 
6
 (pg. 
187
-
199
)
26
Mitton
K.P.
Swain
P.K.
Chen
S.
Xu
S.
Zack
D.J.
Swaroop
A.
The leucine zipper of NRL interacts with the CRX homeodomain. A possible mechanism of transcriptional synergy in rhodopsin regulation
J. Biol. Chem.
 , 
2000
, vol. 
275
 (pg. 
29794
-
29799
)
27
Mears
A.J.
Kondo
M.
Swain
P.K.
Takada
Y.
Bush
R.A.
Saunders
T.L.
Sieving
P.A.
Swaroop
A.
Nrl is required for rod photoreceptor development
Nat. Genet.
 , 
2001
, vol. 
29
 (pg. 
447
-
452
)
28
Oh
E.C.
Khan
N.
Novelli
E.
Khanna
H.
Strettoi
E.
Swaroop
A.
Transformation of cone precursors to functional rod photoreceptors by bZIP transcription factor NRL
Proc. Natl. Acad. Sci. USA
 , 
2007
, vol. 
104
 (pg. 
1679
-
1684
)
29
Furukawa
T.
Morrow
E.M.
Li
T.
Davis
F.C.
Cepko
C.L.
Retinopathy and attenuated circadian entrainment in Crx-deficient mice
Nat. Genet.
 , 
1999
, vol. 
23
 (pg. 
466
-
470
)
30
Woodford
B.J.
Chen
J.
Simon
M.I.
Expression of rhodopsin promoter transgene product in both rods and cones
Exp. Eye Res.
 , 
1994
, vol. 
58
 (pg. 
631
-
635
)
31
Peng
G.H.
Chen
S.
Active opsin loci adopt intrachromosomal loops that depend on the photoreceptor transcription factor network
Proc. Natl. Acad. Sci. USA
 , 
2011
, vol. 
108
 (pg. 
17821
-
17826
)
32
Montes
M.
Becerra
S.
Sanchez-Alvarez
M.
Sune
C.
Functional coupling of transcription and splicing
Gene
 , 
2012
, vol. 
501
 (pg. 
104
-
117
)
33
Emili
A.
Shales
M.
McCracken
S.
Xie
W.
Tucker
P.W.
Kobayashi
R.
Blencowe
B.J.
Ingles
C.J.
Splicing and transcription-associated proteins PSF and p54nrb/nonO bind to the RNA polymerase II CTD
RNA
 , 
2002
, vol. 
8
 (pg. 
1102
-
1111
)
34
Liu
L.
Xie
N.
Rennie
P.
Challis
J.R.
Gleave
M.
Lye
S.J.
Dong
X.
Consensus PP1 binding motifs regulate transcriptional corepression and alternative RNA splicing activities of the steroid receptor coregulators, p54nrb and PSF
Mol. Endocrinol.
 , 
2011
, vol. 
25
 (pg. 
1197
-
1210
)
35
Wu
X.
Yoo
Y.
Okuhama
N.N.
Tucker
P.W.
Liu
G.
Guan
J.L.
Regulation of RNA-polymerase-II-dependent transcription by N-WASP and its nuclear-binding partners
Nat. Cell Biol.
 , 
2006
, vol. 
8
 (pg. 
756
-
763
)
36
Fox
A.H.
Lamond
A.I.
Paraspeckles
Cold Spring Harb. Perspect. Biol.
 , 
2010
, vol. 
2
 pg. 
a000687
 
37
Yang
Y.S.
Hanke
J.H.
Carayannopoulos
L.
Craft
C.M.
Capra
J.D.
Tucker
P.W.
NonO, a non-POU-domain-containing, octamer-binding protein, is the mammalian homolog of Drosophila nonAdiss
Mol. Cell. Biol.
 , 
1993
, vol. 
13
 (pg. 
5593
-
5603
)
38
Hao
H.
Kim
D.S.
Klocke
B.
Johnson
K.R.
Cui
K.
Gotoh
N.
Zang
C.
Gregorski
J.
Gieser
L.
Peng
W.
, et al.  . 
Transcriptional regulation of rod photoreceptor homeostasis revealed by in vivo NRL targetome analysis
PLoS Genet.
 , 
2012
, vol. 
8
 pg. 
e1002649
 
39
Corbo
J.C.
Lawrence
K.A.
Karlstetter
M.
Myers
C.A.
Abdelaziz
M.
Dirkes
W.
Weigelt
K.
Seifert
M.
Benes
V.
Fritsche
L.G.
, et al.  . 
CRX ChIP-seq reveals the cis-regulatory architecture of mouse photoreceptors
Genome Res.
 , 
2010
, vol. 
20
 (pg. 
1512
-
1525
)
40
Brooks
M.J.
Rajasimha
H.K.
Roger
J.E.
Swaroop
A.
Next-generation sequencing facilitates quantitative analysis of wild-type and Nrl(−/−) retinal transcriptomes
Mol. Vis.
 , 
2011
, vol. 
17
 (pg. 
3034
-
3054
)
41
Swaroop
A.
Kim
D.
Forrest
D.
Transcriptional regulation of photoreceptor development and homeostasis in the mammalian retina
Nat. Rev. Neurosci.
 , 
2010
, vol. 
11
 (pg. 
563
-
576
)
42
Cheng
H.
Aleman
T.S.
Cideciyan
A.V.
Khanna
R.
Jacobson
S.G.
Swaroop
A.
In vivo function of the orphan nuclear receptor NR2E3 in establishing photoreceptor identity during mammalian retinal development
Hum. Mol. Genet.
 , 
2006
, vol. 
15
 (pg. 
2588
-
2602
)
43
Amelio
A.L.
Miraglia
L.J.
Conkright
J.J.
Mercer
B.A.
Batalov
S.
Cavett
V.
Orth
A.P.
Busby
J.
Hogenesch
J.B.
Conkright
M.D.
A coactivator trap identifies NONO (p54nrb) as a component of the cAMP-signaling pathway
Proc. Natl. Acad. Sci. USA
 , 
2007
, vol. 
104
 (pg. 
20314
-
20319
)
44
Passon
D.M.
Lee
M.
Rackham
O.
Stanley
W.A.
Sadowska
A.
Filipovska
A.
Fox
A.H.
Bond
C.S.
Structure of the heterodimer of human NONO and paraspeckle protein component 1 and analysis of its role in subnuclear body formation
Proc. Natl. Acad. Sci. USA
 , 
2012
, vol. 
109
 (pg. 
4846
-
4850
)
45
Bentley
D.L.
Rules of engagement: co-transcriptional recruitment of pre-mRNA processing factors
Curr. Opin. Cell Biol.
 , 
2005
, vol. 
17
 (pg. 
251
-
256
)
46
Reed
R.
Coupling transcription, splicing and mRNA export
Curr. Opin. Cell Biol.
 , 
2003
, vol. 
15
 (pg. 
326
-
331
)
47
Yuryev
A.
Patturajan
M.
Litingtung
Y.
Joshi
R.V.
Gentile
C.
Gebara
M.
Corden
J.L.
The C-terminal domain of the largest subunit of RNA polymerase II interacts with a novel set of serine/arginine-rich proteins
Proc. Natl. Acad. Sci. USA
 , 
1996
, vol. 
93
 (pg. 
6975
-
6980
)
48
Auboeuf
D.
Batsche
E.
Dutertre
M.
Muchardt
C.
O'Malley
B.W.
Coregulators: transducing signal from transcription to alternative splicing
Trends Endocrinol. Metab.
 , 
2007
, vol. 
18
 (pg. 
122
-
129
)
49
Das
R.
Yu
J.
Zhang
Z.
Gygi
M.P.
Krainer
A.R.
Gygi
S.P.
Reed
R.
SR proteins function in coupling RNAP II transcription to pre-mRNA splicing
Mol. Cell
 , 
2007
, vol. 
26
 (pg. 
867
-
881
)
50
Misteli
T.
Spector
D.L.
RNA polymerase II targets pre-mRNA splicing factors to transcription sites in vivo
Mol. Cell
 , 
1999
, vol. 
3
 (pg. 
697
-
705
)
51
Marko
M.
Leichter
M.
Patrinou-Georgoula
M.
Guialis
A.
hnRNP M interacts with PSF and p54(nrb) and co-localizes within defined nuclear structures
Exp. Cell Res.
 , 
2010
, vol. 
316
 (pg. 
390
-
400
)
52
Close
P.
East
P.
Dirac-Svejstrup
A.B.
Hartmann
H.
Heron
M.
Maslen
S.
Chariot
A.
Soding
J.
Skehel
M.
Svejstrup
J.Q.
DBIRD complex integrates alternative mRNA splicing with RNA polymerase II transcript elongation
Nature
 , 
2012
, vol. 
484
 (pg. 
386
-
389
)
53
Wright
A.F.
Chakarova
C.F.
Abd El-Aziz
M.M.
Bhattacharya
S.S.
Photoreceptor degeneration: genetic and mechanistic dissection of a complex trait
Nat. Rev. Genet.
 , 
2010
, vol. 
11
 (pg. 
273
-
284
)
54
Kowalska
E.
Ripperger
J.A.
Muheim
C.
Maier
B.
Kurihara
Y.
Fox
A.H.
Kramer
A.
Brown
S.A.
Distinct roles of DBHS family members in the circadian transcriptional feedback loop
Mol. Cell. Biol.
 , 
2012
, vol. 
32
 (pg. 
4585
-
4594
)
55
Kowalska
E.
Ripperger
J.A.
Hoegger
D.C.
Bruegger
P.
Buch
T.
Birchler
T.
Mueller
A.
Albrecht
U.
Contaldo
C.
Brown
S.A.
NONO couples the circadian clock to the cell cycle
Proc. Natl. Acad. Sci. USA
 , 
2013
, vol. 
110
 (pg. 
1592
-
1599
)
56
Kojima
S.-i.
Vignjevic
D.
Borisy
G.G.
Improved silencing vector co-expressing GFP and small hairpin RNA
BioTechniques
 , 
2004
, vol. 
36
 (pg. 
74
-
79
)
57
Roger
J.E.
Nellissery
J.
Kim
D.S.
Swaroop
A.
Sumoylation of bZIP transcription factor NRL modulates target gene expression during photoreceptor differentiation
J. Biol. Chem.
 , 
2010
, vol. 
285
 (pg. 
25637
-
25644
)
58
Hata
K.
Nishimura
R.
Muramatsu
S.
Matsuda
A.
Matsubara
T.
Amano
K.
Ikeda
F.
Harley
V.R.
Yoneda
T.
Paraspeckle protein p54nrb links Sox9-mediated transcription with RNA processing during chondrogenesis in mice
J. Clin. Invest.
 , 
2008
, vol. 
118
 (pg. 
3098
-
3108
)
59
Matsuda
T.
Cepko
C.L.
Electroporation and RNA interference in the rodent retina in vivo and in vitro
Proc. Natl. Acad. Sci. USA
 , 
2004
, vol. 
101
 (pg. 
16
-
22
)
60
Roger
J.E.
Ranganath
K.
Zhao
L.
Cojocaru
R.I.
Brooks
M.
Gotoh
N.
Veleri
S.
Hiriyanna
A.
Rachel
R.A.
Campos
M.M.
, et al.  . 
Preservation of cone photoreceptors after a rapid yet transient degeneration and remodeling in cone-only Nrl−/− mouse retina
J. Neurosci.
 , 
2012
, vol. 
32
 (pg. 
528
-
541
)
61
Zhang
Y.
Liu
T.
Meyer
C.A.
Eeckhoute
J.
Johnson
D.S.
Bernstein
B.E.
Nusbaum
C.
Myers
R.M.
Brown
M.
Li
W.
, et al.  . 
Model-based analysis of ChIP-Seq (MACS)
Genome Biol.
 , 
2008
, vol. 
9
 pg. 
R137
 
62
Brooks
M.J.
Rajasimha
H.K.
Swaroop
A.
Retinal transcriptome profiling by directional next-generation sequencing using 100 ng of total RNA
Methods Mol. Biol.
 , 
2012
, vol. 
884
 (pg. 
319
-
334
)

Author notes

Present address: Department of Cell Biology and Human Anatomy, University of California at Davis, School of Medicine, Davis, CA 95616, USA.

Supplementary data