Reduced dynamin-related protein 1 protects against phosphorylated Tau-induced mitochondrial dysfunction and synaptic damage in Alzheimer’s disease

Abstract

The purpose of our study was to understand the protective effects of a partial reduction of dynamin-related protein 1 (Drp1) in Alzheimer’s disease (AD) progression and pathogenesis. Increasing evidence suggests that phosphorylated Tau and mitochondrial abnormalities are involved in the loss of synapses, defective axonal transport and cognitive decline, in patients with AD. In the current study, we investigated whether a partial reduction of Drp1 protect neurons from phosphorylated Tau-induced mitochondrial and synaptic toxicities in AD progression. We crossed Drp1+/− mice with Tau transgenic mice (P301L line) and created double mutant (TauXDrp1+/−) mice. Using real-time RT-PCR, immunoblotting and immunostaining analyses, we measured mRNA expressions and protein levels of genes related to the mitochondrial dynamics—Drp1 and Fis1 (fission), Mfn1, Mfn2 and Opa1 (fusion), CypD (matrix), mitochondrial biogenesis—Nrf1, Nrf2, PGC1α and TFAM and synaptic—synaptophysin, PSD95, synapsin 1, synaptobrevin 1, neurogranin, GAP43 and synaptopodin in brain tissues from 6-month-old Drp1+/−, Tau, TauXDrp1+/− and wild-type mice. Using biochemical and immunoblotting methods, mitochondrial function and phosphorylated Tau were measured. Decreased mRNA and protein levels of fission and matrix and increased levels of fusion, mitochondrial biogenesis, and synaptic genes were found in 6-month-old TauXDrp1+/− mice relative to Tau mice. Mitochondrial dysfunction was reduced in TauXDrp1+/− mice relative to Tau mice. Phosphorylated Tau found to be reduced in TauXDrp1+/− mice relative to Tau mice. These findings suggest that a partial reduction of Drp1 decreases the production of phosphorylated Tau, reduces mitochondrial dysfunction, and maintains mitochondrial dynamics, enhances mitochondrial biogenesis and synaptic activity in Tau mice. Findings of this study may have implications for the development of Drp1 based therapeutics for patients with AD and other tauopathies.

Introduction

Alzheimer’s disease (AD) is a late-onset, neurodegenerative disease, characterized by the progressive decline of memory, cognitive functions, and changes in behavior and personality (1–3). Currently, 5.4 million Americans suffer from AD (4). The prevalence of AD is high among aged persons with AD: 13% of individuals who are 65 years old have AD and 50% of individuals 85 years of age and older have AD (4). These numbers translate into extremely high health-care costs, in addition to the personal and family hardships that AD creates. Intraneuronal amyloid beta (Aβ) early and hyperphosphorylated Tau and neurofibrillary tangles (NFTs) later in the disease process were found in the brains of AD patients and AD mouse models, and morphological changes that are critical and may be responsible for other cellular and morphological changes, including the loss of synapses, loss of synaptic function, mitochondrial structural and functional abnormalities, inflammatory responses, and neuronal loss (4–17). Currently, there are no drugs or agents available to treat or to prevent AD.

Mitochondrial dysfunction is a prominent feature of AD, but its underlying mechanism is still not well understood. Dysfunction of mitochondria has been identified in AD postmortem brains (18–22), AD transgenic mice (10,11,15,23–25), and cell lines that express mutant APP and/or cells treated with Aβ (7,8,17,26–31). Further, several studies found increased free radical production, lipid peroxidation, oxidative DNA damage, oxidative protein damage, decreased ATP production and cell damage in brains from AD patients compared to brains from age-matched control subjects (13,19–22,32).

Tau pathology, including hyperphosphorylated Tau and NFTs have been identified as a major pathological hallmark of AD. However, the physiological relevance of Tau pathology in the progression and pathogenesis of AD is not completely understood. Tau is a major microtubule-associated protein that plays a large role in the outgrowth of neuronal processes and the development of neuronal polarity. Tau promotes microtubule assembly, stabilizes microtubules and affects the dynamics of microtubules in neurons (27,33). In AD, Tau becomes hyperphosphorylated, which destabilizes microtubules by decreased binding to microtubules, resulting in the aggregation of hyperphosphorylated Tau. Several factors have been reported to involve in phosphorylation of Tau, including Aβ-mediated caspase activation, Aβ-mediated oxidative stress, chronic oxidative stress and reduced IGF-mediated oxidative stress (27). To understand the role of phosphorylated Tau in AD, several investigators have generated several Tau transgenic mouse models using mutated Tau gene (34). Several lines of Tau transgenic mice showed hyperphosphorylated Tau in the form of paired helical filaments in the neurons and also motor and behavioral deficits (27,34).

Increasing evidence suggests that hyperphosphorylated Tau is involved in mitochondrial dysfunction and neuronal damage in AD. (1) Several studies reported that phosphorylated Tau is capable of reducing anterograde transport of vesicles and cell organelles by blocking microtubule tracks (35–38). Thus, a misregulation of Tau could cause the starvation of synapses and could enhance oxidative stress long before Tau detaches from microtubules and aggregates into NFTs. (2) Vossel et al. (39) studied the effects of Tau and Aβ on axonal transport of mitochondria and the neurotrophin factor TrkA, using murine primary neurons. Aβ oligomers inhibited axonal transport of mitochondria in wild-type (WT) neurons, whereas neurons that expressed reduced Tau showed normal axonal transport of mitochondria. These in vitro observations suggest that Aβ may require Tau in order to impair axonal transport and reduced Tau may protect against Aβ-induced axonal transport changes (39). (3) Several groups found mitochondrial functional defects in 3xTgAD mice (decreased respiration and pyruvate dehydrogenase, and increased free radical production and lipid peroxidation) (15,40,41), and others found deregulated mitochondrial proteins, particularly complexes I and IV of oxidative phosphorylation (42,43). (4) Studying the brains from AD patients and from 3xTgAD mice, we found abnormal interactions between dynamin-related protein 1 (Drp1) and hyperphosphorylated Tau, suggesting a direct link between them, and mitochondrial dysfunction and neuronal damage.

Recent mitochondrial studies revealed that abnormal mitochondrial dynamics (increased fission and decreased fusion) plays a large role in disease process, leading to mitochondrial dysfunction and neuronal damage in neurodegenerative diseases, including Alzheimer’s (7,8,17,26,27,44), Huntington’s (45–50), ALS (51–54) and Parkinson’s (55–59).

To determine whether mitochondrial fission protein Drp1 interacts with hyperphosphorylated Tau in AD progression, Manczak and Reddy (61) performed co-immunoprecipitation analysis, using the Drp1 antibody, and immunoblotting analysis, using the phosphorylated Tau antibody and protein lysates of cortical tissues from control subjects and from mild, definite, and severe AD patients (60). They found a physical interaction between phosphorylated Tau and Drp1, but it was mostly in the definite AD patients. They found little or no physical interaction between Drp1 and phosphorylated Tau in the control subjects (60). However, physiological relevance between Drp1 and phosphorylated Tau is unclear. Such information needs elucidation to better understand mitochondrial fragmentation, abnormal distribution and mitochondrial dysfunction in relation phosphorylated Tau in AD.

Drp1 is a highly, evolutionarily conserved large GTPase family of protein, critically involved in regulating mitochondrial structure and distribution in mammals (61–64). Drp1 has been found in the cytoplasm of plants, yeast, worms and in several mammals, including human’s tissues, including the brain, heart, lung, kidney and fibroblasts. Drp1 has a highly conserved N-terminal GTPase domain, a helical domain in the middle and a GED domain at the c-terminus. The presence of a highly conserved GTPase domain in Drp1 suggests that Drp1 may be critically involved in several essential cellular functions, including: (1) mitochondrial division, (2) mitochondrial distribution, (3) peroxisomal fragmentation, (4) phosphorylation, (5) ubiquitination and (6) SUMOylation (63–65). Several studies suggest that Drp1 is involved in increased mitochondrial division and decreased fusion (60–62,64). Further, a loss of Drp1 function increased mitochondrial fusion and mitochondrial connectivity (62,66). Overexpressed WT Drp1 in primary neurons caused excessive fragmentation and impaired mitochondrial distribution. In contrast, overexpressed dominant negative mutation of Drp1 led to increased fusion (64–66). Thus, the movement or distribution of mitochondria into dendrites appears essential to support synapses, and synaptic activity appears to modulate mitochondrial motility and the fusion–fission balance. However, the links between Drp1 and Aβ, and between Drp1 and phosphorylated Tau are not well understood.

To understand the normal function of Drp1, two groups independently generated knockout mouse models for Drp1 (67,68). Ishihara et al. (68) found that mice lacking Drp1 (−/−) had developmental abnormalities, particularly in the forebrain, and they died at embryonic day 12.5. Neural cell-specific (NS) Drp1 (−/−) mice died shortly after birth from brain hypoplasia with apoptosis (67). Primary culture of the NS-Drp1 (−/−) mouse forebrain revealed a decrease in neurites and the formation of defective synapses, the latter of which is thought to be due to aggregated mitochondria failing to distribute properly within neuronal processes. The Sesaki research group (64,66) developed complete and tissue-specific mouse knockouts of Drp1. Homozygote knockout Drp1 mice died by embryonic day 11.5. Mitochondria formed extensive networks, and peroxisomes were elongated in Drp1-null embryonic fibroblasts. Brain-specific Drp1 depletion caused developmental defects. Both knockout studies indicate that Drp1 is essential for cell survival, and for mitochondrial division and distribution in neurons. However, it is unclear whether and how reduced Drp1 (+/−) affects mitochondrial division and distribution in the normal brain, and what the effect of partial deficiency of Drp1 is, in mice expressing the Tau mutation.

In the current study, we sought to determine the protective effects of a partial reduction of Drp1 in mutant Tau mice in the development and progression of disease process in AD. We crossed Drp1+/− mice and mutant Tau mice and generated double mutant (TauXDrp1+/−) mice. Using cortical tissues from 6-month-old Tau, Drp+/−, double mutant (TauXDrp1+/−) and WT mice, we studied (1) mitochondrial structure and activity by measuring mRNA and protein levels of genes related to mitochondrial dynamics, mitochondrial matrix, mitochondrial biogenesis; (2) synaptic activities by measuring mRNA and protein levels of synaptic genes; (3) assessed mitochondrial function by measuring free radical production, lipid peroxidation, mitochondrial ATP and GTPase Drp1 activity and (4) Tau pathology.

Results

mRNA expressions

To determine whether a partial reduction of Drp1 protect neurons from phosphorylated Tau-induced mitochondrial and synaptic toxicities in AD progression, we measured mRNA levels of mitochondrial dynamics, biogenesis and synaptic genes in 6-month-old cortical/hippocampal tissues from Drp1+/−, Tau, TauXDrp1+/− mice relative to age-matched WT mice (Table 1). We also compared mRNA data between Tau and TauXDrp1+/− mice, in order to understand the protective role of reduced Drp1 in mutant Tau mice for mitochondrial and synaptic toxicities (Table 2).

Table 1

mRNA fold changes of mitochondrial dynamics, mitochondrial biogenesis and synaptic genes in 6 months old WT, Drp1+/−, Tau and Tau/Drp1+/− mice

Genes		mRNA fold changes
		Drp1+/−	Tau	Tau/Drp1+/−
Mitochondrial dynamics genes	Drp1	−2.2**	2.3*	1.3
	Fis1	−2.0**	3.3**	1.2
	Mfn1	1.3	−1.5*	1.2
	Mfn2	1.3	−1.5*	1.2
	Opa1	1.3	−1.5*	1.4
	Cyclophilin D	−1.4*	1.4*	1.2
Mitochondrial biogenesis genes	PGC1α	1.7*	−1.8*	1.1
	Nrf1	1.4*	−1.9*	1.3
	Nrf2	1.7**	−1.9*	1.3
	TFAM	1.7*	−1.6*	1.3
Synaptic genes	Synaptophysin	1.4*	−1.9**	1.3
	PSD-95	2.1**	−1.8*	1.3
	Synapsin 1	1.3	−2.3**	1.2
	Synapsin 2	1.2	−2.3*	1.1
	Synaptobrevin 1	1.2	−2.1*	1.2
	Synaptopodin	1.2	−1.4*	1.2
	Neurogranin	1.7**	−1.9**	1.3
	GAP43	1.9**	−2.3**	1.3

*

<0.05.

**

<0.005.

Table 2

mRNA fold changes of mitochondrial dynamics, mitochondrial biogenesis and synaptic genes in 6 months old Tau/Drp1+/− mice relative to Tau mice

Genes		mRNA fold changes
		Tau/Drp1+/−
Mitochondrial dynamics genes	Drp1	−1.6*
	Fis1	−1.5*
	Mfn1	2.7**
	Mfn2	1.5*
	Opa1	1.8*
	Cyclophilin D	−1.7**
Mitochondrial biogenesis genes	PGC1α	1.8**
	Nrf1	2.5**
	Nrf2	2.3**
	TFAM	2.1**
Synaptic genes	Synaptophysin	3.3**
	PSD-95	3.0**
	Synapsin 1	2.7**
	Synapsin 2	1.7*
	Synaptobrevin 1	2.5**
	Synaptopodin	2.1**
	Neurogranin	1.8**
	GAP43	2.8**

*

<0.05.

**

<0.005.

Mitochondrial dynamics genes

Drp1+/− mice versus WT mice

In 6-month-old Drp1+/− mice compared to age-matched WT mice, mRNA expression levels significantly decreased in Drp1, by 2.2-fold (P = 0.02); and in Fis1, by 2.0-fold (P = 0.002) (Table 1). In contrast, the levels of mRNA expression of mitochondrial fusion genes were significantly increased—Mfn1 by 1.3-fold, Mfn2 by 1.3-fold and Opa1 by 1.3-fold. These observations indicate that the reduced fission and increased fusion levels in Drp1 heterozygote knockout mice. Interestingly, mRNA expression of matrix gene CypD was significantly decreased by a 1.4-fold (P = 0.04) in 6-month-old Drp1+/− mice.

Tau mice versus WT mice

In mutant Tau mice relative to WT mice, mRNA expression levels significantly increased in Drp1, by 2.3-fold (P = 0.01); and in Fis1, by 3.3-fold (P = 0.001) (Table 1). In contrast, fusion genes were significantly reduced—Mfn1 by 1.5-fold (P = 0.02), Mfn2 by 1.2 and Opa1 by 1.3-fold. As expected CypD levels were increased by 1.4-fold (P = 0.04).

TauXDrp1+/− mice versus WT mice

In double mutant mice, relative to WT, mRNA levels of fission genes—Drp1 and Fis1 were slightly increased, but not significant. Fusion genes—Mfn1. Mfn2 and Opa1 were increased, but not significant (Table 1).

Mitochondrial biogenesis genes

Drp1+/− mice versus WT mice

mRNA levels of biogenesis genes were increased—PGC1α by 1.7-fold (P = 0.01), Nrf1 by 1.4-fold (P = 0.04), Nrf2 by 1.7-fold (P = 0.001) and TFAM by 1.7-fold (P = 0.03) in Drp1+/− mice relative to WT mice indicating that reduced Drp1 increases mitochondrial biogenesis in mice.

Tau mice versus WT mice

Mitochondrial biogenesis genes down-regulated, PGC1α by 1.8-fold (P = 0.02), Nrf1 by 1.9-fold (P = 0.02), Nrf2 by 1.9-fold (P = 0.01) and TFAM by 1.6-fold (P = 0.02) in mutant Tau mice relative to WT mice, suggesting that mutant Tau reduces biogenesis activity.

TauXDrp1+/− mice versus WT mice: As shown in Table 1, mitochondrial biogenesis genes were slightly increased TauXDrp1+/− mice, but not significant, indicating reduced Drp1 maintains mitochondrial biogenesis in the presence of mutant Tau in mice.

Synaptic genes

Drp1+/− versus WT mice

As shown in Table 1, mRNA levels significantly increased for synaptophysin by 1.4-fold (P = 0.03), PSD95 by 2.1-fold (P = 0.001), neurogranin by 1.7-fold (P = 0.003) and GAP43 by 1.9-fold (P = 0.002) in Drp1+/− mice relative to WT, indicating that reduced Drp1 increases synaptic activity.

Tau mice versus WT mice

mRNA levels of synaptic genes were significantly decreased—synaptophysin by 1.9-fold (P = 0.001), PSD95 by 1.8-fold (P = 0.02), synapsin 1 by 2.3-fold (P = 0.004), synapsin 2 by 2.3-fold (P = 0.01), synaptobrevin by 2.1-fold (P = 0.01), synaptopodin by 1.4-fold (P = 0.02), neurogranin by 1.9-fold (P = 0.002) and GAP43 by 2.3-fold (P = 0.001) (Table 1). These observations suggest that mutant Tau reduces synaptic activity.

TauXDrp1+/− mice versus WT mice

As shown in Table 1, synaptic genes were increased in double mutant mice relative to WT mice, indicating that reduced Drp1 maintains mRNA levels of synaptic genes in the presence of mutant Tau

mRNA differences between Tau mice and TauXDrp1+/− mice

We compared gene expression data between Tau mice and TauXDrp1+/− mice in order to understand whether reduced Drp1 protects against mutant Tau-induced mitochondrial and synaptic toxicities. As shown in Table 2, mRNA levels of fission genes were reduced—Drp1 by 1.6-fold (P = 0.04) and Fis1 by 1.5-fold (P = 0.04), fusion genes increased—Mfn1 by 2.7-fold (P = 0.001), Mfn2 by 1.5-fold (P = 0.04) and Opa1 by 1.8-fold (P = 0.01). CypD levels reduced by 1.7-fold (P = 0.005). These observations suggest that partial reduction of Drp1 increases fusion activity and reduces fission machinery in the presence of Tau mutation.

In double mutant mice relative to Tau mice, mitochondrial biogenesis was increased PGC1α by 1.8-fold (P = 0.004), Nrf1 by 2.5-fold (P = 0.005), Nrf2 by (P = 0.003) and TFAM by 2.1-fold (P = 0.004), indicating that reduced Drp1 enhances mitochondrial biogenesis activity (Table 2).

As shown in Table 2, mRNA levels of synaptic genes were significantly increased—synaptophysin by 3.3-fold (P = 0.001), PSD95 by 3.0-fold (P = 0.001), synapsin 1 by 2.7-fold (P = 0.002), synapsin 2 by 1.7-fold (P = 0.01), synaptobrevin by 2.5-fold (P = 0.003), synaptopodin 2.1-fold (P = 0.003), neurogranin by 1.8-fold (P = 0.01) and GAP43 by 2.8-fold (P = 0.002) (Table 2). These observations suggest that reduced Drp1 enhances synaptic activity in mutant Tau mice.

Immunoblotting analysis

To determine the protective effects of a partial reduction of Drp1 on mitochondrial and synaptic proteins, we quantified mitochondrial and synaptic proteins from cortical tissues of 6-month-old Drp1+/−, Tau, TauXDrp1+/− and WT mice.

Drp1+/− and WT mice

In Drp1+/− mice relative to WT mice, decreased proteins levels were found for Drp1 and Fis1, but not significant (Fig. 1A and B). In contrast, increased levels of mitochondrial fusion proteins, Mfn1, Mfn2 and Opa1 were found in Drp1+/− mice compared to WT mice, but not significant. CypD levels were decreased in Drp1+/− mice (P = 0.03) relative to WT mice.

Figure 1

Immunoblotting analysis of mitochondrial dynamics and biogenesis proteins. (A) Shows representative immunoblotting analysis of 6-month-old WT, Drp1+/−, Tau and TauXDrp1+/− mice. (B) Shows quantitative densitometry analysis of mitochondrial dynamics and the matrix proteins Drp1, Fis1, Mfn1, Mfn2, Opa1 and CypD. (C) Shows quantitative densitometry analysis of mitochondrial biogenesis proteins PGC1α, Nrf1, Nrf1, and TFAM. The fission proteins Drp1 and Fis1 and matrix protein CypD were significantly increased; and the fusion proteins Mfn1, Mfn2, and Opa1 were significantly decreased in Tau mice relative to WT mice, indicating the presence of abnormal mitochondrial dynamics. On the contrary, the fission proteins Drp1 and Fis1 and matrix protein CypD were significantly decreased; and the fusion proteins Mfn1, Mfn2, and Opa1 were significantly increased TauXDrp1+/− mice relative to Tau mice, indicating that reduced Drp1 protects against phosphorylated Tau-induced mitochondrial dynamics toxicity.

Mitochondrial biogenesis proteins (PGC1α; Nrf2, P = 0.01 and TFAM) were increased in Drp1+/− mice relative to WT (Fig. 1A and C).

Synaptic proteins, synaptophysin and PSD95 levels increased Drp1+/− mice relative to WT mice (Fig. 2A and B).

Figure 2

Immunoblotting analysis of phospho Tau and synaptic proteins. (A) Represents immunoblotting analysis. (B) Represents quantitative immunoblotting analysis. Synaptophysin and PSD95 proteins were significantly decreased in Tau mice relative to WT mice. On the contrary, synaptophysin and PSD95 proteins were increased in TauXDrp1+/− mice relative to Tau mice. Phosphorylated Tau protein is significantly decreased in TauXDrp1+/− mice relative to Tau mice.

Tau and WT mice

In Tau mice relative to WT mice, Drp1 (P = 0.01) and Fis1 (P = 0.01) proteins were increased (Fig. 1A and B) and fusion proteins Mfn1 (P = 0.04), Mfn2 (P = 0.02) and Opa1 (P = 0.03) were decreased and CypD was increased (P = 0.04). These observations agree with RNA data and suggest that the presence of abnormal mitochondrial dynamics.

Mitochondrial biogenesis proteins (PGC1α, P = 0.003, Nrf1, P = 0.03, Nrf2, P = 0.02 and TFAM, P = 0.02) were decreased in Tau mice relative to WT mice (Fig. 1A and C).

Synaptic proteins, synaptophysin (P = 0.03) and PSD95 (P = 0.01) were reduced in Tau mice relative WT mice.

TauXDrp1+/− mice and WT mice

In double mutant (TauXDrp1+/−) mice relative to WT mice, fission proteins levels were unchanged for Drp1and Fis1 (Fig. 1A and B). Fusion proteins, Mfn1, Mfn2 and Opa1 were unchanged in TauXDrp1+/− mice compared to WT mice.

The levels of mitochondrial biogenesis proteins, PGC1α, Nrf1, Nrf2 and TFAM, were unchanged in TauXDrp1+/− mice relative to WT (Fig. 1A and C).

Synaptic proteins, synaptophysin and PSD95 levels were unchanged in TauXDrp1+/− mice relative WT mice (Fig. 2A and B).

Tau mice and TauXDrp1+/− mice

Protein data were compared between Tau mice and TauXDrp1+/− mice, in order to understand whether reduced Drp1 affects mutant Tau-induced mitochondrial and synaptic proteins. As shown in Figure 1A and B, significantly reduced levels of fission proteins were found in TauXDrp1+/− mice (Drp1, P = 0.004; Fis1, P = 0.04) relative to Tau mice. On the contrary, fusion proteins were increased in TauXDrp1+/− mice (Mfn1; Mfn2, P = 0.03; Opa1, P = 0.04) relative to Tau mice. CypD was decreased (P = 0.02) in TauXDrp1+/− mice relative to Tau mice.

Mitochondrial biogenesis proteins were significantly increased in TauXDrp1+/− mice (PGC1α, P = 0.002; Nrf1, P = 0.01; Nrf2, P = 0.01 and TFAM, P = 0.001) and relative to Tau mice (Fig. 1A and C), indicating that reduced Drp1 enhances mitochondrial biogenesis.

Synaptic proteins were increased in TauXDrp1+/− mice (synaptophysin, P = 0.01; PSD95, P = 0.02) relative to Tau mice (Fig. 2A and B), indicating that reduced Drp1 enhances synaptic activity in Tau mice.

Phosphorylated Tau in Tau mice and TauXDrp1+/− mice

Phosphorylated Tau levels were significantly decreased in Tau mice relative to TauXDrp1+/− mice (P = 0.00), indicating that a partial reduction of Drp1 reduces phosphorylated Tau.

Immunofluorescence analysis

To determine the protective effects of reduced Drp1 on mitochondrial dynamics (Drp1, Fis1-fission; Mfn1, Mfn2 and Opa1-fusion), mitochondrial biogenesis (PGC1α, Nrf1, Nrf2 and TFAM) and synaptic protein (synaptophysin and PSD95) levels and localizations, immunofluorescence analysis was performed in cortical and hippocampal sections from WT, Drp1+/−, Tau and TauXDrp1+/− mice.

Drp1+/− mice and WT mice

As shown in Figure 3A and B, decreased levels of Drp1 (P = 0.01) and Fis1, and increased levels of Mfn1, Mfn2 and Opa1were found in Drp1+/− mice relative to WT mice.

Figure 3

Immunofluorescence analysis of mitochondrial dynamics proteins. (A) Represents immunofluorescence analysis. (B) Represents quantitative immunofluorescence analysis. The fission proteins Drp1 and Fis1 and matrix protein CypD were significantly increased; and the fusion proteins Mfn1, Mfn2, and Opa1 were significantly decreased in Tau mice relative to WT mice. On the contrary, the fission proteins Drp1 and Fis1 and matrix protein CypD were significantly decreased; and the fusion proteins Mfn1, Mfn2, and Opa1 were significantly increased TauXDrp1+/− mice relative to Tau mice. These immunofluorescence findings agree with immunoblotting results.

Mitochondrial biogenesis proteins (PGC1α, Nrf1, Nrf2 and TFAM) were increased in Drp1+/− mice relative to WT mice, but not significant (Fig. 4A and B).

Figure 4

Immunofluorescence analysis of mitochondrial biogenesis proteins. (A) Represents immunofluorescence analysis. (B) Represents quantitative immunofluorescence analysis. Significantly reduced levels of PGC1α (P = 0.03), Nrf1 (P = 0.001), Nrf2 (P = 0.03) and TFAM (P = 0.02) were found in Tau mice relative to WT mice. On the contrary, increased protein levels were found in PGC1α (P = 0.04), Nrf1 (P = 0.01), Nrf2 (P = 0.01) and TFAM (P = 0.01) in TauXDrp1+/− mice relative to Tau mice.

Synaptic proteins synaptophysin and PSD95 were increased in Drp1+/− mice relative WT mice, but not significant (Fig. 5A and B).

Figure 5

Immunofluorescence analysis of synaptic proteins. (A) Represents immunofluorescence analysis. (B) Represents quantitative immunofluorescence analysis. Synaptic proteins synaptophysin (P = 0.03) and PSD95 (P = 0.002) were significantly decreased in Tau mice relative WT mice (A, B). Synaptic proteins synaptophysin (P = 0.03) and PSD95 (P = 0.002) were significantly increased in TauXDrp1+/− mice relative Tau mice (A, B).

Tau and WT mice

Mitochondrial fission proteins—Drp1 (P = 0.02) and Fis1 (P = 0.003) were increased and fusion proteins Mfn1 (P = 0.01), Mfn2 (P = 0.04) and Opa1 (P = 0.02) were reduced in Tau mice relative to WT mice (Fig. 3A and B).

Mitochondrial biogenesis proteins (PGC1α, P = 0.03; Nrf1, P = 0.001; Nrf2, P = 0.03 and TFAM, P = 0.02) were decreased in Drp1+/− mice relative to WT mice (Fig. 4A and B).

Synaptic proteins synaptophysin (P = 0.03) and PSD95 (P = 0.002) were significantly decreased in Tau mice relative WT mice (Fig. 5A and B).

TauXDrp1+/− and WT mice

As shown in Figure 3A and B, mitochondrial fission proteins—Drp1 and Fis1 were increased and fusion proteins Mfn1, Mfn2 and Opa1 were reduced in TauXDrp1+/− mice relative to WT mice, but not significant (Fig. 3A and B).

Mitochondrial biogenesis proteins—PGC1α, Nrf1, Nrf2, and TFAM were increased in TauXDrp1+/− mice relative to WT mice (Fig. 4A and B). Statistical significance was reached only to Nrf1 (P = 0.02).

Synaptic proteins synaptophysin and PSD95 were increased in TauXDrp1+/− mice relative WT mice, but not significant (Fig. 5A and B).

Tau mice and TauXDrp1+/− mice

Immunofluorescence analyses were compared between double mutant mice and Tau for mitochondrial dynamics, biogenesis and synaptic proteins. As shown in Figure 3A and B, fission proteins Drp1 (P = 0.001) and Fis1 (P = 0.01) reduced and fusion proteins Mfn1 (P = 0.01), Mfn2 (P = 0.01) and Opa1 (P = 0.01) were reduced in TauXDrp1+/− mice relative to Tau mice.

Mitochondrial biogenesis proteins PGC1α (P = 0.04), Nrf1 (P = 0.01), Nrf2 (P = 0.01) and TFAM (P = 0.01) were increased in TauXDrp1+/− mice relative to Tau mice (Fig. 4A and B).

Synaptic proteins synaptophysin (P = 0.002) and PSD95 (P = 0.01) were increased in TauXDrp1+/− mice relative to Tau mice (Fig. 5A and B).

Phosphorylated Tau in Tau mice and TauXDrp1+/− mice

Using phosphorylated Tau antibody, pSer202/Thr205, we also conducted immunofluorescence analysis in cortical brain section. Phosphorylated Tau levels were significantly reduced in TauXDrp1+/− mice relative to Tau mice (P = 0.003) (Fig. 6A and B), indicating that a partial reduction of Drp1 reduces phosphorylated Tau in Tau mice.

Figure 6

Immunofluorescence analysis of phosphorylated Tau in Tau mice and TauXDrp1+/− mice. (A) Represents immunofluorescence analysis. (B) Represents quantitative immunofluorescence analysis. Immunoreactivity levels of phosphorylated Tau were significantly reduced in TauXDrp1+/− mice relative to Tau mice (P = 0.003), indicating that a partial reduction of Drp1 reduces phosphorylated Tau in Tau mice.

Mitochondrial function

Mitochondrial function was assessed in all four lines of 6-month-old mice by measure hydrogen peroxide, lipid peroxidation, cytochrome c oxidase activity, mitochondrial ATP and GTPase Drp1 activity.

H₂O₂ production

As shown in Figure 7A, significantly increased levels of hydrogen peroxide (H₂O₂) were found in Tau mice relative to WT mice (P = 0.005). When the data was compared between TauXDrp1+/− mice with Tau mice, H₂O₂ levels were significantly reduced (P = 0.04), indicating that a partial reduction of Drp1 reduces H₂O₂ levels in Tau mice (Fig. 7A).

Figure 7

Mitochondrial functional parameters in 6-month-old Drp1+/−, Tau, TauXDrp1+/− and WT mice. Mitochondrial function was assessed by measuring: (A) H₂O₂ production, (B) Lipid peroxidation, (C) Cytochrome oxidase activity (D) ATP levels, and (E) GTPase Drp1. The levels of H₂O₂ (P = 0.005) (A) and HNE (P = 0.04) (B) were significantly increased and the levels of cytochrome oxidase (P = 0.04) (C) and ATP (P = 0.02) (D) significantly decreased found in Tau mice relative to WT mice. The levels of H₂O₂ (P = 0.04) (A) and HNE (P = 0.04) (B) were significantly decreased and the levels of cytochrome oxidase (P = 0.02) (C) and ATP (P = 0.02) (D) significantly increased found in Tau/Drp1+/− mice relative to Tau mice. The levels of GTPase Drp1 activity was significantly reduced in Drp1+/− mice (P = 0.01) and increased in Tau mice (P = 0.03) relative to WT mice. In contrast, significantly decreased levels were found TauXDrp1+/− mice (P = 0.01) relative to Tau mice.

Lipid peroxidation

Similar to hydrogen peroxide, levels of 4-hydroxy-2-nonenol (HNE), an indicator of lipid peroxidation were significantly increased in Tau mice relative to WT mice (Fig. 7).

Lipid peroxidation levels were significantly reduced in TauXDrp1+/− mice relative to Tau mice, indicating that reduced Drp1 decreases lipid peroxidation levels in Tau mice.

Cytochrome oxidase activity

Significantly decreased levels of cytochrome oxidase activity were found in Tau mice relative to WT mice (Fig. 7C). Cytochrome oxidase activity levels were unchanged in Drp1+/− and TauXDrp1+/− mice relative to WT mice.

Cytochrome oxidase activity levels were increased in TauXDrp1+/− mice relative to Tau mice (P = 0.02), indicating that a partial reduction of Drp1 increases cytochrome oxidase activity in Tau mice.

ATP production

As shown in Figure 7D, significantly decreased levels of mitochondrial ATP were found Tau mice relative to WT mice (P = 0.02). Mitochondrial ATP levels were unchanged in Drp1+/− and TauXDrp1+/− mice relative to WT mice.

Significantly increased ATP levels were found in TauXDrp1+/− mice relative to Tau mice, indicating that reduced Drp1 increases ATP levels in Tau mice.

GTPase Drp1 enzymatic activity

Significantly decreased levels of GTPase Drp1 activity were found Drp1+/− mice relative to WT mice (P = 0.01). Interestingly, GTPase Drp1 activity levels were increased in Tau mice relative to WT mice (P = 0.03).

Significantly decreased GTPase Drp1 activity levels were found in TauXDrp1+/− mice relative to Tau mice, indicating that reduced Drp1 decreases GTPase Drp1 activity levels in Tau mice.

DISCUSSION

We investigated the protective effects of a partial reduction of Drp1 against Tau-induced mitochondrial and synaptic toxicities in mutant Tau mice. We created double mutant mice by crossing mutant Tau mice with Drp1 heterozygote knockout (Drp1+/−) mice. In the preliminary investigation, using real-time RT-PCR, immunoblotting, immunofluorescence analysis, we measured mRNA and protein levels of mitochondrial dynamics, mitochondrial biogenesis and synaptic genes in all four lines (Drp1+/−, Tau, TauXDrp1+/− and WT) of mice. Mitochondrial function was assessed by measuring the levels of H₂O₂, lipid peroxidation, cytochrome oxidase activity and mitochondrial ATP. GTPase-Drp1 enzymatic activity was measured. Decreased mRNA and protein levels of fission genes and increased levels of mitochondrial fusion and biogenesis and synaptic genes were found in 6-month-old TauXDrp1+/− mice relative to Tau mice. Mitochondrial dysfunction found to be reduced in TauXDrp1+/− mice relative to Tau mice. Phosphorylated Tau levels were significantly reduced in TauXDrp1+/− mice relative to Tau mice. These findings suggest that a partial reduction of Drp1 decreases the levels of phosphorylated Tau, reduces mitochondrial dysfunction, and maintains mitochondrial dynamics, enhances mitochondrial biogenesis and synaptic activity in Tau mice.

mRNA and protein changes

In the current study, abnormal mitochondrial dynamics—increased mRNA and protein levels of fission genes and decreased mRNA and protein levels of fusion genes were found in Tau mice, indicating mutant Tau causes impaired mitochondrial dynamics. Mitochondrial biogenesis was reduced, marked by significantly decreased expression of PGC1α, Nrf1, Nrf2 and TFAM genes in Tau mice. Further, decreased mRNA and protein levels of synaptic genes were found in Tau mice, indicating that mutant Tau or phosphorylated Tau affects synaptic activity. Our current study observations in Tau mice further strengthen our previous findings such as increased expression of the mitochondrial fission genes Drp1 and Fis1 and decreased expression of the mitochondrial fusion genes Mfn1, Mfn2, Opa1 and Tomm 40 in AD postmortem brains and primary hippocampal neurons from AβPP transgenic mice (69). In addition, we found increased mitochondrial fission, decreased mitochondrial fusion and elevated phosphorylation of Tau in brain tissues from APP, APP/PS1 and 3xTgAD mice (61).

On the other hand, our study findings revealed that a partial reduction of Drp1 (Drp1+/− mice) reduces fission activity and enhances fusion machinery in neurons from WT mice (70). Further, mitochondrial biogenesis activity is elevated in Drp1+/− mice. In addition, increased levels of mRNA and proteins of synaptic genes in Drp1+/− mice strongly suggest that reduced Drp1 enhances synaptic activity in the brain (70). Based on these observations, it is concluded that a partial reduction of Drp1 is beneficial for neuronal function in Tau mice.

Our comparative mRNA and protein data between Tau mice and double mutant (TauXDrp1+/−) mice revealed that reduced expression of fission genes and increased levels fusion genes and increased levels of mitochondrial biogenesis genes in double mutant mice, indicates that reduced Drp1 is protective against mutant Tau-induced mitochondrial toxicity. Further, increased expression synaptic genes in also suggest that reduced Drp1 is beneficial in the presence of Tau in double mutant (TauXDrp1+/−) mice. These observations agree with our previous notion that phosphorylated Tau interaction with Drp1, increases mitochondrial fragmentation, ultimately leading to mitochondrial dysfunction and neuronal damage (61). In the current study, we found a partial reduction of Drp1 reduces mitochondrial fragmentation or fission and increases mitochondrial fusion in the presence of phosphorylated Tau in mice—this may be true in humans with phosphorylated Tau in AD and other neurodegenerative diseases and other tauopathies. Our current study findings are based on 6 months old mice; we expect similar findings in later time points, 12- and 20-month-old mice.

It is well established that abnormal mitochondrial dynamics is evident in several neurodegenerative diseases, in which mutant protein(s) interaction with Drp1causes increased fragmentation of mitochondria—Aβ and phosphorylated Tau interaction with Drp1 in Alzheimer’s (7,8,17,44,69,71), mutant huntingtin interaction with Drp1 in Huntington’s (45,47–50), mutant SOD interaction with Drp1 in ALS (51,54) DJ, Parkin and alpha-synuclein interaction with Drp1 in Parkinson’s (55,57–60). Our current study findings may have implications to all these diseases that reduced Drp1 is protective against mutant protein(s)-induced mitochondrial fragmentation in neuronal damage in neurodegenerative disease process.

Very similar to reduced mitochondrial fragmentation due to partial reduction of Drp1, reduced Drp1 enhances synaptic activity in disease process in TauXDrp1+/− mice in the current study, and it is expected that partial reduction of Drp1 enhances synaptic activity in other neurodegenerative diseases, including Huntington’s, ALS, and Parkinson’s.

Mitochondrial function

In Tau mice, mitochondrial function was found to be defective (Fig. 7). Our observations agree with others on hyperphosphorylated-induced defective mitochondrial function (15,40–43) (Fig. 7). On the other hand, mitochondrial function was increased in Drp1+/− mice, indicating that reduced Drp1 boosts and/or maintains mitochondrial function in neurons.

As expected, mitochondrial function was increased in double mutant (TauXDrp1+/−) mice relative to Tau mice (Fig. 7A–E)—suggesting that reduced Drp1 exhibited increased mitochondrial ATP, cytochrome oxidase activity and reduced free radicals and oxidative stress. These observations strongly suggest that reduced Drp1 reduces phosphorylated Tau-induced cellular toxicity and boosts mitochondrial function and may promote neuronal longevity. Our mitochondrial functional data were consistent with gene-expression and protein data. The phosphorylated Tau pathology was dampened by the partial reduction of Drp1 and eventually, reduced free radicals and lipid peroxidation, and increased mitochondrial ATP and cytochrome oxidase activity. Thus, all of our data point to reduced Drp1 protects neurons against phosphorylated Tau-induced neuronal toxicity.

It is worth mentioning that phosphorylated Tau is significantly reduced in double mutant mice relative to Tau mice, further strengthening our notion that phosphorylated Tau is responsible for mitochondrial and synaptic toxicities in Tau mice. And reduced Drp1 lower phosphorylated Tau and phosphorylated Tau-induced mitochondrial and synaptic toxicities in AD neurons. Our observations will strongly support to develop reduced Drp1 therapeutic strategies for AD, tauopathies and other neurodegenerative diseases.

Materials and Methods

Mice and tissue preparation

To study the protective effects of partial deficiency of Drp1, we used Drp1 heterozygote knockout mice (gifted by Hiromi Sesaki, Johns Hopkins University) and mutant Tau mice (P301L line) mice were purchased from Jackson Labs, New York and used for our experiments.

Dynamin-related protein 1 heterozygote knockout mice

Drp1+/− mice were generated using genetic a recombination strategy, replaced exons 3–5 of the GTPase domain, of the mouse endogenous Drp1 gene, with a neomycin-resistant gene (67). Homozygous Drp1 (−/−) knockout mice are embryonic-lethal and die by embryonic day 11.5. However, heterozygote Drp1 (+/−) mice are viable, fertile, normal in size, and do not show any phenotypic abnormalities. Heterozygous mice are maintained in a mixed background C57BL6/6-129/SvEv. To determine which mice are homozygous WT (+/+) or heterozygous (+/−) for Drp1, we genotyped the mice, using the DNA prepared from tail biopsy and PCR amplification, as described in Wakabayashi et al. (67).

Mutant Tau mice

P301L mice were generated with human Tau P301L mutation (72). These mice developed age-dependent hyperphosphorylated Tau and NFTs in the neocortex, the hippocampus, and the cortex. Cognitive impairments were found at 4.5 months of age in homozygous mice and at 6 months of age in hemizygous mice. We purchased P301L mice from Taconic Farms (Cat # 1638-F, 1638-M) and used for our investigations. We did the genotyping for the human Tau P301L mutation by using the DNA prepared from tail biopsy and PCR amplification, as described in Lewis et al. (72).

Double mutant (TauXDrp1+/−) mice

We generated the double mutant (P301L—TauXDrp1+/−) mice, by genetic crossing P301L mice with Drp1 +/− mice. The resulting double mutant mice were studied Tau pathology and mitochondrial toxicity. We genotyped the Drp1+/− and P301L mutations, using DNA prepared from tail biopsy and for PCR amplification, as described in Wakabayashi et al. (67) and Lewis et al. (72).

All the mice were observed daily by a veterinary caretaker and further examined twice a week by laboratory staff, and if animals show premature signs of neurological deterioration, they were euthanized before experimentation according to the procedure for euthanasia approved by the TTUHSC-IACUC and will not be used in the proposed study.

Quantitative real-time RT-PCR

Using the reagent TriZol (Invitrogen), total RNA was isolated from cortical tissues from Tau, Drp+/−, TauXDrp1+/− and WT mice. Using primer express Software (Applied Biosystems, Carlsbad, CA, USA), we designed the oligonucleotide primers for the housekeeping genes β-actin, GAPDH, mitochondrial structural genes, fission genes (Drp1, Fis1), fusion genes (MFN1, MFN2, Opa1), the mitochondrial matrix protein CypD, mitochondrial biogenesis genes PGC1α, PGC1β, Nrf1, Nrf2, TFAM and synaptic genes, synaptophysin, PSD95, synapsins1-2, synaptobrevins1-2, neurogranin, GAP43, and synaptopodin. The primer sequences and amplicon sizes are listed in Table 2. Using SYBR-Green chemistry-based quantitative real-time RT-PCR, we measured mRNA expression of the above-mentioned genes, as described by Manczak and Reddy (73).

The mRNA transcript level was normalized against β-actin and the GAPDH at each dilution. The standard curve was the normalized mRNA transcript level, plotted against the log-value of the input cDNA concentration at each dilution. To compare β-actin, GAPDH, and neuroprotective markers, relative quantification was performed according to the CT method (Applied Biosystems). Briefly, the comparative CT method involved averaging triplicate samples, which were taken as the CT values for β-actin, GAPDH, and neuroprotective markers. β-actin normalization was used in the present study because the β-actin CT values were similar for the WT and Drp1+/−, Tau and TauXDrp1+/− mice for the mitochondrial dynamics, mitochondrial biogenesis, and the synaptic genes. The ΔCT-value was obtained by subtracting the average β-actin CT value from the average CT-value of the synaptic mitochondrial ETC genes and the mitochondrial structural genes. The ΔCT of WT mice was used as the calibrator. The fold change was calculated according to the formula 2^^ − (Δ ΔCT), where ΔΔCT is the difference between ΔCT and the ΔCT calibrator value. To determine the statistical significance of mRNA expression, the CT value differences between WT mice and other lines of mice were used in relation to β-actin normalization. Statistical significance was calculated using one-way ANOVA.

Immunoblotting analysis

To determine whether partial deficiency of Drp1 alters the protein levels of mitochondrial dynamics, biogenesis and synaptic genes that showed altered mRNA expression, we performed immunoblotting analyses of protein lysates from Tau, Drp1+/−, TauXDrp1+/− and WT mice as described in Manczak and Reddy (73). Twenty μg protein lysates from cortical/hippocampal tissues of all lines mice were resolved on a 4–12% Nu-PAGE gel (Invitrogen). The resolved proteins were transferred to nylon membranes (Novax Inc., San Diego, CA, USA) and were then incubated for 1 h at room temperature with a blocking buffer (5% dry milk dissolved in a TBST buffer). The nylon membranes were incubated overnight with the primary antibodies shown in Table 3. The membranes were washed with a TBST buffer 3 times at 10-min intervals and were then incubated for 2 h with appropriate secondary antibodies, followed by 3 additional washes at 10-min intervals. Mitochondrial and synaptic proteins were detected with chemilumniscence reagents (Pierce Biotechnology, Rockford, IL, USA), and the bands from immunoblots were quantified on a Kodak Scanner (ID Image Analysis Software, Kodak Digital Science, Kennesaw, GA, USA). Briefly, image analysis was used to analyze gel images captured with a Kodak Digital Science CD camera. The lanes were marked to define the positions and specific regions of the bands. An ID fine-band command was used to locate and to scan the bands in each lane and to record the readings.

Table 3

Summary of Quantitative real-time RT-PCR oligonucleotide primers used in measuring mRNA expression in mitochondrial dynamics and mitochondrial biogenesis and synaptic genes in 6-month-old WT, Drp1+/−, Tau and Tau/Drp1+/− mice

Gene	DNA sequence (5′–3′)	PCR product size
Mitochondrial dynamics genes
Drp1	Forward Primer ATGCCAGCAAGTCCACAGAA	86
	Reverse Primer TGTTCTCGGGCAGACAGTTT
Fis1	Forward Primer CAAAGAGGAACAGCGGGACT	95
	Reverse Primer ACAGCCCTCGCACATACTTT
MFN1	Forward Primer GCAGACAGCACATGGAGAGA	83
	Reverse Primer GATCCGATTCCGAGCTTCCG
MFN2	Forward Primer TGCACCGCCATATAGAGGAAG	78
	Reverse Primer TCTGCAGTGAACTGGCAATG
Cyclophilin D	Forward Primer AGATGTCAAATTGGCAGGGGG	91
	Reverse Primer TGCGCTTTTCGGTATAGTGCT
Opa1	Forward Primer ACCTTGCCAGTTTAGCTCCC	82
	Reverse Primer TTGGGACCTGCAGTGAAGAA
Mitochondrial biogenesis genes
PGC1α	Forward Primer GCAGTCGCAACATGCTCAAG	83
	Reverse Primer GGGAACCCTTGGGGTCATTT
Nrf1	Forward Primer AGAAACGGAAACGGCCTCAT	96
	Reverse Primer CATCCAACGTGGCTCTGAGT
Nrf2	Forward Primer ATGGAGCAAGTTTGGCAGGA	96
	Reverse Primer GCTGGGAACAGCGGTAGTAT
TFAM	Forward Primer TCCACAGAACAGCTACCCAA	84
	Reverse Primer CCACAGGGCTGCAATTTTCC
	Reverse Primer AGACGGTTGTTGATTAGGCGT
Synaptic genes
Synaptophysin	Forward Primer CTGCGTTAAAGGGGGCACTA	81
	Reverse Primer ACAGCCACGGTGACAAAGAA
PSD95	Forward Primer CTTCATCCTTGCTGGGGGTC	90
	Reverse Primer TTGCGGAGGTCAACACCATT
Synapsin 1	Forward Primer TGAGGACATCAGTGTCGGGTAA	64
	Reverse Primer GGCAATCTGCTCAAGCATAGC
Synapsin 2	Forward Primer TCCCACTCATTGAGCAGACATACT	63
	Reverse Primer GGGAACGTAGGAAGCGTAAGC
Synaptobrevin 1	Forward Primer TGCTGCCAAGCTAAAAAGGAA	68
	Reverse Primer CAGATAGCTCCCAGCATGATCA
Neurogranin	Forward Primer CTCCAAGCCAGACGACGATA	83
	Reverse Primer AACTCGCCTGGATTTTGGCT
GAP43	Forward Primer GCTGCGACCAAAATTCAGGC	83
	Reverse Primer GCTGGTGCATCACCCTTCT
Synaptopodin	Forward Primer TCCTGCGCCCTGAACCTA	70
	Reverse Primer GACGGGCGACAGAGCATAGA
Housekeeping genes
Beta actin	Forward Primer AGAAGCTGTGCTATGTTGCTCTA	91
	Reverse Primer TCAGGCAGCTCATAGCTCTTC
GAPDH	Forward Primer TTCCCGTTCAGCTCTGGG	59
	Reverse Primer CCCTGCATCCACTGGTGC

Immunofluorescence analysis and quantification

Immunofluorescence analysis was performed using midbrain sections from Tau, Drp1+/−, TauXDrp1+/− and WT mice as described in Manczak and Reddy (73). The sections were washed with warm PBS, fixed in freshly prepared 4% paraformaldehyde in PBS for 10 min, and then washed with PBS and permeabilized with 0.1% Triton-X100 in PBS. They were blocked with a 1% blocking solution (Invitrogen) for 1 h at room temperature. All sections were incubated overnight with primary antibodies (see Table 4). After incubation, the sections were washed 3 times with PBS, for 10 min each. The sections were incubated with a secondary antibody conjugated with Fluors 488 and 599 (Invitrogen) for 1 h at room temperature. The sections were washed 3 times with PBS and mounted on slides. Photographs were taken with a multiphoton laser scanning microscope system (ZeissMeta LSM510). To quantify the immunoreactivity of mitochondrial and synaptic antibodies for each treatment, 10–15 photographs were taken at ×40 magnification, and statistical significance was assessed, using one-way ANOVA for mitochondrial and synaptic and mitochondrial proteins.

Table 4

Summary of antibody dilutions and conditions used in the immunoblotting analysis of mitochondrial dynamics, mitochondrial biogenesis and synaptic proteins in 6 months old WT, Drp1+/−, Tau, and Tau/Drp1 +/− mice

Marker	Primary antibody—species and dilution	Purchased from company, state	Secondary antibody, dilution	Purchased from company, city and state
Drp1	Rabbit Polyclonal 1:500	Novus Biological, Littleton, CO	Donkey anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
Fis1	Rabbit Polyclonal 1:500	MBL International Corporation-life. Woburn, MA	Donkey anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
Mfn1	Rabbit Polyclonal 1:400	Novus Biological, Littleton, CO	Donkey anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
Mfn2	Rabbit Polyclonal 1:400	Abcam, Cambridge, MA	Donkey anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
Opa1	Rabbit Polyclonal 1:500	Novus Biological, Littleton, CO	Donkey anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
CypD	Mouse Monoclonal 1:500	EMD, Calobiochem Chemicals INC, Gibbstown, NJ	Sheep anti-mouse HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
SYN	Rabbit Polyclonal 1:400	Abcam, Cambridge, MA	Donkey anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
PSD95	Rabbit Monoclonal 1:300	Abcam, Cambridge, MA	Donkey anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
Tau (HT7)	Mouse Monoclonal 1:500	Thermo Fisher Scientific, Waltham, MA	Sheep anti-mouse HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
Tau-pThr181 (5H9L11)	Rabbit Monoclonal 1:300	Thermo Fisher Scientific, Waltham, MA	Donkey anti-rabbit HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ
B-actin	Mouse Monoclonal 1:500	Sigma-Aldrich, St Luis, MO	Sheep anti-mouse HRP 1:10 000	GE Healthcare Amersham, Piscataway, NJ

Table 5

Summary of antibody dilutions and conditions used in the immunohistochemistry/immunofluorescence analysis of mitochondrial dynamics, mitochondrial biogenesis and synaptic proteins in 6 months old WT, Drp1+/− Tau and Tau/Drp1+/− mice

Marker	Primary antibody—species and dilution	Purchased from company, state	Secondary antibody, dilution, Alexa fluor dye	Purchased from company, city and state
Drp1	Rabbit Polyclonal 1:300	Novus Biological, Littleton, CO	Donkey anti-Rabbit IgG Alexa Fluor 488 conjugate	Thermo Fisher Scientific, Waltham, MA
Fis1	Rabbit Polyclonal 1:300	Protein Tech Group, Inc., Chicago, IL	Donkey anti-Rabbit IgG Alexa Fluor 488 conjugate	Thermo Fisher Scientific, Waltham, MA
Mfn1	Rabbit Polyclonal 1:300	Protein Tech Group, Inc., Chicago, IL	Donkey anti-Rabbit IgG Alexa Fluor 488 conjugate	Thermo Fisher Scientific, Waltham, MA
Mfn2	Rabbit Polyclonal 1:200	Protein Tech Group, Inc., Chicago, IL	Donkey anti-Rabbit IgG Alexa Fluor 488 conjugate	Thermo Fisher Scientific, Waltham, MA
OPA1	Rabbit Polyclonal 1:500	Novus Biological, Littleton, CO	Donkey anti-Rabbit IgG Alexa Fluor 488 conjugate	Thermo Fisher Scientific, Waltham, MA
SYN	Rabbit Polyclonal 1:200	Protein Tech Group, Inc., Chicago, IL	Donkey anti-Rabbit IgG Alexa Fluor 488 conjugate	Thermo Fisher Scientific, Waltham, MA
PSD95	Rabbit Polyclonal 1:400	Protein Tech Group, Inc., Chicago, IL	Donkey anti-Rabbit IgG Alexa Fluor 488 conjugate	Thermo Fisher Scientific, Waltham, MA
Tau-pSer202/Thr205 (AT8)	Mouse Monoclonal 1:500	Thermo Fisher Scientific, Waltham, MA	Donkey anti-Mouse IgG Alexa Fluor 594 conjugate	Thermo Fisher Scientific, Waltham, MA

Mitochondrial functional assays

H₂O₂ production

Using an Amplex® Red H₂O₂ Assay Kit (Molecular Probes, Eugene, OR, USA), the production of H₂O₂ was measured using cortical tissues from Tau, Drp1+/−, TauXDrp1+/− and WT mice as described in Manczak and Reddy (73). Briefly, H₂O₂ production was measured in the mitochondria cortical tissues from all four lines of mice. A BCA Protein Assay Kit (Pierce Biotechnology) was used to estimate protein concentration. The reaction mixture contained mitochondrial proteins (μg/μl), Amplex Red reagents (50 μM), horseradish peroxidase (0.1 U/ml), and a reaction buffer (1X). The mixture was incubated at room temperature for 30 min, followed by spectrophotometer readings of fluorescence (570 nm). Finally, H₂O₂ production was determined, using a standard curve equation expressed in nmol/μg mitochondrial protein. Hydrogen peroxide levels were compared between WT mice with Tau, Drp+/−, double mutant (TauXDrp1+/−) mice and data were also compared between Tau mice versus TauXDrp1+/− mice.

Lipid peroxidation assay

Lipid peroxidates are unstable indicators of oxidative stress in the brain. The final product of lipid peroxidation is HNE, which was measured in the cell lysates prepared from cortical tissues from Tau, Drp1+/−, TauXDrp1+/− and WT mice. We used HNE-His ELISA Kit (Cell BioLabs, Inc., San Diego, CA, USA) as described in Manczak and Reddy (73). Briefly, freshly prepared protein as added to a 96-well protein binding plate and incubated overnight at 4 °C. It was then washed 3 times with a buffer. After the last wash, the anti-HNE-His antibody was added to the protein in the wells, which was then incubated for 2 h at room temperature and was washed again 3 times. Next, the samples were incubated with a secondary antibody conjugated with peroxidase for 2 h at room temperature, followed by incubation with an enzyme substrate. Optical density was measured (at 450nm) to quantify the level of HNE. Lipid peroxidation levels were compared between WT mice with Tau, Drp+/−, double mutant (TauXDrp1+/−) mice and data were also compared between Tau versus TauXDrp1+/− mice.

Cytochrome oxidase activity

Cytochrome oxidase activity was measured in cortical tissues from all lines of mice. Enzyme activity was assayed spectrophotometrically using a Sigma Kit (Sigma–Aldrich) following manufacturer’s instructions (73). Briefly, 2 μg protein lysate was added to 1.1 ml of a reaction solution containing 50 μl 0.22 mM ferricytochrome c fully reduced by sodium hydrosulphide, Tris–HCl (pH 7.0), and 120 mM potassium chloride. The decrease in absorbance at 550 mM was recorded for 1-min reactions at 10-sec intervals. Cytochrome c oxidase activity was measured according to the following formula: mU/mg total mitochondrial protein = (A/min sample − (A/min blank) × 1.1 mg protein × 21.84). The protein concentrations were determined following the BCA method. Cytochrome oxidase activity levels were compared between WT mice with Tau, Drp+/−, double mutant (TauXDrp1+/−) mice and data were also compared between Tau versus TauXDrp1+/− mice.

ATP levels

ATP levels were measured in mitochondria isolated from cortical tissues of Tau, Drp1+/−, TauXDrp1+/− and WT mice and using ATP determination kit (Molecular Probes), as described in Manczak and Reddy (73). The bioluminescence assay is based on the reaction of ATP with recombinant firefly luciferase and its subtract luciferin. Luciferase catalyzes the formation of light from ATP and luciferin. It is the emitted light that is linearly related to the ATP concentration, which is measured with a luminometer. ATP levels were measured from mitochondrial pellets using a standard curve method. ATP levels were compared between WT mice with Tau, Drp+/−, double mutant (TauXDrp1+/−) mice and data were also compared between Tau versus TauXDrp1+/− mice.

GTPase Drp1 enzymatic activity

Using a calorimetric kit (Novus Biologicals, Littleton, CO, USA), GTPase enzymatic activity was measured in cortical tissues from Tau, Drp1+/−, TauXDrp1+/− and WT mice following GTPase assay methods described in Manczak and Reddy (73), based on GTP hydrolyzing to GDP and to inorganic Pi. GTPase activity was measured, based on the amount of Pi that the GTP produces. By adding the ColorLock Gold (orange) substrate to the Pi generated from GTP, we assessed GTP activity, based on the inorganic complex solution (green). Colorimetric measurements (green) were read in the wavelength range of 650 nm. GTPase activity data were compared between WT mice with Tau, Drp+/−, double mutant (TauXDrp1+/−) mice and data were also compared between Tau mice versus TauXDrp1+/− mice.

Acknowledgements

We sincerely thank all the staff at the animal facility for taking care of all lines of mice that are used in the study.

Conflict of Interest statement. None declared.

Funding

National Institutes of Health grants (AG042178, AG047812); Garrison Family Foundation (to P.H.R.) and (GM089853 to H.S.).