Schwann cells are myelinating glia in the peripheral nervous system that form the myelin sheath. A major cause of peripheral neuropathy is a copy number variant involving the Peripheral Myelin Protein 22 (PMP22) gene, which is located within a 1.4-Mb duplication on chromosome 17 associated with the most common form of Charcot-Marie-Tooth Disease (CMT1A). Rodent models of CMT1A have been used to show that reducing Pmp22 overexpression mitigates several aspects of a CMT1A-related phenotype. Mechanistic studies of Pmp22 regulation identified enhancers regulated by the Sox10 (SRY sex determining region Y-box 10) and Egr2/Krox20 (Early growth response protein 2) transcription factors in myelinated nerves. However, relatively little is known regarding how other transcription factors induce Pmp22 expression during Schwann cell development and myelination. Here, we examined Pmp22 enhancers as a function of cell type-specificity, nerve injury and development. While Pmp22 enhancers marked by active histone modifications were lost or remodeled after injury, we found that these enhancers were permissive in early development prior to Pmp22 upregulation. Pmp22 enhancers contain binding motifs for TEA domain (Tead) transcription factors of the Hippo signaling pathway. We discovered that Tead1 and co-activators Yap and Taz are required for Pmp22 expression, as well as for the expression of Egr2. Tead1 directly binds Pmp22 and Egr2 enhancers early in development and Tead1 binding is induced during myelination, correlating with Pmp22 expression. The data identify Tead1 as a novel regulator of Pmp22 expression during development in concert with Sox10 and Egr2.

Introduction

The most common form of hereditary peripheral neuropathy Charcot-Marie-Tooth (CMT) Type 1A (CMT1A) results from a 1.4-Mb duplication on chromosome 17, which contains the abundantly expressed myelin gene Peripheral Myelin Protein 22 (PMP22) (1–3). Pmp22 is highly expressed in Schwann cells, which form the lipid-rich myelin sheath that wraps axons and maintains axonal integrity in the peripheral nervous system. Genetic aberrations in myelin genes and regulators lead to demyelinating and dysmyelinating diseases, including CMT disease (4,5), thus a better understanding of transcriptional regulation for critical genes is needed (6,7). Studies of CMT1A rodent models have shown that reducing the level of Pmp22 transcription mitigates the consequences of Pmp22 overexpression (8–10). The gene dosage sensitivity of PMP22 is also shown by the fact that reciprocal deletion of the chromosome 17 segment causes another type of neuropathy, Hereditary Neuropathy with liability to Pressure Palsies (11,12).

Since regulation of Pmp22 expression is a major target of therapeutic discovery for CMT1A (13,14), we used chromatin immunoprecipitation (ChIP) techniques to map a series of enhancers regulating the Pmp22 gene (15,16). Pmp22 expression is coordinated by enhancers near the gene (15,17), as well as distal enhancers (16) that reside within a duplicated region, excluding the Pmp22 gene itself (hg36 chr17:15,143,663–15,311,619), found in patients with a mild form of CMT (18,19). Several of these enhancers are bound by two transcription factors required for Schwann cell differentiation: Sox10 (SRY sex determining region Y-box 10) and Egr2/Krox20 (Early growth response protein 2) (20,21).

Sox10 is expressed throughout all stages of Schwann cell development and is necessary for embryonic and mature Schwann cell differentiation (20,22–25). In promyelinating cells, Sox10 upregulates expression of Egr2 (26–29). Egr2 is required for myelination and myelin maintenance, and activates a number of myelin-associated genes (21,30,31). Egr2 functions synergistically with Sox10 to upregulate Pmp22, as well as other myelin genes such as Myelin protein zero (Mpz) (7,16,32–34). However, genome-wide analysis revealed that <10% of Sox10 binding events overlap with Egr2 (34), suggesting that Sox10 activates genes in coordination with other transcription factors.

Our previous studies focused on Pmp22 enhancers in myelinating peripheral nerve, yet it remains unclear how Pmp22 expression is developmentally regulated in response to physiological signaling pathways driving myelination. Furthermore, it is also expected that other transcription factors, besides Sox10 and Egr2, are responsible for the extremely high levels of Pmp22 expression in myelinating peripheral nerve. Here, we broaden our approach in studying Pmp22 regulation by examining enhancers as a function of cell type- and tissue-specificity, which has revealed a novel pathway of Pmp22 gene induction.

Results

H3K27ac-marked enhancers correlate with Pmp22 expression

Several enhancers direct the expression of Pmp22 in Schwann cells (15–17,35,36), and recent in vivo ChIP-Seq studies showed that actively engaged enhancers are marked by histone 3 lysine 27 acetylation (H3K27ac) (37,38). To determine if enhancers correlate with Pmp22 expression, we used ChIP-Seq datasets to reveal their formation as a function of cell type-specificity (39) and nerve cut injury (40). While one of the major regulators of Pmp22, Sox10, is expressed in oligodendrocytes (41), the overall expression level of Pmp22 in oligodendrocytes in spinal cord is relatively low compared with peripheral nerve (42,43). We found that many Sox10-bound enhancers far upstream of the gene locus, as well as a couple nearby, were unique to post-natal day 15 (P15) rat sciatic nerve (Fig. 1A), compared with spinal cord (Fig. 1B) and H3K27ac peaks in oligodendrocytes (44) were absent at most such positions. In addition, the expression levels of Pmp22 and other myelin genes decline precipitously after nerve injury (43), and we also found that most Pmp22 enhancers were dramatically reduced at 3 days after nerve cut injury (Fig. 1C). Notably, the enhancer at −162 kb was still prominent after injury, but it appeared to have been nonetheless affected as the enrichment peak narrowed substantially compared with the sham control. Overall, these data indicate that the peripheral nerve enhancers are closely correlated with Pmp22 expression in a cell type-specific and stage-specific manner.

Figure 1.

H3K27ac-marked enhancers correlate with Pmp22 expression. ChIP-Seq analysis depicts genomic regions enriched with transcriptional regulators and enhancers in P15 rat (A) sciatic nerve and (B) spinal cord. Included are binding profiles of the Schwann cell and oligodendrocyte master regulator Sox10, as well as the Schwann cell-specific regulator Egr2. Profiles of H3K27ac and the oligodendrocyte-specific regulator Olig2 in cultured oligodendrocytes (OL) were obtained from published datasets (44). H3K27ac-enriched enhancers specific to sciatic nerve are indicated by grey boxes. (C) ChIP-Seq analysis depicts enrichment of histone H3K27 acetylation in P25 rat sham versus cut sciatic nerve (3 days after transection). Enhancers lost upon nerve injury are indicated by grey boxes. (D) ChIP-Seq analysis of H3K4me3 enrichment in adult sciatic nerve identifies active promoters of expressed genes. The overlapping segments of two duplicated regions (hg36 chr17:15,143,663–15,311,619; rn5 chr10:49,146,632-49,288,636) found in patients with a mild form of CMT (18,19) is shown as a red thick line. Previously characterized Pmp22 enhancers are labeled in (A–C), which includes the upstream sites A, B and C (16), as well as sites at −7 kb and +11 kb (15,17). H3K27ac-enrichment also reveals an enhancer at − 18 kb, as well as additional upstream enhancers (−162, −134, −128, −108, −104 kb) within the duplicated region. Marked genomic regions are listed with respect to the Pmp22 translation start site. Note that Cdrt4 and Tekt3 genes located within the duplicated region are not expressed in peripheral nerve (16).

Figure 1.

H3K27ac-marked enhancers correlate with Pmp22 expression. ChIP-Seq analysis depicts genomic regions enriched with transcriptional regulators and enhancers in P15 rat (A) sciatic nerve and (B) spinal cord. Included are binding profiles of the Schwann cell and oligodendrocyte master regulator Sox10, as well as the Schwann cell-specific regulator Egr2. Profiles of H3K27ac and the oligodendrocyte-specific regulator Olig2 in cultured oligodendrocytes (OL) were obtained from published datasets (44). H3K27ac-enriched enhancers specific to sciatic nerve are indicated by grey boxes. (C) ChIP-Seq analysis depicts enrichment of histone H3K27 acetylation in P25 rat sham versus cut sciatic nerve (3 days after transection). Enhancers lost upon nerve injury are indicated by grey boxes. (D) ChIP-Seq analysis of H3K4me3 enrichment in adult sciatic nerve identifies active promoters of expressed genes. The overlapping segments of two duplicated regions (hg36 chr17:15,143,663–15,311,619; rn5 chr10:49,146,632-49,288,636) found in patients with a mild form of CMT (18,19) is shown as a red thick line. Previously characterized Pmp22 enhancers are labeled in (A–C), which includes the upstream sites A, B and C (16), as well as sites at −7 kb and +11 kb (15,17). H3K27ac-enrichment also reveals an enhancer at − 18 kb, as well as additional upstream enhancers (−162, −134, −128, −108, −104 kb) within the duplicated region. Marked genomic regions are listed with respect to the Pmp22 translation start site. Note that Cdrt4 and Tekt3 genes located within the duplicated region are not expressed in peripheral nerve (16).

H3K27ac-enrichment revealed putative enhancers at −18 kb, as well as additional upstream enhancers (−162, −134, −128, −108, −104 kb) within a homologous region to a duplicated segment (hg36 chr17:15,143,663–15,311,619) found in patients with a mild form of CMT (18,19). While the duplicated region contains the genes CMT1A duplicated region transcript 4 (Cdrt4) and Tektin 3 (Tekt3), ChIP-Seq analysis in rat sciatic nerve revealed that the Cdrt4 and Tekt3 gene promoters lack H3K4 trimethylation, a mark of active promoters (Fig. 1D) (45). Indeed, we had found that Cdrt4 and Tekt3 are not expressed in sciatic nerve (16). Conversely, the start of the Pmp22 gene is highly enriched with H3K4me3, as expected since it is highly expressed in sciatic nerve. These results identified several H3K27ac-marked Pmp22 enhancers that are Schwann cell-specific and regulated by injury, which includes new sites as well as the previously described upstream enhancers A (−120 kb), B (−115 kb) and C (−91 kb) (16).

Pmp22 enhancers are permissive for activation early in development

Pmp22 expression is induced during development as Schwann cells begin to wrap and myelinate axons (42), yet it remains unclear how enhancers coordinate gene expression levels developmentally. Given that Sox10 is expressed throughout Schwann cell development (20), we hypothesized that Pmp22 enhancers may be permissive early in development by P1 in sciatic nerve. Permissive genomic regions are defined as regions accessible for binding of transcriptional regulators, and have been described as H3K27ac-enriched, as well as DNaseI hypersensitive (46). Indeed, while Pmp22 expression is induced from P1 to P15 in sciatic nerve, we found by ChIP-qPCR that Sox10 binds enhancers at P1 prior to the myelination-associated induction of Pmp22 (Fig. 2A and B). We also found that Sox10-bound regions were marked by H3K27ac in P1 nerve (Fig. 2C). Comparatively, Sox10 binding and H3K27ac-enrichment did not change much from P1 to P15 as detected by ChIP-qPCR. Our findings suggest that the chromatin landscape is permissive early in development and that other factors, such as Egr2 (7,32), may help coordinate the upregulation of Pmp22 gene expression during myelination.

Figure 2.

Pmp22 enhancers are permissive for activation early in development. (A) Dense ChIP-Seq profiles from sciatic nerve highlight the location of Pmp22 enhancers assayed by ChIP-qPCR. ChIP-qPCR analysis identifies (B) Sox10 binding and (C) H3K27ac-enhancer mark enrichment in P1 and P15 rat sciatic nerve. Genomic regions assayed are listed with respect to the Pmp22 translation start site. Included in the analysis is a negative control site (neg.) within Tekt3, a testes-specific gene that is not expressed in Schwann cells. Levels in (B) are shown relative to control IP (goat IgG) (grey line is set at 1), whereas in (C) levels are shown relative to total histone H3 ChIP (grey line demarcates the negative control site). Error bars indicate the standard deviation of three independent experiments (*P < 0.05). (D) Representative Tead binding motifs at H3K27ac-marked enhancers are shown.

Figure 2.

Pmp22 enhancers are permissive for activation early in development. (A) Dense ChIP-Seq profiles from sciatic nerve highlight the location of Pmp22 enhancers assayed by ChIP-qPCR. ChIP-qPCR analysis identifies (B) Sox10 binding and (C) H3K27ac-enhancer mark enrichment in P1 and P15 rat sciatic nerve. Genomic regions assayed are listed with respect to the Pmp22 translation start site. Included in the analysis is a negative control site (neg.) within Tekt3, a testes-specific gene that is not expressed in Schwann cells. Levels in (B) are shown relative to control IP (goat IgG) (grey line is set at 1), whereas in (C) levels are shown relative to total histone H3 ChIP (grey line demarcates the negative control site). Error bars indicate the standard deviation of three independent experiments (*P < 0.05). (D) Representative Tead binding motifs at H3K27ac-marked enhancers are shown.

Tead regulation of Pmp22 enhancers

Recent studies from our lab found that many Sox10-bound enhancers in peripheral nerve are enriched with the binding motif of TEA domain (Tead) family members (39,40). Tead family members interact with Yap and Taz co-activators downstream of the tumor suppressor Hippo signaling pathway (47). We hypothesized that if Tead factors are important for Pmp22 expression, then we might detect sequence binding motifs at Pmp22 enhancers. Indeed, we identified Tead binding motifs at the upstream sites −120 kb (site A), −115 kb (site B) and −91 kb (site C), as well as at the +11 kb site (Fig. 2D). We also found Tead motifs at the H3K27ac-enriched enhancers located −162 and −18 kb upstream.

To identify which Tead factor plays a role in regulating Pmp22 expression, we first identified which factor was expressed in Schwann cells. Since promoters of expressed genes are marked by H3K4 trimethylation (45), we used ChIP-Seq analysis of H3K4me3 enrichment in sciatic nerve to identify expressed Tead family members. We found that H3K4me3 is most highly enriched at the Tead1 promoter (Fig. 3A), compared with that of Tead2, Tead3 or Tead4. We also found that Tead1 is the most highly expressed family member in S16 cells rat Schwann cells by RNA-Seq analysis. The FPKM (Fragment Per Kilobase of transcript per Million mapped reads) value of Tead1 in S16 cells is 73, while that of Tead2, Tead3 and Tead4 are 9, 8 and 5, respectively. From these data, the ranked expression level of Tead1 among all expressed genes (17,985 non-zero FPKM values) is 820 while the ranks of the other Tead genes are >6000. Given that many myelin genes are induced as Schwann cells undergo myelination, we tested if Tead1 protein expression follows a similar pattern of induction. Western blot analysis indicated that Tead1 is expressed in P1 and P15 sciatic nerve, and is induced over this time period (Fig. 3B).

Figure 3.

Tead1 is expressed in Schwann cells. (A) ChIP-Seq analysis in adult rat sciatic nerve reveals H3K4me3 enrichment at Tead1 locus, with the promoter region highlighted in a grey box. (B) Western blot analysis compares Tead1 and Pmp22 expression in P1 and P15 rat sciatic nerve. A representative blot from two biological replicates is shown. Quantitative RT-PCR was used to determine relative mRNA expression levels in (C) primary rat Schwann cells and (D) S16 rat Schwann cells treated with siRNA targeting Sox10. Gene expression levels of the housekeeping gene Ubce7 are included as a negative control. Levels are shown relative to the sample treated with a non-targeting control siRNA, which was set as 1. Error bars indicate the standard deviation of three independent experiments (*P < 0.05).

Figure 3.

Tead1 is expressed in Schwann cells. (A) ChIP-Seq analysis in adult rat sciatic nerve reveals H3K4me3 enrichment at Tead1 locus, with the promoter region highlighted in a grey box. (B) Western blot analysis compares Tead1 and Pmp22 expression in P1 and P15 rat sciatic nerve. A representative blot from two biological replicates is shown. Quantitative RT-PCR was used to determine relative mRNA expression levels in (C) primary rat Schwann cells and (D) S16 rat Schwann cells treated with siRNA targeting Sox10. Gene expression levels of the housekeeping gene Ubce7 are included as a negative control. Levels are shown relative to the sample treated with a non-targeting control siRNA, which was set as 1. Error bars indicate the standard deviation of three independent experiments (*P < 0.05).

During myelination, Sox10 upregulates Egr2 gene expression, which leads to coordinated binding of Sox10 and Egr2 at many enhancers of myelin genes in Schwann cells (7,16,32,34). Thus, we hypothesized that Sox10 may activate Tead1 gene expression to promote subsequent coordinated binding of Sox10 and Tead1 at the Pmp22 enhancers. However, Sox10 depletion by siRNAs in primary rat Schwann cells did not have a major effect on Tead1 expression (Fig. 3C). A similar Sox10 siRNA treatment in S16 rat Schwann cells, which express relatively high levels of myelin genes (48,49), showed a slight reduction of Tead1 expression (Fig. 3D). As expected, Sox10 siRNA treatment reduced Egr2 and Pmp22 expression in S16 cells. Our findings indicate that Tead1 gene expression is largely independent of Sox10.

Tead1 and the co-activator Taz are required for Pmp22 and Egr2 gene activation

As it is unknown if Tead1 is required for Pmp22 expression, we used siRNA targeting Tead1 in primary rat Schwann cells to assay gene expression changes dependent on Tead1. By RT-qPCR, cells treated with Tead1 siRNA exhibited a 60–70% reduction in Tead1 expression compared with cells treated with a non-targeting control siRNA. We found that Tead1 siRNA leads to downregulation of Egr2 gene expression, as well as both Pmp22 transcripts (Fig. 4A). The Pmp22 gene is transcribed from two alternative promoters, Prom1 and Prom2, from exon 1A and exon 1B, respectively. The Prom1 and Prom2 Pmp22 transcripts only differ in their 5′ non-coding region, yet they exhibit different expression patterns in vivo where the Prom1 transcript predominates in mature rodent peripheral nerve (42). In contrast, expression of Sox10 and the myelin genes Erb-B2 receptor tyrosine kinase 3 (ErbB3), Myelin basic protein (Mbp), and Mpz were unaffected. We also assayed Tead1-dependent gene expression in S16 rat Schwann cells, where Egr2 and Pmp22 are expressed at higher levels, and similar results were seen with cells treated with Tead1 siRNA (Fig. 4B). Our findings suggest that Tead1 plays a role in regulating Pmp22 and Egr2 expression.

Figure 4.

Tead1 is required for Pmp22 gene activation. Quantitative RT-PCR was used to determine relative mRNA expression levels in (A) primary rat Schwann cells or (B) S16 rat Schwann cells treated with siRNA for Tead1. Levels are shown relative to the sample treated with a non-targeting control siRNA, which was set as 1 (grey line). Error bars indicate the standard deviation of three independent experiments (*P < 0.05).

Figure 4.

Tead1 is required for Pmp22 gene activation. Quantitative RT-PCR was used to determine relative mRNA expression levels in (A) primary rat Schwann cells or (B) S16 rat Schwann cells treated with siRNA for Tead1. Levels are shown relative to the sample treated with a non-targeting control siRNA, which was set as 1 (grey line). Error bars indicate the standard deviation of three independent experiments (*P < 0.05).

A recent study found that the Tead co-activators Yap and Taz are required for myelination in peripheral nerve (50). Yap and Taz exhibit some functional redundancy and dose-dependent requirements, as indicated by intermediate sorting defects in conditional knock-out (cKO) and heterozygous (cHet) mice. Since Teads may compensate for each other (51,52) and Tead activation is dependent on Yap/Taz co-activators (53,54), we tested if Yap and Taz are required for Pmp22 expression in vivo by performing RT-qPCR on sciatic nerve from Taz cKO and Taz cHet; Yap cKO animals. The mice were generated by mating mice with floxed alleles of the Taz and Yap genes with the Schwann cell-specific Mpz-Cre line. While full knockout of both Yap and Taz show extensive abnormalities in peripheral nerve development (50), we focused our analysis on Taz cKO and Taz cHet; Yap cKO animals, which exhibit minor sorting defects generally characterized by some bundles of non-myelinated axons that contain unsorted large diameter axons (Fig. 5A). However, most large diameter axons are sorted normally in Taz cKO and Taz cHet; Yap cKO, and the number of myelinated fibers and myelin thickness are normal. We found that both Prom1 and Prom2 Pmp22 transcripts, as well as Egr2 and Mpz, were reduced in Taz cKO nerve at P3 (Fig. 5B), but gene expression was largely rescued by P20 (Fig. 5C). Conversely, in the Taz cHet; Yap cKO nerve, myelin gene expression was unaffected at P3 (Fig. 5B), but Mpz and Prom1 Pmp22 transcripts were reduced in P20 nerve (Fig. 5C). Sox10 gene expression was unaffected in Taz cKO and Taz cHet; Yap cKO nerve at both P3 and P20, and Egr2 expression was not significantly different in the Taz cHet; Yap cKO at P20. Our findings suggest that Yap and Taz play a role in regulating Pmp22 expression, as well as expression of other myelin genes, in early development.

Figure 5.

The Tead co-activators Taz and Yap are required for myelin gene expression in vivo. (A) Semithin cross-sections of sciatic nerves stained with Toluidine blue from control Mpz-Cre, Taz cKO and Taz cHet; Yap cKO mice at P3 and P20 (Bar, 10 µM). Quantitative RT-PCR was used to determine relative mRNA expression levels at (B) P3 and (C) P20 in Taz cKO and Taz cHet; Yap cKO sciatic nerves. Levels are shown relative to control sciatic nerves from Mpz-Cre transgenic mice, which was set at 1 (grey line). Error bars indicate the mean of at least three independent experiments as indicated, and statistical analysis was performed by one-way ANOVA (*P < 0.05).

Figure 5.

The Tead co-activators Taz and Yap are required for myelin gene expression in vivo. (A) Semithin cross-sections of sciatic nerves stained with Toluidine blue from control Mpz-Cre, Taz cKO and Taz cHet; Yap cKO mice at P3 and P20 (Bar, 10 µM). Quantitative RT-PCR was used to determine relative mRNA expression levels at (B) P3 and (C) P20 in Taz cKO and Taz cHet; Yap cKO sciatic nerves. Levels are shown relative to control sciatic nerves from Mpz-Cre transgenic mice, which was set at 1 (grey line). Error bars indicate the mean of at least three independent experiments as indicated, and statistical analysis was performed by one-way ANOVA (*P < 0.05).

Tead1 binds the MSE enhancer driving Egr2 expression

Since deficiencies in Tead1 and the co-activators Yap and Taz reduce gene expression of Pmp22, as well as Egr2, we hypothesized that Tead1 binds the Myelinating Schwann cell element (MSE) enhancer (27,28) driving Egr2 expression. Indeed, by ChIP-qPCR we found that Tead1 binds the MSE in S16 rat Schwann cells (Fig. 6A), as well as in P1 (Fig. 6B) and P15 (Fig. 6C) rat sciatic nerve. While Tead1 binding colocalizes with Sox10 binding at the MSE, Tead1 does not bind two other Sox10-bound enhancers at +3 kb within the ErbB3 gene (also known as the ErbB3MCS6 enhancer) (55) and at −27 kb upstream of Sox10 (Sox10MCS4/U3) (56,57). No binding was detected at the negative control site located within the silent Tekt3 gene. These data suggest that Tead1 may participate in early induction of Egr2, although the knockout studies indicate this may become less important by P20.

Figure 6.

Tead1 binds the MSE enhancer driving Egr2 expression. ChIP-qPCR analysis identifies Sox10 and Tead1 binding in (A) S16 rat Schwann cells and in (B) P1 and (C) P15 rat sciatic nerve. Binding was assayed at a negative control site (Tekt3) as well as at Sox10-bound enhancers at the ErbB3, Sox10 and Egr2 loci. Levels are shown relative to control IP (goat IgG), thus background levels are indicated by grey line at 1. Error bars indicate the standard deviation of three independent experiments (*P < 0.05).

Figure 6.

Tead1 binds the MSE enhancer driving Egr2 expression. ChIP-qPCR analysis identifies Sox10 and Tead1 binding in (A) S16 rat Schwann cells and in (B) P1 and (C) P15 rat sciatic nerve. Binding was assayed at a negative control site (Tekt3) as well as at Sox10-bound enhancers at the ErbB3, Sox10 and Egr2 loci. Levels are shown relative to control IP (goat IgG), thus background levels are indicated by grey line at 1. Error bars indicate the standard deviation of three independent experiments (*P < 0.05).

Tead1 binding to Pmp22 enhancers

The expression data indicated that Pmp22 is Yap/Taz-dependent even at P20. Given that Tead1 binding motifs were found at Pmp22 enhancers (Fig. 2D), we hypothesized that Tead1 binds Pmp22 enhancers and directly regulates expression of Pmp22. We used ChIP-qPCR to assay binding of Tead1 in S16 rat Schwann cells and rat sciatic nerve. We found that Tead1 enrichment is greatest at the upstream sites at −162, −115 (site B) and −91 kb (site C), along with the −18 and +11 kb sites in S16 cells (Fig. 7A) and sciatic nerve (Fig. 7B). Interestingly, Tead1 binding enrichment appears to increase from P1 to P15 in sciatic nerve, correlating with protein expression level (Fig. 3B) and induction of Pmp22 gene expression.

Figure 7.

Tead1 directly regulates Pmp22 expression through specific enhancer usage. ChIP-qPCR analysis identifies Tead1 binding in (A) S16 rat Schwann cells and in (B) P1 and P15 rat sciatic nerve. Genomic regions assayed are listed with respect to the Pmp22 translation start site. Shown in (A) are percent recoveries in a control IP (goat IgG) indicated by grey line at ∼0.05% recovery, whereas in (B) levels are shown relative to control IP (grey line is set at 1). (C) Reporter analysis was used to assess Pmp22 enhancer activity. Pmp22 enhancer regions were placed upstream of a luciferase reporter gene containing a minimal promoter. (i) Reporters were transiently transfected into RT4 rat Schwann cells, and exhibited different levels of activity relative to empty vector, which is depicted by logarithmic scale. (ii) Tead1 requirement for Pmp22 enhancer activation was assayed in RT4 cells treated with Tead1 siRNA. Levels are shown relative to the control sample, which was set as 1 (grey line). The control sample was treated with a non-targeting control siRNA and transfected with an empty luciferase reporter construct. Error bars in (AB) and (Cii) indicate the standard deviation of three independent experiments (*P < 0.05).

Figure 7.

Tead1 directly regulates Pmp22 expression through specific enhancer usage. ChIP-qPCR analysis identifies Tead1 binding in (A) S16 rat Schwann cells and in (B) P1 and P15 rat sciatic nerve. Genomic regions assayed are listed with respect to the Pmp22 translation start site. Shown in (A) are percent recoveries in a control IP (goat IgG) indicated by grey line at ∼0.05% recovery, whereas in (B) levels are shown relative to control IP (grey line is set at 1). (C) Reporter analysis was used to assess Pmp22 enhancer activity. Pmp22 enhancer regions were placed upstream of a luciferase reporter gene containing a minimal promoter. (i) Reporters were transiently transfected into RT4 rat Schwann cells, and exhibited different levels of activity relative to empty vector, which is depicted by logarithmic scale. (ii) Tead1 requirement for Pmp22 enhancer activation was assayed in RT4 cells treated with Tead1 siRNA. Levels are shown relative to the control sample, which was set as 1 (grey line). The control sample was treated with a non-targeting control siRNA and transfected with an empty luciferase reporter construct. Error bars in (AB) and (Cii) indicate the standard deviation of three independent experiments (*P < 0.05).

To test if Tead1 is required for enhancer activation, we employed luciferase reporter assays in RT4 rat Schwann cells treated with Tead1 siRNA. The designated Pmp22 enhancer regions were placed upstream of a luciferase reporter gene containing a minimal promoter, and were transfected into the RT4 cell line, which also expresses high levels of Pmp22 relative to primary Schwann cells (49). The Pmp22 enhancers appear to display different levels of activity and Tead1-dependence in the RT4 Schwann cell line (Fig. 7Ci). We found that the −18 kb site was not active in RT4 cells, while the −91 kb (site C) was very active but did not respond to Tead1 siRNA (reduced Tead1 expression by ∼70%) (Fig. 7Cii). Conversely, Tead1 siRNA reduced activity of the upstream enhancers at −162 and −115 kb (site B), as well as activity of the +11 kb intronic enhancer. The lack of an effect on site C may reflect incomplete silencing of Tead1 by RNA interference, which may leave significant residual binding to strong Tead sites, along with the limitations of using episomal reporters in a cultured cell line that does not recapitulate all aspects of Schwann cell differentiation.

While we found that Tead1 binds Pmp22 enhancers and modulates enhancer activation, we next tested if evolutionarily conserved Tead1 binding motifs are required for activation of enhancers. To address this, we employed luciferase reporter assays with −115 (site B), −91 (site C) and +11 kb constructs in S16 rat Schwann cells, and assayed reporter activity using wildtype constructs compared with mutated constructs with abolished Tead1 motifs (ΔTead1) (Fig. 8A–C). The reporters are active in S16 cells (16), as seen with RT4 cells, and abolishing the Tead1 motif in the mutant constructs generally reduced activity of the reporters (Fig. 8D and F). Not all motifs are important, as shown at site −91 kb (site C) where ablating two out of three motifs led to modest effects on reporter activity (Fig. 8E). Ultimately, our findings indicate that direct binding of Tead1 is required for activation of Pmp22 enhancers.

Figure 8.

Tead1 binding motifs are required for Pmp22 enhancer activity. (AC) Pmp22 enhancers were examined for conserved Tead1 consensus motif sequences. Shown in the schematics are the positions of previously described Sox10 (grey ovals) and Egr2 (white triangles) binding sites (15,16), newly identified Tead1 motifs (black squares), and the distances between the sites are labeled along the bottom. Shown below the schematics are conserved sequences at the Tead1 motifs (bolded). (DF) Luciferase assays were performed in S16 Schwann cells with constructs containing wildtype (WT; white bars) or mutant (ΔTead1; black bars) genomic segments. Levels are shown relative to the wildtype construct activity, which was set as 1. Error bars indicate the standard deviation of eight technical replicate experiments (*P < 0.05).

Figure 8.

Tead1 binding motifs are required for Pmp22 enhancer activity. (AC) Pmp22 enhancers were examined for conserved Tead1 consensus motif sequences. Shown in the schematics are the positions of previously described Sox10 (grey ovals) and Egr2 (white triangles) binding sites (15,16), newly identified Tead1 motifs (black squares), and the distances between the sites are labeled along the bottom. Shown below the schematics are conserved sequences at the Tead1 motifs (bolded). (DF) Luciferase assays were performed in S16 Schwann cells with constructs containing wildtype (WT; white bars) or mutant (ΔTead1; black bars) genomic segments. Levels are shown relative to the wildtype construct activity, which was set as 1. Error bars indicate the standard deviation of eight technical replicate experiments (*P < 0.05).

Discussion

Here, we describe a new mechanism for transcriptional control of Pmp22, a gene implicated in the most common form of inherited peripheral neuropathy, CMT1A. We found that Pmp22 enhancers strongly correlate with Pmp22 expression as a function of cell type and nerve injury. While coordinated regulation by Sox10 and Egr2 may account for Pmp22 induction, the extremely high levels of Pmp22 in myelinating cells likely require additional transcription factors. Sox10-bound enhancers in peripheral nerve are enriched with the sequence binding motif of Tead family members (39,40), and we discovered that Tead1 controls Pmp22 gene expression through specific enhancers.

Interestingly, we also found that Egr2 expression is Tead1-dependent in cultured Schwann cells and Yap/Taz-dependent in vivo. Tead1 binds the MSE near the Egr2 gene. A number of studies have shown that the MSE is an important integrator of signals triggering myelination (27–29,58,59). Sox10 binds the MSE along with the POU domain transcription factor Pou3f1 (Scip/Oct6/Tst1) (28,29), which is induced by cAMP-dependent signaling (60). The transcription factors Yin yang 1 (YY1) (58) and Nfatc4 (59) also bind the MSE downstream of MAP kinase and calcineurin signaling pathways, respectively, and contribute to neuregulin induction of Egr2. Interestingly, Yap/Taz regulation has been linked to neuregulin signaling in other systems (61). Since Pmp22 is directly activated by Egr2 (15,16), part of Tead1 activation of Pmp22 may be indirectly mediated by Egr2 induction. However, a direct role for Tead1 activation of Pmp22 is supported by ChIP analysis of Pmp22 enhancers, as well as a decrement of Pmp22 Prom1 expression at P20 in Taz/Yap-deficient nerve when Egr2 levels appear to be normal (50). Moreover, the mutation of individual Tead binding sites also supports a direct role of Tead1 in regulation of Pmp22 enhancers.

Our analysis of H3K27ac-enriched enhancers demonstrates the utility of examining the chromatin landscape to identify new mechanisms regulating gene expression. We identified several enhancers dynamically regulated by cell type and nerve injury that were also found within a duplicated region detected in patients with a mild form of CMT (18,19). Interestingly, the upstream cluster encompasses two genomic regions of broad H3K27ac-enrichment of >20 kb around the −162 kb site and >40 kb around the −134 to −91 kb sites, which suggests that these regions may be super-enhancers. Super-enhancers are defined as extended regions of H3K27ac that contain dense clustered binding, or “epicenters” (62,63), of the mediator co-activator complex and master transcription factors (64). Super-enhancers regulate the expression of genes that drive cell identity (65), and exhibit cell lineage- and tissue-specificity (63,66). It is tempting to hypothesize that the −162, −115 (site B) and −91 kb (site C) sites bound by combinations of Sox10, Egr2 and Tead1 function as epicenters within a broader super-enhancer.

Our study revealed that Pmp22 expression is controlled in part by Tead1 downstream of the tumor suppressor Hippo pathway, which involves a kinase cascade that leads to phosphorylation and inactivation of the transcriptional co-activators Yap and Taz (67). When the Hippo pathway is turned off, Yap and Taz translocate to the nucleus and activate target genes by associating with Tead transcription factors. The Hippo pathway can be modulated by mechanotransduction and neuregulin stimulation (61,68), signal transduction mechanisms dynamically regulated over Schwann cell development (50,69) and even by electromagnetic field exposure in Schwann cells (70). The Hippo pathway is also activated by the tumor suppressor Nf2/Merlin in Schwann cells, which is lost in Neurofibromatosis type 2 Schwannomas (71). Conversely, Schwann cell-specific ablation of Yap and Taz leads to sorting defects caused by reduced proliferation and expression of laminin receptors (50). The double deletion of Yap and Taz in peripheral nerve exhibited a much more severe phenotype than either single deletion of the co-activators, suggesting that they play partially redundant roles. Interestingly, Yap expression is colocalized with Sox10 at early embryonic stages of dorsal root ganglia development and Yap hyperactivation leads to expansion of the glial cell population (72).

Our study indicates that Tead1 and co-activators Yap/Taz preferentially regulate the Prom1 Pmp22 transcript. The Prom1 transcript is the predominant one expressed in rodent peripheral nerve and is greatly induced over myelination (42). Since the Prom1 promoter alone is not sufficient to drive transgenic expression in peripheral nerve (17), it is likely that proximal and distal enhancers play a role in regulating preferential Prom1 transcript expression. Here, we found that the Prom1 Pmp22 transcript appears to be uniquely downregulated in the Yap cKO; Taz cHet at P20, and there is a dominant effect on Prom1 transcript levels in the Taz cKO at P3, exhibiting a similar trend seen with Tead1 siRNA in cell culture.

While Pmp22 expression is induced over Schwann cell development and myelination, we found that its enhancers are established prior to the large postnatal induction in Pmp22. We found that H3K27ac-enrichment is unchanged in sciatic nerve from P1 to P15 as immature Schwann cells differentiate into mature, myelinating cells. Our findings suggest that transcription factors responsible for postnatal induction of Pmp22 bind to a pre-existing enhancer landscape to regulate myelination. A similar finding was seen in other systems (46,73,74). Samstein et al. (73) found that the lineage-driving factor Foxp3 binds genomic regions that were already accessible in the precursor cell type, implicating that lineage-driving factors are not necessarily responsible for forming open chromatin regions in the differentiated cell type. However, there is evidence that developmentally established enhancers are subject to decommissioning as the Pmp22 (and other myelin gene) enhancers are dramatically altered in the transcriptional reprogramming that occurs in Schwann cells after nerve injury (40).

In our model, Pmp22 expression is developmentally regulated by Tead1, along with Egr2. Pmp22 expression is also regulated by Sox10, which probably accounts for the basal level of Pmp22 expression found in early Schwann cell development (75). Sox10 and Tead1 coordinate to bind the MSE enhancer of Egr2, which is also regulated by YY1 and Nfatc4 (58,59). Together, Sox10, Tead1 and Egr2 coordinate upregulation of Pmp22 expression. Our study reveals that Tead1 binding events are enriched at the −162, −115, −91, −18 and +11 kb sites. Our findings expand the list of transcriptional regulators of Pmp22 beyond Sox10 and Egr2. Previous studies have also implicated progesterone receptors and LXR as additional regulators of the Pmp22 gene (76–78), and future work will identify how integrated contributions of these factors result in the developmental regulation of Pmp22.

Materials and Methods

Cell line culture

RT4-D6P2T (RT4, obtained from ATCC) (79) and S16 (obtained from Richard Quarles) (48) rat Schwann cells were grown with DMEM supplemented with 4.5 g/l glucose, l-glutamine, penicillin, streptomycin, and 5% bovine growth serum (Hyclone). Primary rat Schwann cells were also grown with supplemented DMEM media, along with 0.2% bovine pituitary extract (Sigma) and 2 μM forskolin (Sigma) (80).

siRNA treatment

Cells were transfected with siRNA targeting Sox10 (Ambion, 4390771), Tead1 (IDT, RNC.RNAI.X001078008 12.1 and 12.3) or a negative siRNA control (IDT, DS NC1). RT4 and primary rat Schwann cells were transfected using the Lipofectamine RNAiMAX reagent (Invitrogen), and S16 cells were transfected with the AMAXA nucleofector system (Lonza) according to the manufacturer’s protocol.

ChIP

ChIP in S16 rat Schwann cells was performed as previously described (15). ChIP was performed on pooled P1 and P15 sciatic nerve from Sprague-Dawley rats as previously described (34) with a few changes. During lysis of P1 nerve, 0.3% triton was used instead of 1% triton. Conversely, given that P15 nerve is harder to homogenize we used 1% triton and 0.03% SDS for lysis to improve shearing efficiency. Antibodies used included goat IgG (Santa Cruz Biotechnology, sc-2028), Sox10 (R&D, AF2864), Tead1 (BD Biosciences, 610923), H3K27ac (ActiveMotif, 39133) and total H3 (ActiveMotif 39163). K27 acetylation was detected by using a select antibody previously screened for specificity (81). ChIP-qPCR was performed on three independent experiments, and primers used are included in Table 1.

Table 1.

Primers used for ChIP-qPCR

Site Forward Reverse 
Pmp22 −162 kb TTTAGCAGGGGCTTTTCTGA CATCATGCAGGAATGTGGAG 
Pmp22 −134 kb CACCAAGTGCTTGCTTGTGT CCATGTCTGCCATGTCCAC 
Pmp22 −128 kb TCTTCTGCATTGTCCAGGCTT CAACCTCCCACTGCACATGA 
Pmp22 −120 kb (site A) AGAGGAAAACAGTGGCGGTTT TCCGTAGGATGCTGCTCATTG 
Pmp22 −115 kb (site B) ACTGTGTCAGCTAAAAGCACCCTAA GGGCTTTGTATGCAGTCACTCAT 
Pmp22 −108 kb AGCTCTGTTCTCCCTCACCA AAATTGCCCAAAGTGTTTGC 
Pmp22 −104 kb GCGGCCAAAATATTCTCAAA CCTTTTTCCTTGCATTTCCA 
Pmp22 −91 kb (site C) CTCTACCGGAATGCGCTAATTG GGGACATAAGGCATCCTTTTGTT 
neg. AATACCAGCAGATCCGGAAGAC TTGACTCGTTCTCCCAGGTTTT 
Pmp22 −18 kb CCATGGAATTCATGTGGTCA AACACTCCATTCATCGCACA 
Pmp22 −7 kb TCTGAGCTTTCTCTCTCCCACAG TCCCAGGATGAAGTGCATCTT 
Pmp22 +11 kb CACTGGCCTCTGGGCAAGT GAAACAATGTGGCCTTTGCTC 
Sox10 −27 kb (Sox10-MCS4/U3GGTTAACGAGGGATGCAAGGA GGTCAGAGGGCATCATGGTT 
ErbB3 +3 kb (ErbB3-MCS6AGGCCCTGGAATAAACATCTCTTT AATTGCTTCATTGTGGGCTGA 
Egr2 MSE TCCTGACCAGAAAGATTGTTATTGAG TGCAGGATTTCAGCTTTGTGA 
Site Forward Reverse 
Pmp22 −162 kb TTTAGCAGGGGCTTTTCTGA CATCATGCAGGAATGTGGAG 
Pmp22 −134 kb CACCAAGTGCTTGCTTGTGT CCATGTCTGCCATGTCCAC 
Pmp22 −128 kb TCTTCTGCATTGTCCAGGCTT CAACCTCCCACTGCACATGA 
Pmp22 −120 kb (site A) AGAGGAAAACAGTGGCGGTTT TCCGTAGGATGCTGCTCATTG 
Pmp22 −115 kb (site B) ACTGTGTCAGCTAAAAGCACCCTAA GGGCTTTGTATGCAGTCACTCAT 
Pmp22 −108 kb AGCTCTGTTCTCCCTCACCA AAATTGCCCAAAGTGTTTGC 
Pmp22 −104 kb GCGGCCAAAATATTCTCAAA CCTTTTTCCTTGCATTTCCA 
Pmp22 −91 kb (site C) CTCTACCGGAATGCGCTAATTG GGGACATAAGGCATCCTTTTGTT 
neg. AATACCAGCAGATCCGGAAGAC TTGACTCGTTCTCCCAGGTTTT 
Pmp22 −18 kb CCATGGAATTCATGTGGTCA AACACTCCATTCATCGCACA 
Pmp22 −7 kb TCTGAGCTTTCTCTCTCCCACAG TCCCAGGATGAAGTGCATCTT 
Pmp22 +11 kb CACTGGCCTCTGGGCAAGT GAAACAATGTGGCCTTTGCTC 
Sox10 −27 kb (Sox10-MCS4/U3GGTTAACGAGGGATGCAAGGA GGTCAGAGGGCATCATGGTT 
ErbB3 +3 kb (ErbB3-MCS6AGGCCCTGGAATAAACATCTCTTT AATTGCTTCATTGTGGGCTGA 
Egr2 MSE TCCTGACCAGAAAGATTGTTATTGAG TGCAGGATTTCAGCTTTGTGA 

ChIP-Seq profiles of H3K27ac enrichment and transcription factor binding at select loci were obtained from previously published data (39,40). Conversely, the ChIP-Seq profile of H3K4me3 (Millipore, 04-745) was obtained by micrococcal nucleases (MNase) aided ChIP in adult (2 months old) rat sciatic nerve as described previously (82) with a few changes. Rather than washing with RIPA buffer after the immunoprecipitation, ChIP samples were washed with washing buffer 1 (WB1, 50 mM Tris–HCl, pH7.5; 10 mM EDTA; 125 mM NaCl) once, WB2 (50 mM Tris–HCl, pH7.5; 10 mM EDTA; 250 mM NaCl) once, and WB3 (50 mM Tris–HCl, pH7.5; 10 mM EDTA; 500 mM NaCl) twice.

Western blot

Nerves were homogenized in lysis buffer (150 mM NaCl, 10% glycerol, 50 mM Tris pH 8.0, 1% SDS, 1% Triton and 1:100 protease inhibitor Sigma-Aldrich P8340) with a motorized pellet pestle. Proteins analyzed by immunoblotting included Sox10 (R&D, AF2864), Tead1 (BD Biosciences, 610923), Pmp22 (Stratech, C0306), actin (SantaCruz, I-19 sc-1616). Membranes were scanned and quantitated with the Odyssey Infrared Imager (LI-COR Biosciences).

RT-qPCR

RNA was isolated from sciatic nerves using the RNeasy Lipid Tissue Mini Kit (Qiagen) according to the manufacturer’s protocol. Conversely, RNA was harvested from transfected cells at 48 h after transfection using Tri Reagent (Ambion). RNA was converted to cDNA using the MMLV reverse transcriptase (Invitrogen). All cDNAs were analyzed from three independent experiments by RT-qPCR using Power SYBR Green Master Mix (Thermo Fisher Scientific) on the ViiA7 system (Applied Biosystems). Relative expression was calculated using the Comparative Ct method (83). Primers used are included in Table 2.

Table 2.

Primers used for RT-qPCR

Gene Forward Reverse 
Rat 
18S CGCCGCTAGAGGTGAAATTCT CGAACCTCCGACTTTCGTTCT 
Ubce7 CAAGGGCTTATTGTTCCTGACAAC TCTGAAGGCTCCCTTATCATATGG 
Sox10 CGAATTGGGCAAGGTCAAGA CACCGGGAACTTGTCATCGT 
Tead1 GTGCTCCTTTGGGAAACAAG ATTGGTGAGCGGTTTATTCG 
Egr2 TCTTTTCCGCTGTCCTCGAT TGCTAGCCCTTTCCGTTGA 
Pmp22 TGTCCCCGCACTTTGGTTAT CAGATCCCTCCCTCCCATTC 
Mpz CTGCAGTCAAATCCCCCAGTA CCTGGAGGTGACGGTCACTT 
Mbp ATCGTTCCACAGGAGTGTTCG CAAGGTCGGTCGTTCAGTCAC 
ErbB3 AGCGTCACGGAGCAGAAGTT GGCTTTTCCCCAAGGCTAAT 
Pmp22 Prom1 GAGGAAGGGCGTACACCATTG GGAGTTGGGCTCGGGCT 
Pmp22 Prom2 CGAGTTTGTGCCTGAGGCTAC AAGCATGGTGGCTGGGAGT 
Mouse 
Sox10 GCCACGAGGTAATGTCCAACA TGGTCCAGCTCAGTCACATCA 
Egr2 TCTTTTCCGCTGTCCTCGAT TGCTAGCCCTTTCCGTTGA 
Pmp22 Prom1 TTGACTGCAGAGACATCCAAGTG GGGCTCGGGATCAGAGGA 
Pmp22 Prom2 AGATAGCTGTCCCTTTGAACTGAAA GTTGGGCTCGGGATCAGA 
Mpz CCCTGGCCATTGTGGTTTAC CCATTCACTGGACCAGAAGGAG 
Gene Forward Reverse 
Rat 
18S CGCCGCTAGAGGTGAAATTCT CGAACCTCCGACTTTCGTTCT 
Ubce7 CAAGGGCTTATTGTTCCTGACAAC TCTGAAGGCTCCCTTATCATATGG 
Sox10 CGAATTGGGCAAGGTCAAGA CACCGGGAACTTGTCATCGT 
Tead1 GTGCTCCTTTGGGAAACAAG ATTGGTGAGCGGTTTATTCG 
Egr2 TCTTTTCCGCTGTCCTCGAT TGCTAGCCCTTTCCGTTGA 
Pmp22 TGTCCCCGCACTTTGGTTAT CAGATCCCTCCCTCCCATTC 
Mpz CTGCAGTCAAATCCCCCAGTA CCTGGAGGTGACGGTCACTT 
Mbp ATCGTTCCACAGGAGTGTTCG CAAGGTCGGTCGTTCAGTCAC 
ErbB3 AGCGTCACGGAGCAGAAGTT GGCTTTTCCCCAAGGCTAAT 
Pmp22 Prom1 GAGGAAGGGCGTACACCATTG GGAGTTGGGCTCGGGCT 
Pmp22 Prom2 CGAGTTTGTGCCTGAGGCTAC AAGCATGGTGGCTGGGAGT 
Mouse 
Sox10 GCCACGAGGTAATGTCCAACA TGGTCCAGCTCAGTCACATCA 
Egr2 TCTTTTCCGCTGTCCTCGAT TGCTAGCCCTTTCCGTTGA 
Pmp22 Prom1 TTGACTGCAGAGACATCCAAGTG GGGCTCGGGATCAGAGGA 
Pmp22 Prom2 AGATAGCTGTCCCTTTGAACTGAAA GTTGGGCTCGGGATCAGA 
Mpz CCCTGGCCATTGTGGTTTAC CCATTCACTGGACCAGAAGGAG 

Animal models

All experiments involving animals followed experimental protocols approved by the Roswell Park Cancer Institute, and the University of Wisconsin School of Veterinary Medicine Institutional Animal Care and Use Committees. Taz and Yap floxed mice and Mpz-Cre transgenic congenic in the C57BL6 background were described previously (84,85). Also, Taz cKO and Taz cHet; Yap cKO animals were created as previously described (50).

Luciferase assays

Luciferase assays were performed with the RT4 Schwann cell line using transient transfections with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. The reporter constructs used contain the following coordinates from human chromosome 17 (hg18 Mar. 2006 build in UCSC Genome Browser): PMP22 −162 kb: chr17:15,301,367–15,302,142; PMP22 −115 kb (site B): chr17:15,250,013–15,250,409; PMP22 −91 kb (site C): chr17:15,221,688–15,222,096; PMP22 −18 kb: chr17:15,129,534-15,130,260; PMP22 +11 kb: 15,091,959-15,092,201. The reporters are cloned upstream of the pGL4 luciferase reporter containing the minimal E1B TATA promoter. To test if Tead1 is required for activity, reporters were transfected 24 h after Tead1 siRNA treatment.

Luciferase assays were performed with the S16 Schwann cell line as described previously (86). Mutagenic primers were designed to delete Tead sites and mutagenesis was performed using the QuikChange II Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s instructions. The resulting mutant constructs were sequence verified to ensure that the Tead consensus sites were deleted. Mutagenesis was performed using pDONR221 constructs and subsequently, the constructs were recombined into the pE1B luciferase reporter.

RNA-sequencing

RNA-Seq was performed on RNA isolated from S16 rat Schwann cells (Law, W.D. and Antonellis, A. (2016), unpublished data). Approximately 41 million reads were uniquely mapped to the rat (rn5) RefSeq genome using STAR (87) using the default parameters with the exception that multi-mapped reads were excluded. The number of reads per transcript was determined using HTSeq (88) using the default parameters with the exception that the stranded read option was not used. The length of each RefSeq transcript was obtained from the RefSeq GTF file using Bedtools (89), and FPKM (Fragments Per Kilobase of transcript per Million mapped reads) values were calculated using a custom Perl script (available upon request).

Statistics

P-values were obtained from the Student’s two-tailed t-test or as indicated from one-way ANOVA when comparing unequal sample sizes (P < 0.05 is considered to be statistically significant).

Acknowledgements

We thank members of our lab for helpful feedback on the study and Jeff Wrana (Lunenfeld-Tanenbaum, Research Institute, Toronto) for Yap and Taz floxed mice.

Conflict of Interest statement. None declared.

Funding

This study was supported by grants from National Institutes of Health: NS075269 and NS083841 to J.S., HD03352 P30 core grant, NS045630 to L.F., NS073748 to A.A. C.G. was supported by funds from the Cellular and Molecular Biology Program at the University of Michigan, and W.D.L. was supported by the National Institutes of Health Genetics Training Grant (GM007544) and an EDGE Award from the Endowment for the Basic Sciences at the University of Michigan.

References

1
Lupski
J.R.
de Oca-Luna
R.M.
Slaugenhaupt
S.
Pentao
L.
Guzzetta
V.
Trask
B.J.
Saucedo-Cardenas
O.
Barker
D.F.
Killian
J.M.
Garcia
C.A.
et al.  . (
1991
)
DNA duplication associated with Charcot-Marie-Tooth disease type 1A
.
Cell
 ,
66
,
219
232
.
2
Timmerman
V.
Nelis
E.
Van Hul
W.
Nieuwenhuijsen
B.W.
Chen
K.L.
Wang
S.
Ben Othman
K.
Cullen
B.
Leach
R.J.
Hanemann
C.O.
(
1992
)
The peripheral myelin protein gene PMP-22 is contained within the Charcot-Marie-Tooth disease type 1A duplication
.
Nat. Genet
 .,
1
,
171
175
.
3
Patel
P.I.
Roa
B.B.
Welcher
A.A.
Schoener-Scott
R.
Trask
B.J.
Pentao
L.
Snipes
G.J.
Garcia
C.A.
Francke
U.
Shooter
E.M.
et al.  . (
1992
)
The gene for the peripheral myelin protein PMP-22 is a candidate for Charcot-Marie-Tooth disease type 1A
.
Nat. Genet
 .,
1
,
159
165
.
4
Reilly
M.M.
Murphy
S.M.
Laurá
M.
(
2011
)
Charcot-Marie-Tooth disease
.
J. Peripher. Nerv. Syst
 .,
16
,
1
14
.
5
Saporta
M.A.
Shy
M.E.
(
2013
)
Inherited peripheral neuropathies
.
Neurol. Clin
 .,
31
,
597
619
.
6
Jacob
C.
(
2015
)
Transcriptional control of neural crest specification into peripheral glia
.
Glia
 ,
63
,
1883
1896
7
Svaren
J.
Meijer
D.
(
2008
)
The molecular machinery of myelin gene transcription in Schwann cells
.
Glia
 ,
56
,
1541
1551
.
8
Perea
J.
Robertson
A.
Tolmachova
T.
Muddle
J.
King
R.
Ponsford
S.
Thomas
P.
Huxley
C.
(
2001
)
Induced myelination and demyelination in a conditional mouse model of Charcot-Marie-Tooth disease type 1A
.
Hum. Mol. Genet
 .,
10
,
1007
1018
.
9
Sereda
M.W.
Meyer zu Horste
G.
Suter
U.
Uzma
N.
Nave
K.A.
(
2003
)
Therapeutic administration of progesterone antagonist in a model of Charcot-Marie-Tooth disease (CMT-1A)
.
Nat. Med
 .,
9
,
1533
1537
.
10
Passage
E.
Norreel
J.
Noack-Fraissignes
P.
Sanguedolce
V.
Pizant
J.
Thirion
X.
Robaglia-Schlupp
A.
Pellissier
J.
Fontés
M.
(
2004
)
Ascorbic acid treatment corrects the phenotype of a mouse model of Charcot-Marie-Tooth disease
.
Nat. Med
 .,
10
,
396
401
.
11
Chance
P.F.
Alderson
M.K.
Leppig
K.A.
Lensch
M.W.
Matsunami
N.
Smith
B.
Swanson
P.D.
Odelberg
S.J.
Disteche
C.M.
Bird
T.D.
(
1993
)
DNA deletion associated with hereditary neuropathy with liability to pressure palsies
.
Cell
 ,
72
,
143
151
.
12
Suter
U.
Scherer
S.S.
(
2003
)
Disease mechanisms in inherited neuropathies
.
Nat. Rev. Neurosci
 .,
4
,
714
726
.
13
Inglese
J.
Dranchak
P.
Moran
J.J.
Jang
S.W.
Srinivasan
R.
Santiago
Y.
Zhang
L.
Guha
R.
Martinez
N.
MacArthur
R.
et al.  . (
2014
)
Genome editing-enabled HTS assays expand drug target pathways for Charcot-Marie-tooth disease
.
ACS Chem. Biol
 .,
9
,
2594
2602
.
14
Jang
S.W.
Lopez-Anido
C.
MacArthur
R.
Svaren
J.
Inglese
J.
(
2012
)
Identification of drug modulators targeting gene-dosage disease CMT1A
.
ACS Chem. Biol
 .,
7
,
1205
1213
.
15
Jones
E.A.
Lopez-Anido
C.
Srinivasan
R.
Krueger
C.
Chang
L.W.
Nagarajan
R.
Svaren
J.
(
2011
)
Regulation of the PMP22 Gene through an Intronic Enhancer
.
J. Neurosci
 .,
31
,
4242
4250
.
16
Jones
E.A.
Brewer
M.H.
Srinivasan
R.
Krueger
C.
Sun
G.
Charney
K.N.
Keles
S.
Antonellis
A.
Svaren
J.
(
2012
)
Distal enhancers upstream of the Charcot-Marie-Tooth type 1A disease gene PMP22
.
Hum. Mol. Genet
 .,
21
,
1581
1591
.
17
Maier
M.
Castagner
F.
Berger
P.
Suter
U.
(
2003
)
Distinct elements of the peripheral myelin protein 22 (PMP22) promoter regulate expression in Schwann cells and sensory neurons
.
Mol. Cell. Neurosci
 .,
24
,
803
817
.
18
Weterman
M.A.
van Ruissen
F.
de Wissel
M.
Bordewijk
L.
Samijn
J.P.
van der Pol
W.L.
Meggouh
F.
Baas
F.
(
2010
)
Copy number variation upstream of PMP22 in Charcot-Marie-Tooth disease
.
Eur. J. Hum. Genet
 .,
18
,
421
428
.
19
Zhang
F.
Seeman
P.
Liu
P.
Weterman
M.A.
Gonzaga-Jauregui
C.
Towne
C.F.
Batish
S.D.
De Vriendt
E.
De Jonghe
P.
Rautenstrauss
B.
et al.  . (
2010
)
Mechanisms for nonrecurrent genomic rearrangements associated with CMT1A or HNPP: rare CNVs as a cause for missing heritability
.
Am. J. Hum. Genet
 .,
86
,
892
903
.
20
Kuhlbrodt
K.
Herbarth
B.
Sock
E.
Hermans-Borgmeyer
I.
Wegner
M.
(
1998
)
Sox10, a novel transcriptional modulator in glial cells
.
J. Neurosci
 .,
18
,
237
250
.
21
Topilko
P.
Schneider-Maunoury
S.
Levi
G.
Baron-Van Evercooren
A.
Chennoufi
A.B.
Seitanidou
T.
Babinet
C.
Charnay
P.
(
1994
)
Krox-20 controls myelination in the peripheral nervous system
.
Nature
 ,
371
,
796
799
.
22
Britsch
S.
Goerich
D.E.
Riethmacher
D.
Peirano
R.I.
Rossner
M.
Nave
K.A.
Birchmeier
C.
Wegner
M.
(
2001
)
The transcription factor Sox10 is a key regulator of peripheral glial development
.
Genes Dev
 .,
15
,
66
78
.
23
Sonnenberg-Riethmacher
E.
Miehe
M.
Stolt
C.C.
Goerich
D.E.
Wegner
M.
Riethmacher
D.
(
2001
)
Development and degeneration of dorsal root ganglia in the absence of the HMG-domain transcription factor Sox10
.
Mech. Dev
 .,
109
,
253
265
.
24
Finzsch
M.
Schreiner
S.
Kichko
T.
Reeh
P.
Tamm
E.
Bösl
M.
Meijer
D.
Wegner
M.
(
2010
)
Sox10 is required for Schwann cell identity and progression beyond the immature Schwann cell stage
.
J. Cell. Biol
 .,
189
,
701
712
.
25
Bremer
M.
Fröb
F.
Kichko
T.
Reeh
P.
Tamm
E.R.
Suter
U.
Wegner
M.
(
2011
)
Sox10 is required for Schwann-cell homeostasis and myelin maintenance in the adult peripheral nerve
.
Glia
 ,
59
,
1022
1032
.
26
Kuhlbrodt
K.
Herbarth
B.
Sock
E.
Enderich
J.
Hermans-Borgmeyer
I.
Wegner
M.
(
1998
)
Cooperative function of POU proteins and SOX proteins in glial cells
.
J. Biol. Chem
 .,
273
,
16050
16057
.
27
Ghislain
J.
Desmarquet-Trin-Dinh
C.
Jaegle
M.
Meijer
D.
Charnay
P.
Frain
M.
(
2002
)
Characterisation of cis-acting sequences reveals a biphasic, axon-dependent regulation of Krox20 during Schwann cell development
.
Development
 ,
129
,
155
166
.
28
Ghislain
J.
Charnay
P.
(
2006
)
Control of myelination in Schwann cells: a Krox20 cis-regulatory element integrates Oct6, Brn2 and Sox10 activities
.
EMBO Rep
 .,
7
,
52
58
.
29
Reiprich
S.
Kriesch
J.
Schreiner
S.
Wegner
M.
(
2010
)
Activation of Krox20 gene expression by Sox10 in myelinating Schwann cells
.
J. Neurochem
 .,
112
,
744
754
.
30
Le
N.
Nagarajan
R.
Wang
J.Y.
Araki
T.
Schmidt
R.E.
Milbrandt
J.
(
2005
)
Analysis of congenital hypomyelinating Egr2Lo/Lo nerves identifies Sox2 as an inhibitor of Schwann cell differentiation and myelination
.
Proc. Natl Acad. Sci. U S A
 .,
102
,
2596
2601
.
31
Decker
L.
Desmarquet-Trin-Dinh
C.
Taillebourg
E.
Ghislain
J.
Vallat
J.M.
Charnay
P.
(
2006
)
Peripheral myelin maintenance is a dynamic process requiring constant Krox20 expression
.
J. Neurosci
 .,
26
,
9771
9779
.
32
Jones
E.A.
Jang
S.W.
Mager
G.M.
Chang
L.W.
Srinivasan
R.
Gokey
N.G.
Ward
R.M.
Nagarajan
R.
Svaren
J.
(
2007
)
Interactions of Sox10 and Egr2 in myelin gene regulation
.
Neuron Glia Biol
 .,
3
,
377
387
. PMC2605513.
33
Jang
S.W.
Svaren
J.
(
2009
)
Induction of myelin protein zero by early growth response 2 through upstream and intragenic elements
.
J. Biol. Chem
 .,
284
,
20111
20120
.
34
Srinivasan
R.
Sun
G.
Keles
S.
Jones
E.A.
Jang
S.W.
Krueger
C.
Moran
J.J.
Svaren
J.
(
2012
)
Genome-wide analysis of EGR2/SOX10 binding in myelinating peripheral nerve
.
Nucleic Acids Res
 .,
40
,
6449
6460
.
35
Maier
M.
Berger
P.
Nave
K.A.
Suter
U.
(
2002
)
Identification of the regulatory region of the peripheral myelin protein 22 (PMP22) gene that directs temporal and spatial expression in development and regeneration of peripheral nerves
.
Mol. Cell Neurosci
 .,
20
,
93
109
.
36
Orfali
W.
Nicholson
R.N.
Guiot
M.C.
Peterson
A.C.
Snipes
G.J.
(
2005
)
An 8.5-kb segment of the PMP22 promoter responds to loss of axon signals during Wallerian degeneration, but does not respond to specific axonal signals during nerve regeneration
.
J. Neurosci. Res
 .,
80
,
37
46
.
37
Rada-Iglesias
A.
Bajpai
R.
Swigut
T.
Brugmann
S.A.
Flynn
R.A.
Wysocka
J.
(
2011
)
A unique chromatin signature uncovers early developmental enhancers in humans
.
Nature
 ,
470
,
279
283
.
38
Creyghton
M.P.
Cheng
A.W.
Welstead
G.G.
Kooistra
T.
Carey
B.W.
Steine
E.J.
Hanna
J.
Lodato
M.A.
Frampton
G.M.
Sharp
P.A.
et al.  . (
2010
)
Histone H3K27ac separates active from poised enhancers and predicts developmental state
.
Proc. Natl Acad. Sci. U S A
 .,
107
,
21931
21936
.
39
Lopez-Anido
C.
Sun
G.
Koenning
M.
Srinivasan
R.
Hung
H.A.
Emery
B.
Keles
S.
Svaren
J.
(
2015
)
Differential Sox10 genomic occupancy in myelinating glia
.
Glia
 ,
63
,
1897
1914
.
40
Hung
H.A.
Sun
G.
Keles
S.
Svaren
J.
(
2015
)
Dynamic regulation of Schwann cell enhancers after peripheral nerve injury
.
J. Biol. Chem
 .,
290
,
6937
6950
.
41
Stolt
C.C.
Rehberg
S.
Ader
M.
Lommes
P.
Riethmacher
D.
Schachner
M.
Bartsch
U.
Wegner
M.
(
2002
)
Terminal differentiation of myelin-forming oligodendrocytes depends on the transcription factor Sox10
.
Genes Dev
 .,
16
,
165
170
.
42
Suter
U.
Snipes
G.J.
Schoener-Scott
R.
Welcher
A.A.
Pareek
S.
Lupski
J.R.
Murphy
R.A.
Shooter
E.M.
Patel
P.I.
(
1994
)
Regulation of tissue-specific expression of alternative peripheral myelin protein-22 (PMP22) gene transcripts by two promoters
.
J. Biol. Chem
 .,
269
,
25795
25808
.
43
Snipes
G.J.
Suter
U.
Welcher
A.A.
Shooter
E.M.
(
1992
)
Characterization of a novel peripheral nervous system myelin protein (PMP-22/SR13)
.
J. Cell. Biol
 .,
117
,
225
238
.
44
Yu
Y.
Chen
Y.
Kim
B.
Wang
H.
Zhao
C.
He
X.
Liu
L.
Liu
W.
Wu
L.M.
Mao
M.
et al.  . (
2013
)
Olig2 targets chromatin remodelers to enhancers to initiate oligodendrocyte differentiation
.
Cell
 ,
152
,
248
261
.
45
Heintzman
N.D.
Stuart
R.K.
Hon
G.
Fu
Y.
Ching
C.W.
Hawkins
R.D.
Barrera
L.O.
Van Calcar
S.
Qu
C.
Ching
K.A.
et al.  . (
2007
)
Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome
.
Nat. Genet
 .,
39
,
311
318
.
46
Kim
T.H.
Li
F.
Ferreiro-Neira
I.
Ho
L.L.
Luyten
A.
Nalapareddy
K.
Long
H.
Verzi
M.
Shivdasani
R.A.
(
2014
)
Broadly permissive intestinal chromatin underlies lateral inhibition and cell plasticity
.
Nature
 ,
506
,
511
515
.
47
Chen
L.
Loh
P.G.
Song
H.
(
2010
)
Structural and functional insights into the TEAD-YAP complex in the Hippo signaling pathway
.
Protein Cell
 ,
1
,
1073
1083
.
48
Toda
K.
Small
J.A.
Goda
S.
Quarles
R.H.
(
1994
)
Biochemical and cellular properties of three immortalized Schwann cell lines expressing different levels of the myelin-associated glycoprotein
.
J. Neurochem
 .,
63
,
1646
1657
.
49
Hai
M.
Muja
N.
DeVries
G.H.
Quarles
R.H.
Patel
P.I.
(
2002
)
Comparative analysis of Schwann cell lines as model systems for myelin gene transcription studies
.
J. Neurosci. Res
 .,
69
,
497
508
.
50
Poitelon
Y.
Lopez-Anido
C.
Catignas
K.
Berti
C.
Palmisano
M.
Williamson
C.
Ameroso
D.
Abiko
K.
Hwang
Y.
Gregorieff
A.
et al.  . (
2016
)
YAP and TAZ control peripheral myelination and the expression of laminin receptors in Schwann cells
.
Nat. Neurosci
 .,
19
,
879
887
.
51
Sawada
A.
Kiyonari
H.
Ukita
K.
Nishioka
N.
Imuta
Y.
Sasaki
H.
(
2008
)
Redundant roles of Tead1 and Tead2 in notochord development and the regulation of cell proliferation and survival
.
Mol. Cell. Biol
 .,
28
,
3177
3189
.
52
Chen
H.H.
Baty
C.J.
Maeda
T.
Brooks
S.
Baker
L.C.
Ueyama
T.
Gursoy
E.
Saba
S.
Salama
G.
London
B.
et al.  . (
2004
)
Transcription enhancer factor-1-related factor-transgenic mice develop cardiac conduction defects associated with altered connexin phosphorylation
.
Circulation
 ,
110
,
2980
2987
.
53
Zhao
B.
Ye
X.
Yu
J.
Li
L.
Li
W.
Li
S.
Lin
J.D.
Wang
C.Y.
Chinnaiyan
A.M.
Lai
Z.C.
et al.  . (
2008
)
TEAD mediates YAP-dependent gene induction and growth control
.
Genes Dev
 .,
22
,
1962
1971
.
54
Zhang
H.
Liu
C.Y.
Zha
Z.Y.
Zhao
B.
Yao
J.
Zhao
S.
Xiong
Y.
Lei
Q.Y.
Guan
K.L.
(
2009
)
TEAD transcription factors mediate the function of TAZ in cell growth and epithelial-mesenchymal transition
.
J. Biol. Chem
 .,
284
,
13355
13362
.
55
Prasad
M.K.
Reed
X.
Gorkin
D.U.
Cronin
J.C.
McAdow
A.R.
Chain
K.
Hodonsky
C.J.
Jones
E.A.
Svaren
J.
Antonellis
A.
et al.  . (
2011
)
SOX10 directly modulates ERBB3 transcription via an intronic neural crest enhancer
.
BMC Dev. Biol
 .,
11
,
40.
56
Antonellis
A.
Huynh
J.L.
Lee-Lin
S.Q.
Vinton
R.M.
Renaud
G.
Loftus
S.K.
Elliot
G.
Wolfsberg
T.G.
Green
E.D.
McCallion
A.S.
et al.  . (
2008
)
Identification of neural crest and glial enhancers at the mouse Sox10 locus through transgenesis in zebrafish
.
PLoS Genet
 .,
4
,
e1000174.
57
Werner
T.
Hammer
A.
Wahlbuhl
M.
Bosl
M.R.
Wegner
M.
(
2007
)
Multiple conserved regulatory elements with overlapping functions determine Sox10 expression in mouse embryogenesis
.
Nucleic Acids Res
 .,
35
,
6526
6538
.
58
He
Y.
Kim
J.Y.
Dupree
J.
Tewari
A.
Melendez-Vasquez
C.
Svaren
J.
Casaccia
P.
(
2010
)
Yy1 as a molecular link between neuregulin and transcriptional modulation of peripheral myelination
.
Nat. Neurosci
 .,
13
,
1472
1480
.
59
Kao
S.C.
Wu
H.
Xie
J.
Chang
C.P.
Ranish
J.A.
Graef
I.A.
Crabtree
G.R.
(
2009
)
Calcineurin/NFAT signaling is required for neuregulin-regulated Schwann cell differentiation
.
Science
 ,
323
,
651
654
.
60
Monk
K.R.
Naylor
S.G.
Glenn
T.D.
Mercurio
S.
Perlin
J.R.
Dominguez
C.
Moens
C.B.
Talbot
W.S.
(
2009
)
A G protein-coupled receptor is essential for Schwann cells to initiate myelination
.
Science
 ,
325
,
1402
1405
.
61
Serrano
I.
McDonald
P.C.
Lock
F.
Muller
W.J.
Dedhar
S.
(
2013
)
Inactivation of the Hippo tumour suppressor pathway by integrin-linked kinase
.
Nat. Commun
 .,
4
,
2976.
62
Siersbæk
R.
Rabiee
A.
Nielsen
R.
Sidoli
S.
Traynor
S.
Loft
A.
La Cour Poulsen
L.
Rogowska-Wrzesinska
A.
Jensen
O.N.
Mandrup
S.
(
2014
)
Transcription factor cooperativity in early adipogenic hotspots and super-enhancers
.
Cell Rep
 .,
7
,
1443
1455
.
63
Adam
R.C.
Yang
H.
Rockowitz
S.
Larsen
S.B.
Nikolova
M.
Oristian
D.S.
Polak
L.
Kadaja
M.
Asare
A.
Zheng
D.
et al.  . (
2015
)
Pioneer factors govern super-enhancer dynamics in stem cell plasticity and lineage choice
.
Nature
 ,
521
,
366
370
.
64
Whyte
W.A.
Orlando
D.A.
Hnisz
D.
Abraham
B.J.
Lin
C.Y.
Kagey
M.H.
Rahl
P.B.
Lee
T.I.
Young
R.A.
(
2013
)
Master transcription factors and mediator establish super-enhancers at key cell identity genes
.
Cell
 ,
153
,
307
319
.
65
Hnisz
D.
Abraham
B.J.
Lee
T.I.
Lau
A.
Saint-André
V.
Sigova
A.A.
Hoke
H.A.
Young
R.A.
(
2013
)
Super-enhancers in the control of cell identity and disease
.
Cell
 ,
155
,
934
947
.
66
Hnisz
D.
Schuijers
J.
Lin
C.Y.
Weintraub
A.S.
Abraham
B.J.
Lee
T.I.
Bradner
J.E.
Young
R.A.
(
2015
)
Convergence of developmental and oncogenic signaling pathways at transcriptional super-enhancers
.
Mol. Cell
 ,
58
,
362
370
.
67
Pan
D.
(
2010
)
The hippo signaling pathway in development and cancer
.
Dev. Cell
 ,
19
,
491
505
.
68
Aragona
M.
Panciera
T.
Manfrin
A.
Giulitti
S.
Michielin
F.
Elvassore
N.
Dupont
S.
Piccolo
S.
(
2013
)
A mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors
.
Cell
 ,
154
,
1047
1059
.
69
Newbern
J.
Birchmeier
C.
(
2010
)
Nrg1/ErbB signaling networks in Schwann cell development and myelination
.
Semin. Cell Dev. Biol
 .,
21
,
922
928
.
70
Colciago
A.
Melfi
S.
Giannotti
G.
Bonalume
V.
Ballabio
M.
Caffino
L.
Fumagalli
F.
Magnaghi
V.
(
2015
)
Tumor suppressor Nf2/merlin drives Schwann cell changes following electromagnetic field exposure through Hippo-dependent mechanisms
.
Cell Death Disc
 ., doi: 10.1038/cddiscovery.2015.21.
71
Li
W.
Cooper
J.
Zhou
L.
Yang
C.
Erdjument-Bromage
H.
Zagzag
D.
Snuderl
M.
Ladanyi
M.
Hanemann
C.O.
Zhou
P.
et al.  . (
2014
)
Merlin/NF2 loss-driven tumorigenesis linked to CRL4(DCAF1)-mediated inhibition of the hippo pathway kinases Lats1 and 2 in the nucleus
.
Cancer Cell
 ,
26
,
48
60
.
72
Serinagaoglu
Y.
Paré
J.
Giovannini
M.
Cao
X.
(
2015
)
Nf2-Yap signaling controls the expansion of DRG progenitors and glia during DRG development
.
Dev. Biol
 .,
398
,
97
109
.
73
Samstein
R.M.
Arvey
A.
Josefowicz
S.Z.
Peng
X.
Reynolds
A.
Sandstrom
R.
Neph
S.
Sabo
P.
Kim
J.M.
Liao
W.
et al.  . (
2012
)
Foxp3 exploits a pre-existent enhancer landscape for regulatory T cell lineage specification
.
Cell
 ,
151
,
153
166
.
74
John
S.
Sabo
P.J.
Thurman
R.E.
Sung
M.H.
Biddie
S.C.
Johnson
T.A.
Hager
G.L.
Stamatoyannopoulos
J.A.
(
2011
)
Chromatin accessibility pre-determines glucocorticoid receptor binding patterns
.
Nat. Genet
 .,
43
,
264
268
.
75
Hagedorn
L.
Suter
U.
Sommer
L.
(
1999
)
P0 and PMP22 mark a multipotent neural crest-derived cell type that displays community effects in response to TGF-beta family factors
.
Development
 ,
126
,
3781
3794
.
76
Makoukji
J.
Shackleford
G.
Meffre
D.
Grenier
J.
Liere
P.
Lobaccaro
J.M.
Schumacher
M.
Massaad
C.
(
2011
)
Interplay between LXR and Wnt/β-catenin signaling in the negative regulation of peripheral myelin genes by oxysterols
.
J. Neurosci
 .,
31
,
9620
9629
.
77
Desarnaud
F.
Do Thi
A.N.
Brown
A.M.
Lemke
G.
Suter
U.
Baulieu
E.E.
Schumacher
M.
(
1998
)
Progesterone stimulates the activity of the promoters of peripheral myelin protein-22 and protein zero genes in Schwann cells
.
J. Neurochem
 .,
71
,
1765
1768
.
78
Melcangi
R.C.
Magnaghi
V.
Cavarretta
I.
Zucchi
I.
Bovolin
P.
D’Urso
D.
Martini
L.
(
1999
)
Progesterone derivatives are able to influence peripheral myelin protein 22 and P0 gene expression: possible mechanisms of action
.
J. Neurosci. Res
 .,
56
,
349
357
.
79
Imada
M.
Sueoka
N.
(
1978
)
Clonal sublines of rat neurotumor RT4 and cell differentiation. I. Isolation and characterization of cell lines and cell type conversion
.
Dev. Biol
 .,
66
,
97
108
.
80
Brockes
J.P.
Fields
K.L.
Raff
M.C.
(
1979
)
Studies on cultured rat Schwann cells. I. Establishment of purified populations from cultures of peripheral nerve
.
Brain Res
 .,
165
,
105
118
.
81
Egelhofer
T.A.
Minoda
A.
Klugman
S.
Lee
K.
Kolasinska-Zwierz
P.
Alekseyenko
A.A.
Cheung
M.S.
Day
D.S.
Gadel
S.
Gorchakov
A.A.
et al.  . (
2011
)
An assessment of histone-modification antibody quality
.
Nat. Struct. Mol. Biol
 .,
18
,
91
93
.
82
Ma
K.H.
Hung
H.A.
Srinivasan
R.
Xie
H.
Orkin
S.H.
Svaren
J.
(
2015
)
Regulation of peripheral nerve myelin maintenance by gene repression through polycomb repressive complex 2
.
J. Neurosci
 .,
35
,
8640
8652
.
83
Livak
K.J.
Schmittgen
T.D.
(
2001
)
Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method
.
Methods
 ,
25
,
402
408
.
84
Feltri
M.L.
D’Antonio
M.
Previtali
S.
Fasolini
M.
Messing
A.
Wrabetz
L.
(
1999
)
P0-Cre transgenic mice for inactivation of adhesion molecules in Schwann cells
.
Ann. N. Y. Acad. Sci
 .,
883
,
116
123
.
85
Reginensi
A.
Scott
R.P.
Gregorieff
A.
Bagherie-Lachidan
M.
Chung
C.
Lim
D.S.
Pawson
T.
Wrana
J.
McNeill
H.
(
2013
)
Yap- and Cdc42-dependent nephrogenesis and morphogenesis during mouse kidney development
.
PLoS Genet
 .,
9
,
e1003380.
86
Antonellis
A.
Dennis
M.Y.
Burzynski
G.
Huynh
J.
Maduro
V.
Hodonsky
C.J.
Khajavi
M.
Szigeti
K.
Mukkamala
S.
Bessling
S.L.
et al.  . (
2010
)
A rare myelin protein zero (MPZ) variant alters enhancer activity in vitro and in vivo
.
PLoS One
 ,
5
,
e14346.
87
Dobin
A.
Davis
C.A.
Schlesinger
F.
Drenkow
J.
Zaleski
C.
Jha
S.
Batut
P.
Chaisson
M.
Gingeras
T.R.
(
2013
)
STAR: ultrafast universal RNA-seq aligner
.
Bioinformatics
 ,
29
,
15
21
.
88
Anders
S.
Pyl
P.T.
Huber
W.
(
2015
)
HTSeq—a Python framework to work with high-throughput sequencing data
.
Bioinformatics
 ,
31
,
166
169
.
89
Quinlan
A.R.
Hall
I.M.
(
2010
)
BEDTools: a flexible suite of utilities for comparing genomic features
.
Bioinformatics
 ,
26
,
841
842
.