Abstract

Patients with cystic fibrosis (CF) display low bone mass and alterations in bone formation. Mice carrying the F508del genetic mutation in the cystic fibrosis conductance regulator (Cftr) gene display reduced bone formation and decreased bone mass. However, the underlying molecular mechanisms leading to these skeletal defects are unknown, which precludes the development of an efficient anti-osteoporotic therapeutic strategy. Here we report a key role for the intermediate filament protein keratin 8 (Krt8), in the osteoblast dysfunctions in F508del-Cftr mice. We found that murine and human osteoblasts express Cftr and Krt8 at low levels. Genetic studies showed that Krt8 deletion (Krt8−/−) in F508del-Cftr mice increased the levels of circulating markers of bone formation, corrected the expression of osteoblast phenotypic genes, promoted trabecular bone formation and improved bone mass and microarchitecture. Mechanistically, Krt8 deletion in F508del-Cftr mice corrected overactive NF-κB signaling and decreased Wnt-β-catenin signaling induced by the F508del-Cftr mutation in osteoblasts. In vitro, treatment with compound 407, which specifically disrupts the Krt8-F508del-Cftr interaction in epithelial cells, corrected the abnormal NF-κB and Wnt-β-catenin signaling and the altered phenotypic gene expression in F508del-Cftr osteoblasts. In vivo, short-term treatment with 407 corrected the altered Wnt-β-catenin signaling and bone formation in F508del-Cftr mice. Collectively, the results show that genetic or pharmacologic targeting of Krt8 leads to correction of osteoblast dysfunctions, altered bone formation and osteopenia in F508del-Cftr mice, providing a therapeutic strategy targeting the Krt8-F508del-CFTR interaction to correct the abnormal bone formation and bone loss in cystic fibrosis.

Introduction

Cystic fibrosis (CF) is caused by mutations in the gene encoding the cystic fibrosis conductance regulator (CFTR) that regulates epithelial fluid secretion (1,2). Among the various mutations affecting the Cftr, the most prevalent Cftr mutation is the in-frame deletion of phenylalanine at position 508 (F508del-Cftr) in the nucleotide binding domain-1 (NBD1). In epithelial cells, the F508del-Cftr mutation causes Cftr unfolding and retention of the Cftr protein in the endoplasmic reticulum, leading to premature degradation by the proteasome (3,4). This results in decreased Cftr levels at the plasma membrane and subsequent lung failure (5). In addition to affecting epithelial cell function, Cftr mutations impact bone homeostasis. Patients with CF often display low bone mass with a significant clinical increase in bone fragility (6). The underlying mechanisms remain unknown but may involve alterations in bone metabolism (7,8). CFTR was reported to be expressed in osteoclasts and osteoblasts (9) but its potential role in bone cells is elusive. In mice, global Cftr knockdown causes bone loss and altered bone microarchitecture associated with decreased bone formation and increased bone resorption (10), but the cellular mechanisms that cause these effects are unknown. More relevant to the human disease, the prevalent F508del-Cftr mutation was found to cause decreased bone formation in mice (11) as a consequence of reduced osteoblast activity (12), which can be partly restored by treatment with a Cftr corrector (13). However, the molecular mechanisms relating the F508del-Cftr mutation to osteoblast dysfunctions in cystic fibrosis remain unknown, precluding the development of an efficient therapeutic strategy for combating the altered bone formation and bone loss in this disease.

The regulation of Cftr trafficking is a complex process which involves numerous proteins. In epithelial cells, the F508del-Cftr mutation is associated with impaired Cftr processing and transport to the cell membrane (14), which may be partially restored by Cftr corrective agents that improve folding and trafficking of the mutant protein (15). Recent data in epithelial cells showed that the intermediate filament protein keratin 8 (Krt8), binds directly and preferentially to the F508del over the wild type (WT) NBD1 domain of Cftr (16,17) and that disruption of the Krt8-F508del-Cftr interaction can rescue the trafficking of the mutant Cftr (17). While Krt8 is mostly expressed in epithelial cells, it is unknown whether this intermediate filament protein may play a direct or indirect role in bone cell activity. In this study, we show that genetic Krt8 deletion or pharmacological targeting of the Krt8-F508del-Cftr interaction corrected the abnormal NF-κB and Wnt signaling in mutant osteoblasts in vitro and in vivo, and corrected osteoblast function and bone formation in F508del-Cftr mice, providing a therapeutic strategy for attenuating the reduced osteoblast function, bone formation and bone mass in this model of cystic fibrosis that is relevant to the human disease.

Results

WT and F508del-Cftr osteoblasts express some Cftr and Krt8

Krt8 gene expression was previously detected in the bone marrow (18) but whether cells of the osteoblast lineage express the Krt8 intermediate filament protein is unknown. Here we determined whether murine and human osteoblasts express Krt8. Our PCR analysis indicates that Krt8 mRNA was expressed in murine WT and F508del-Cftr osteoblasts (Fig. 1A). Quantitative RT-PCR analysis confirmed the expression of Krt8 in both WT and F508del-Cftr murine osteoblasts with no difference between the two strains (Fig. 1B). The availability of a relevant anti-human KRT8 antibody (not available for mice) showed that KRT8 was expressed at low levels in WT and human homozygotic F508del-Cftr osteoblasts (Fig. 1C), although at lower levels compared to HeLa epithelial cells (Fig. 1D). WT and F508del-Cftr murine osteoblasts also expressed some Cftr mRNA as shown by PCR analysis (Fig. 1E). The levels of Cftr protein were however lower in osteoblasts than in epithelial cells (Fig. 1F). Using the anti-NBD1 antibody, we found that human F508del-CFTR osteoblasts also expressed CFTR at low levels compared to Hela cells or to Hela cells transfected with the F508del-CFTR mutation (Fig. 1G). These data indicate that both murine and human osteoblasts express some Krt8 and Cftr.

Figure 1.

Osteoblasts express some Krt8 and Cftr. (A) PCR analysis of Krt8 mRNA levels in murine osteoblasts (mOb) from 10 week-old WT and F508del-Cftr mice. Positive control: WT mouse kidney (+), Negative control: water (−). (B) Quantitative PCR analysis of Krt8 mRNA levels in mOb from WT and F508del-Cftr mice. (C) Western blot analyses of KRT8 in WT human osteoblasts (hOb) compared to hOb isolated from a rib of a 24 year old female homozygotic F508del-CFTR patient, and in F508del-Cftr hOb compared to HeLa cells used as positive controls (D). NaK pump (NaK-P) served as loading control. (E) PCR analysis of Cftr mRNA in mOb isolated from WT and in F508del-Cftr mice. Controls are as in (A). (F) Western blot analyses of Cftr mRNA in mOb isolated from WT and in F508del-Cftr mice compared to HeLa cells. RPB1 served as loading control. (G) Western blot analysis of CFTR in F508del-CFTR hOb compared to HeLa cells transfected or not with F508del-CFTR and used as controls. Tubulin served as loading control.

Figure 1.

Osteoblasts express some Krt8 and Cftr. (A) PCR analysis of Krt8 mRNA levels in murine osteoblasts (mOb) from 10 week-old WT and F508del-Cftr mice. Positive control: WT mouse kidney (+), Negative control: water (−). (B) Quantitative PCR analysis of Krt8 mRNA levels in mOb from WT and F508del-Cftr mice. (C) Western blot analyses of KRT8 in WT human osteoblasts (hOb) compared to hOb isolated from a rib of a 24 year old female homozygotic F508del-CFTR patient, and in F508del-Cftr hOb compared to HeLa cells used as positive controls (D). NaK pump (NaK-P) served as loading control. (E) PCR analysis of Cftr mRNA in mOb isolated from WT and in F508del-Cftr mice. Controls are as in (A). (F) Western blot analyses of Cftr mRNA in mOb isolated from WT and in F508del-Cftr mice compared to HeLa cells. RPB1 served as loading control. (G) Western blot analysis of CFTR in F508del-CFTR hOb compared to HeLa cells transfected or not with F508del-CFTR and used as controls. Tubulin served as loading control.

Genetic Krt8 deletion corrected bone volume and microarchitecture in F508del-Cftr mice

To test whether Krt8 in osteoblasts may be involved in the altered osteoblast functions in F508del-Cftr mice, we crossed F508del-Cftr mice with Krt8−/− mice and analyzed the phenotype in male Krt8−/−-F508del-Cftr mice at 10 weeks of age when the F508del-Cftr mutation maximally impacts bone mass (12,13). Since the role of Krt8 in bone was unknown, we first determined the impact of Krt8 deletion on bone homeostasis. We found that genetic Krt8 deletion caused a 50% decrease in long bone volume and bone mass, as shown by histomorphometric analysis (Fig. 2A and B). The reduced bone mass in Krt8−/− mice resulted from decreased trabecular number and thickness, associated with increased trabecular separation (Fig. 2C–E). This phenotype in adult Krt8−/− mice was confirmed by micro-CT analysis and was associated with reduced cortical thickness and a minor decrease in body weight and size compared to WT mice (Supplementary Material, Fig. S1). We next analyzed the impact of genetic deletion of Krt8 on bone mass and bone formation in adult F508del-Cftr mice. The trabecular bone volume in femur metaphysis was decreased in F508del-Cftr mice compared to WT mice in this genetic background (Fig. 2A and B) confirming our results in the FVB/N genetic background (13). Histomorphometric analyses indicated that the decreased bone mass in long bones in F508del-Cftr mice was attenuated by genetic Krt8 deletion (Fig. 2A and B), which was confirmed by micro-CT analysis (Supplementary Material, Fig. S1). Genetic Krt8 deletion in F508del-Cftr mice also tended to improve the trabecular bone microarchitecture (Fig. 2C–E, Supplementary Material, Fig. S1). In contrast to these positive effects of the Krt8 deletion in trabecular bone, cortical thickness was not improved in F508del-Cftr mice lacking Krt8 (Supplementary Material, Fig. S1). Similar results were found at the vertebral level (data not shown) and in female mice, although cortical thickness was improved in female F508del-Cftr mice with Krt8 deleted (Supplementary Material, Fig. S2). These beneficial effects on trabecular bone were not linked to increased body weight and size, which remained lower than in WT mice (Supplementary Material, Fig. S1). These results indicate that genetic Krt8 deletion rescued the loss of trabecular bone mass and microarchitecture induced by the F508del-Cftr mutation in mice.

Figure 2.

Krt8 deletion improved skeletal defects in male F508del-Cftr mice. (A) Representative histological images of femur metaphyses showing the changes in trabecular bone in male WT, Krt8−/−, F508del-Cftr mice and F508del-Cftr mice crossed with Krt8−/− mice at 10 weeks of age. 5 μm thick sections, red ponceau/aniline blue staining. Measurements were performed in the indicated standard zone in the secondary spongiosa. (B) Histomorphometric analysis of the bone volume and microarchitecture parameters measured in the indicated standard area (C–E). N = 6–9 mice for each genotype (WT: 9; Krt8−/−: 6, F508del-Cftr: 6, Krt8−/−/F508del-Cftr: 9). Results are mean ± SEM. *P < 0.05 versus the indicated group.

Figure 2.

Krt8 deletion improved skeletal defects in male F508del-Cftr mice. (A) Representative histological images of femur metaphyses showing the changes in trabecular bone in male WT, Krt8−/−, F508del-Cftr mice and F508del-Cftr mice crossed with Krt8−/− mice at 10 weeks of age. 5 μm thick sections, red ponceau/aniline blue staining. Measurements were performed in the indicated standard zone in the secondary spongiosa. (B) Histomorphometric analysis of the bone volume and microarchitecture parameters measured in the indicated standard area (C–E). N = 6–9 mice for each genotype (WT: 9; Krt8−/−: 6, F508del-Cftr: 6, Krt8−/−/F508del-Cftr: 9). Results are mean ± SEM. *P < 0.05 versus the indicated group.

Keratin 8 deletion corrected osteoblast activity and bone formation in F508del-Cftr mice

We next examined whether the attenuation of bone loss induced by Krt8 deletion in F508del-Cftr mice was the result of decreased bone resorption or increased bone formation. We first found that Krt8 deletion in F508del-Cftr mice tended to increase serum levels of P1NP, an established marker of collagen type 1 synthesis by osteoblasts, and fully corrected serum levels of osteocalcin, a marker of the function of mature osteoblasts (Fig. 3A and B). Histomorphometric analyses showed that Krt8 deletion in WT mice decreased the function of osteoblasts as assessed by the bone mineral apposition rate (Fig. 3C and D). In marked contrast, Krt8 deletion fully corrected the defective mineral apposition rate in F508del-Cftr mice (Fig. 3C and D). Moreover, Krt8 deletion in F508del-Cftr mice increased the extent of bone forming surfaces, resulting in a marked increase in the bone formation rate at the tissue level (Fig. 3E and F). In contrast, Krt8 deletion in F508del-Cftr mice had no significant impact on the osteoclast surface or the number of active (TRAP+) osteoclasts (Fig. 3G and H). These results indicate that Krt8 deletion in F508del-Cftr mice corrected the defective bone formation and thereby attenuated the trabecular bone loss induced by the F508del-Cftr mutation in these mice.

Figure 3.

Krt 8 deletion corrected bone formation in F508del-Cftr mice. (A and B) Biochemical circulating parameters of bone formation in WT, Krt8−/−, F508del-Cftr and F508del-Cftr mice crossed with Krt8−/− mice. (C) Representative images of mineral apposition visualized by double fluorescent labeling in trabecular bone in each genotype. Bar: interval between the two labels. (D–F) Histomorphometric analysis of bone formation and resorption parameters (G and H) for each genotype. N = 6–9 mice for each strain genotype (WT: 9; Krt8−/−: 6, F508del-Cftr: 6, Krt8−/−/F508del-Cftr: 9). Results are mean ± SEM. *P < 0.05 versus the indicated group. N.S.: Not significant.

Figure 3.

Krt 8 deletion corrected bone formation in F508del-Cftr mice. (A and B) Biochemical circulating parameters of bone formation in WT, Krt8−/−, F508del-Cftr and F508del-Cftr mice crossed with Krt8−/− mice. (C) Representative images of mineral apposition visualized by double fluorescent labeling in trabecular bone in each genotype. Bar: interval between the two labels. (D–F) Histomorphometric analysis of bone formation and resorption parameters (G and H) for each genotype. N = 6–9 mice for each strain genotype (WT: 9; Krt8−/−: 6, F508del-Cftr: 6, Krt8−/−/F508del-Cftr: 9). Results are mean ± SEM. *P < 0.05 versus the indicated group. N.S.: Not significant.

We next analyzed whether the beneficial effect of Krt8 deletion in F508del-Cftr mice resulted from changes in osteoblast differentiation or activity. To achieve this goal, early and late osteoblast marker genes were analyzed in vivo in bone marrow-free long bones. As shown in Figure 4, Krt8 deletion in WT mice reduced the mRNA level of Runx2, a transcription factor associated with osteoblast differentiation, and reduced the mRNA level of Col1a1 characteristically highly expressed by the osteoblast (Fig. 4A and C). Ex vivo analysis in osteoblasts isolated from these mice confirmed that Krt8 deletion in WT mice reduced osteoblast gene expression (Supplementary Material, Fig. S3), indicating alteration of osteoblast differentiation in these mice. In marked contrast, Krt8 deletion in F508del-Cftr mice increased the levels of Runx2, Alp, Col1a1 and Oc which are markers of differentiated osteoblasts (Fig. 4A–D). To determine whether this effect occurred in a cell-autonomous manner, we analyzed the expression of these conventional osteoblast marker genes ex vivo using osteoblasts isolated from long bones. We found that Krt8 deletion in F508del-Cftr mice corrected all osteoblast marker genes ex vivo, supporting a cell-autonomous effect of Krt8 deletion on osteoblast differentiation and function in F508del-Cftr mice (Fig. 4E–H). These results indicate that Krt8 deletion corrected the defective osteoblast differentiation and function in F508del-Cftr mice, in contrast to WT mice.

Figure 4.

Krt8 deletion corrected osteoblast dysfunction in F508del-Cftr mice. (A–D) qRT-PCR analysis of mRNA levels for transcription factor Runx2, and the markers of the osteoblast function alkaline phosphatase (Alp), collagen type 1 α1 (Col1a1) and osteocalcin (Oc) in bone marrow-free femurs from WT, Krt8−/, F508del-Cftr and F508del-Cftr mice crossed with Krt8−/− mice. (E–H) qRT-PCR analysis of mRNA levels for functional marker genes in osteoblasts isolated from WT and F508del-Cftr mice alone or crossed with Krt8−/− mice. N = 6–9 mice for each genotype (WT: 9; Krt8−/−: 6, F508del-Cftr: 6, Krt8−/−/F508del-Cftr: 9). Results are mean ± SEM. *P < 0.05 versus the indicated group.

Figure 4.

Krt8 deletion corrected osteoblast dysfunction in F508del-Cftr mice. (A–D) qRT-PCR analysis of mRNA levels for transcription factor Runx2, and the markers of the osteoblast function alkaline phosphatase (Alp), collagen type 1 α1 (Col1a1) and osteocalcin (Oc) in bone marrow-free femurs from WT, Krt8−/, F508del-Cftr and F508del-Cftr mice crossed with Krt8−/− mice. (E–H) qRT-PCR analysis of mRNA levels for functional marker genes in osteoblasts isolated from WT and F508del-Cftr mice alone or crossed with Krt8−/− mice. N = 6–9 mice for each genotype (WT: 9; Krt8−/−: 6, F508del-Cftr: 6, Krt8−/−/F508del-Cftr: 9). Results are mean ± SEM. *P < 0.05 versus the indicated group.

Since we found that genetic Krt8 deletion corrected osteoblast function and bone formation in F508del-Cftr mice, we next investigated the mechanisms underlying these beneficial effects on bone homeostasis. Using osteoblasts isolated from F508del-Cftr mice, we recently showed that the F508del-Cftr mutation causes decreased osteoblast differentiation and function as a consequence of increased NF-κB and decreased Wnt-β-catenin signaling (19), which are negative and positive regulators of bone formation, respectively (20). We thus investigated whether Krt8 deletion may impact NF-κB and Wnt signaling in F508del-Cftr mice. Krt8 deletion in WT mice decreased the expression of Axin and Opg which are direct Wnt target genes, whereas the expression of receptor activator of nuclear factor kappa-B ligand (Rankl) was unchanged (Supplementary Material, Fig. S3D–F). In marked contrast, Krt8 deletion in F508del-Cftr mice increased the expression of the Wnt target genes, Opg, Axin and Wnt1 inducible signaling pathway (Wisp) (Fig. 5A–D). These results suggest that Krt8 deletion leads to the inhibition of NF-κB and activation of canonical Wnt signaling in F508del-Cftr mice. To confirm the latter finding, we performed an immunohistochemical analysis of β-catenin in vertebrae from F508del-Cftr mice. As shown in Figure 5E, immunohistochemical analysis showed that total β-catenin levels were lower in metaphyseal osteoblasts in F508del-Cftr mice compared to WT mice. Krt8 deletion in F508del-Cftr mice increased β-catenin levels in osteoblasts, which was confirmed by semi-quantitative analysis (Fig. 5E). Collectively, these findings indicate that Krt8 deletion corrected the abnormal NF-κB and Wnt-β-catenin signals in the bones of F508del-Cftr mice.

Figure 5.

Krt8 deletion corrected NF-κB and Wnt target genes in F508del-Cftr mice. (A and B) qRT-PCR analysis of mRNA levels for osteoprotegerin (Opg) and Rankl mRNA in osteoblasts isolated from WT, F508del-Cftr and F508del-Cftr mice crossed with Krt8−/− mice. (C and D) qRT-PCR analysis of mRNA levels for the Wnt target genes Axin and Wnt1 inducible signaling pathway (Wisp) mRNA levels in osteoblasts isolated from each genotype. (E) Representative immunohistochemical analysis and semi-quantitative analysis of total β-catenin labeling (arrows) in histological sections of the vertebral metaphysis from WT, Krt8−/−, F508del-Cftr mice or F508del-Cftr mice crossed with Krt8−/− mice (×125). Insert shows specific total β-catenin labeling in trabecular osteoblasts (Ob) (×400). N = 6–9 mice for each genotype (WT: 9; F508del-Cftr: 6, Krt8−/−/F508del-Cftr: 9). Results are mean ± SEM. *P < 0.05 versus the indicated group. N.S.: Not significant.

Figure 5.

Krt8 deletion corrected NF-κB and Wnt target genes in F508del-Cftr mice. (A and B) qRT-PCR analysis of mRNA levels for osteoprotegerin (Opg) and Rankl mRNA in osteoblasts isolated from WT, F508del-Cftr and F508del-Cftr mice crossed with Krt8−/− mice. (C and D) qRT-PCR analysis of mRNA levels for the Wnt target genes Axin and Wnt1 inducible signaling pathway (Wisp) mRNA levels in osteoblasts isolated from each genotype. (E) Representative immunohistochemical analysis and semi-quantitative analysis of total β-catenin labeling (arrows) in histological sections of the vertebral metaphysis from WT, Krt8−/−, F508del-Cftr mice or F508del-Cftr mice crossed with Krt8−/− mice (×125). Insert shows specific total β-catenin labeling in trabecular osteoblasts (Ob) (×400). N = 6–9 mice for each genotype (WT: 9; F508del-Cftr: 6, Krt8−/−/F508del-Cftr: 9). Results are mean ± SEM. *P < 0.05 versus the indicated group. N.S.: Not significant.

Targeting Krt8-F508del-Cftr corrected NF-κB activity, Wnt signaling and osteoblast function in F508del-Cftr mice

We next investigated the molecular mechanisms by which Krt8 deletion may correct osteoblast function in mutant osteoblasts. One hypothesis is that Krt8 deletion may act on Cftr function which in turn might control osteoblast function. However, we found that treatment of WT osteoblasts with Inh-172, a selective inhibitor of Cftr function, had no significant effect on osteoblast gene expression in either WT murine osteoblasts (Supplementary Material, Fig. S4A–D) or WT human osteogenic cells (Supplementary Material, Fig. S4E–H), suggesting that inhibition of the Cftr channel function does not directly impact osteoblast function. Besides Cftr, Krt8 was found to interact with P62 (21), a protein that regulates several functions including autophagy and NF-κB signaling (22,23). In osteoclasts, P62 interacts with components of the NF-κB-signaling pathway (24,25) and P62 was recently reported to control NF-κB signaling in osteoblasts (26). We found that P62 expression did not differ in WT and in F508del-Cftr osteoblasts as shown by western blot analysis (Supplementary Material, Fig. S4I) and immunohistochemistry (Supplementary Material, Fig. S4J), suggesting that the phenotype induced by Krt8 deletion in mutant mice was not directly linked to changes in P62 levels in osteoblasts. In epithelial cells, Krt8 interacts with F508del-Cftr, which contributes to the reduced Cftr trafficking and functional levels at the cell membrane (27). To test whether the F508del-Cftr interaction with Krt8 may directly impact osteoblast activity, we evaluated the effect of 407, a compound that blocks the interaction between F508del-Cftr and Krt8 by binding to F508del-NBD1, thus acting as a protein-protein interaction inhibitor in mutant epithelial cells (16,17). To this end, we tested whether the 407 compound may correct the osteoblast function in primary osteoblasts from F508del-Cftr mice in the FVB/N genetic background (19). Remarkably, treatment of F508del-Cftr osteoblasts with 407 at a dose that was shown to block the Krt8-F508del-Cftr interaction in mutant epithelial cells (17) corrected the expression of the osteoblast markers Runx2, Alp, Col1a1 and Oc in F508del-Cftr osteoblasts (Fig. 6A–D). Similar results, although to a lesser extent, were found in human osteoblasts from one homozygous patient with the F508del-CFTR mutation (Fig. 6E–H). Since 407 acts by blocking the interaction between F508del-Cftr and Krt8, no effect of 407 on osteoblast gene expression was observed in WT human or murine osteoblasts (data not shown). Interestingly, we found that treatment of murine F508del-Cftr osteoblasts with 407 tended to increase Opg levels and increased the expression of the Wnt responsive genes, Axin and Wisp1 (Fig. 6I, K and L). In addition, treatment with 407 corrected the exacerbated NF-κB transcriptional activity in F508del-Cftr osteoblasts (Fig. 6M). This beneficial effect was associated with correction of the lower than normal ALP activity in F508del-Cftr osteoblasts (Fig. 6N). Taken together, these results indicate that targeting specifically the Krt8-F508del-Cftr interaction using 407 in mutant osteoblasts corrected the abnormal NF-κB and Wnt signaling and osteoblast dysfunctions in F508del-Cftr osteoblasts in vitro.

Figure 6.

The pharmacological compound 407 corrected cell signaling and dysfunction in mutant osteoblasts. (A–H) qRT-PCR analysis of mRNA levels for phenotypic markers in osteoblasts isolated from WT or F508del-Cftr mice, (A–D) or human (h) F508del-CFTR osteoblasts isolated from one patient (E–H), after treatment with the compound 407 (10 μM) or the solvent for 24 h. (I–L) Effect of 407 on the expression of Wnt target genes and Rankl expression in osteoblasts isolated from F508del-Cftr mice compared to WT mice. (M) Treatment with 407 corrected NF-κB transcriptional activity in murine F508del-Cftr osteoblasts. (N) Treatment with 407 corrected alkaline phosphatase (ALP) activity in murine F508del-Cftr osteoblasts. Results are mean ± SEM. *P < 0.05 versus the indicated group. n = 6 mice or 4 replicates. N.S.: Not significant.

Figure 6.

The pharmacological compound 407 corrected cell signaling and dysfunction in mutant osteoblasts. (A–H) qRT-PCR analysis of mRNA levels for phenotypic markers in osteoblasts isolated from WT or F508del-Cftr mice, (A–D) or human (h) F508del-CFTR osteoblasts isolated from one patient (E–H), after treatment with the compound 407 (10 μM) or the solvent for 24 h. (I–L) Effect of 407 on the expression of Wnt target genes and Rankl expression in osteoblasts isolated from F508del-Cftr mice compared to WT mice. (M) Treatment with 407 corrected NF-κB transcriptional activity in murine F508del-Cftr osteoblasts. (N) Treatment with 407 corrected alkaline phosphatase (ALP) activity in murine F508del-Cftr osteoblasts. Results are mean ± SEM. *P < 0.05 versus the indicated group. n = 6 mice or 4 replicates. N.S.: Not significant.

Treatment with 407 corrected Wnt-β-catenin signaling and bone formation in F508del-Cftr mice

To determine whether targeting the Krt8-F508del-Cftr interaction may correct the osteoblast dysfunction in F508del-Cftr osteoblasts in vivo, F508del-Cftr mice in the FVB/N genetic background were treated with the compound 407 for 4 days, and the effects on bone metabolism were determined. Remarkably, we found that treatment with 407 rapidly corrected the defective bone formation in mutant mice, as demonstrated by the increased MAR, mineralizing surface and BFR (Fig. 7A–C). In this genetic background, the treatment with 407 also tended to decrease parameters of bone resorption (Fig. 7D and E). Mechanistically, we found that the administration of 407 in mutant mice increased total β-catenin immunostaining in osteoblasts in the metaphyseal bone, which was confirmed by semi-quantitative analysis (Fig. 7F). These results indicate that short-term treatment with 407 corrected the NF-κB and Wnt/β-catenin responsive genes, and rescued osteoblast activity and bone formation in in F508del-Cftr mice, suggesting a therapeutic strategy for attenuating the osteoblast dysfunctions in this murine model of cystic fibrosis.

Figure 7.

In vivo treatment with 407 corrected NF-κB and Wnt signaling and bone formation in F508del-Cftr mice. (A–C) Effect of short-term treatment with 407 (620 μg ×3/day, i.p., 4 days) or the solvent on dynamic parameters of bone formation and bone resorption parameters (D and E) in F508del-Cftr mice in the FVB/N genetic background. (F) Representative immunohistochemical analysis and semi-quantitative analysis of total β-catenin (arrows, black staining) in histological sections of femur metaphysis from untreated WT or F508del-Cftr mice treated with the compound 407 or the solvent (×125). (n = 4–9 mice per group) (WT: 8; F508del-Cftr: 9, F508del-Cftr + 407: 4). Results are mean ± SEM. *P < 0.05 versus the indicated group. N.S.: Not significant.

Figure 7.

In vivo treatment with 407 corrected NF-κB and Wnt signaling and bone formation in F508del-Cftr mice. (A–C) Effect of short-term treatment with 407 (620 μg ×3/day, i.p., 4 days) or the solvent on dynamic parameters of bone formation and bone resorption parameters (D and E) in F508del-Cftr mice in the FVB/N genetic background. (F) Representative immunohistochemical analysis and semi-quantitative analysis of total β-catenin (arrows, black staining) in histological sections of femur metaphysis from untreated WT or F508del-Cftr mice treated with the compound 407 or the solvent (×125). (n = 4–9 mice per group) (WT: 8; F508del-Cftr: 9, F508del-Cftr + 407: 4). Results are mean ± SEM. *P < 0.05 versus the indicated group. N.S.: Not significant.

Discussion

To date, the molecular mechanisms that cause the defective osteoblast dysfunctions and osteopenia induced by Cftr mutations are poorly understood, which precludes the development of a specific therapeutic strategy to correct the altered bone formation and prevent bone loss in cystic fibrosis. Here, we report a previously unrecognized role of the intermediate filament protein keratin 8 in osteoblasts, in the altered bone formation and osteopenia induced by the F508del-Cftr mutation in mice. We found that osteoblasts express some Krt8, as demonstrated by RT-PCR experiments, and that Krt8 deletion in normal mice caused osteopenia as a result of decreased bone formation. Krt8 deletion caused decreased expression of the osteoblast markers Runx2 and Col1a1 expression, indicating that Krt8 impacts osteoblast differentiation in normal mice. In marked contrast to these effects in WT mice, Krt8 deletion in F508del-Cftr mice corrected osteoblast differentiation markers and bone formation activity, and attenuated bone loss in these mutant mice. The finding that the abnormal bone phenotype induced by the F508del-Cftr mutation in mice was greatly improved by genetic Krt8 deletion suggests that Krt8 plays an important role in osteoblasts in the mechanisms driving the abnormal bone phenotype in F508del-Cftr mice.

The molecular mechanisms by which the intermediate filament protein Krt8 may control gene expression are likely to be complex. We first investigated the autophagy cascade because its signaling regulator P62 interacts with Krt8 (21) and Cftr (28) in epithelial cells. We found that P62 expression did not differ in WT and mutant osteoblasts in vitro or in vivo, suggesting that the correction of the bone phenotype by Krt8 deletion in mutant osteoblasts was not directly P62-dependent. Alternatively, Krt8 interacts with NF-κB and protein kinases in epithelial cells (29). In bone, the activation of NF-κB signaling is known to inhibit osteogenic differentiation in part by promoting β-catenin degradation (30). Our finding that Krt8 deletion in F508del-Cftr mice corrected NF-κB and Wnt target genes, and rescued osteoblast gene expression in vitro and in vivo indicate that the beneficial effect of Krt8 deletion on bone formation in F508del-Cftr mice involves in large part the correction of NF-κB and Wnt signaling in osteoblasts. This effect was not due to Krt8 deletion itself since this deletion decreased Wnt target gene expression in WT mice. These findings support the novel concept that the intermediate filament protein keratin 8, in non-epithelial cells (osteoblasts) governs these cells, bone formation and bone mass by modulating both anti-anabolic (NF-κB) and anabolic (Wnt/β-catenin) signaling pathways.

Our data may provide an attractive strategy for correcting the osteoblast dysfunction in cystic fibrosis. We found that the defective expression of osteoblast genes and function in F508del-Cftr mice osteoblasts was corrected by 407, a small molecule that specifically blocks the Krt8-F508del-Cftr interaction in mutant epithelial cells (31). Mechanistically, we found that treatment of F508del-Cftr osteoblasts with 407 corrected NF-κB and Wnt/β-catenin signaling and rescued osteoblast activity. These data support a role for the Krt8-F508del-Cftr interaction in the de-repression of NF-κB signaling, inhibition of Wnt/β-catenin signaling and subsequent dysfunction of mutant osteoblasts, although we cannot exclude other effects of 407 that remain to be explored in osteoblasts. Importantly, we show that the beneficial effect of the pharmacological molecule 407 in vitro translated into a therapeutic effect in vivo. Indeed, short-term administration of 407 in F508del-Cftr mice increased β-catenin levels in osteoblasts in the metaphysis, resulting in the correction of bone formation markers, osteoblast activity and bone formation rate in these mice. Moreover, bone resorption parameters tended to decrease after treatment with 407, suggestive of an additional inhibitory effect on bone resorption, most likely as a result of increased Wnt signaling activity and Opg levels which are known inhibitors of bone resorption (32). Since we found that treatment with 407 also improved osteoblast gene expression in human homozygous F508del-CFTR osteoblasts, this strategy may have a translational impact on bone formation in patients with the F508del-CFTR mutation.

Several different cellular mechanisms are known to be involved in F508del-Cftr degradation, trafficking and restoration of Cftr function. Notably, F508del-Cftr degradation and trafficking were recently found to be controlled in part by E3 ligases such as RNF5 and RNF185 (33), suggesting that these ligases may be targets for pharmacotherapy of CF. In addition, a number of new corrective agents targeting F508del-NBD1 have been recently discovered (34). Whether targeting these mechanisms may ameliorate the osteoblast dysfunction and skeletal abnormalities induced by the F508del-Cftr mutation warrants further investigation.

In summary, our data provide genetic and pharmacological evidence that Krt8 is involved in the osteoblast dysfunction and bone loss induced by the most frequent F508del-Cftr mutation in cystic fibrosis. Additionally, our study provides a molecular basis for developing efficient therapeutic strategies using either the 407 compound or other pharmacological compounds targeting the Krt8-F508del-Cftr interaction in F508del-Cftr osteoblasts to correct the altered bone formation and to attenuate bone loss in cystic fibrosis.

Materials and Methods

Mice and treatment

Rotterdam homozygous F508del-Cftr mice (F508del-Cftrtm1Eur) which express the clinically common F508del mutation in the Cftr gene and their normal Cftr+/+ homozygous littermates (WT mice) in the FVB/N background (Centre de Distribution, Typage et Archivage Animal, Centre National de la Recherche Scientifique, Orléans, France) were crossed with Krt8−/− mice in the 129-ola background (35). To minimize bowel obstruction and intestinal disorders, a commercially available osmotic laxative containing electrolytes (Movicol) was continuously supplied in the drinking water in all mice (13). We used 10 week-old adult male mice that exhibit decreased bone mass and bone formation relative to their normal littermates (12). For in vivo treatment, 10 week-old F508del-Cftr mice in the FVB/N background were treated intraperitoneally with the pharmacological compound 407 that disrupts the Krt8-F508del-Cftr in epithelial cells (31), at a dose of 620 µg/100 µl or the solvent (water), 3 times a day (4-h intervals) for 4 days. This dose was calculated so that the circulating levels were 5-fold the concentration used in vitro. Blood and bone samples were collected post-mortem and used as described. The animals were handled according to protocols approved by the Local Institutional Review Committee on Animal Care (P2.AE.099.09, Ethical Committee, University Paris Descartes, Paris, France).

Biochemical analyses

At sacrifice, blood was collected, serum aliquots were frozen before ELISA analysis of N-terminal propeptide of type 1 procollagen (P1NP) (IDS, Frankfurt, Germany) and osteocalcin levels (ImmunoDiagnostic Systems, Paris, France) which are two conventional circulating markers of bone formation.

MicroCT analysis

We used the micro-tomographic imaging system (µCT 40, Scanco Medical AG, Bassersdorf, Switzerland) equipped with a 5 µm focal spot X-ray tube as a source. The long axis of the femur was oriented orthogonal to the rotation axis of the scanner. Scans were performed at an isotropic, nominal resolution of 20 µm (medium resolution mode). Image segmentation and morphometric characterization of the acquired 3D image data included calculation of bone volume density (BV/TV), trabecular thickness (Tb.Th), separation (Tb.Sp) and number (Tb.N) in the trabecular bone compartment of the distal metaphysis as well as cortical thickness (Ct.Th) in the mid-diaphysis (12). The coefficient of variability between measurements and the inter-operator variability are less than 1 and 5%, respectively (36).

Histomorphometric analysis

For histomorphometric analysis, femurs were fixed in 70% ethanol, dehydrated and embedded in methyl methacrylate (12,13). Sections obtained with a Leica microtome (SM2500S) (Wetzlar, Germany) were stained with naphtol ASTR phosphate for the detection of tartrate resistant acid phosphatase (TRAP) which characterizes osteoclast activity, or with red ponceau/aniline blue, or left unstained for fluorochrome evaluation (calcein/tetracycline double labeling). The following parameters were analyzed blindly in a standard area over a distance of 1800 µm in the secondary spongiosa by two independent observers using a software package (Les Ulis, France): trabecular bone volume, trabecular number, trabecular separation and trabecular thickness (37). Osteoclast surface and number were determined on TRAP-stained sections using a Leitz integrated eyepiece at ×125 magnification (33). The mineral apposition rate (MAR), which reflects the bone matrix capacity of osteoblasts, was measured using image analyzer (Biocom) on calcein/tetracycline double labeled surfaces. The mineralizing surface, which reflects the extent of active osteoblasts along the bone surface, was measured in the same area using a Leitz integrated eyepiece. The bone formation rate (BFR), which reflects the bone formation activity at the tissue level, was calculated according to the standard nomenclature (38).

Cell cultures and treatments

Trabecular bone fragments isolated from mouse long bone metaphyses were cultured and cells displaying characteristics of osteoblasts were obtained by migration as described (39). Only second passage cells were used in the different assays. Similarly, human osteoblasts were obtained from a rib fragment in one homozygotic F508del-CFTR 24 year old female patient (34). Human primary MSCs derived from the bone marrow stroma were purchased from PromoCell (Heidelberg, Germany). HeLa cells stably transfected with the wild type Cftr plasmid construct or the F508del-Cftr mutation were provided by Dr P. Fanen (INSERM U955, Créteil, France). Cells were cultured in Dulbecco modified Eagle's medium supplemented with 10% FCS, 2 mm glutamine, 100 µg/ml streptomycin, 100 units/ml penicillin and 250 µg/ml Zeocin (Invitrogen, Cergy Pontoise, France) at 37°C and 5% CO2. The selective Cftr inhibitor 172 (Inh-172) was obtained from Sigma-Aldrich (Saint-Quentin Fallavier, France). The compound 407 was obtained and described previously (31). Alkaline phosphatase (ALP) activity was assayed using an Alkaline Phosphatase kit (Bio-Rad, Hercules, USA) (19).

Western blot and immunohistochemistry

For western blot analysis, cell samples obtained from 3–4 mice were pooled and prepared as described previously and western blots were performed in triplicate (19). Briefly, total proteins were solubilized in radioimmunoprecipitation buffer (50 mm Tris–HCl, pH 7.5, 150 mm NaCl, 1% Triton X-100, 1% deoxycholate, and 0.1% SDS) containing protease inhibitors (protease inhibitor cocktail; Roche Diagnostics, Basel, Switzerland) and phosphatase inhibitors (phosphatase inhibitor cocktail II; Sigma-Aldrich, St Louis, USA). Identical amounts (20–80 µg) were separated by SDS polyacrylamide gel electrophoresis on 8% polyacrylamide gels and transferred onto nitrocellulose filters (TransBlot; Bio-Rad, Hercules, CA, USA). Membranes were probed with the indicated antibody followed by incubation with goat anti-mouse IgG or goat anti-rabbit IgG HRP-conjugated secondary antibodies (ABCYS, Paris, France). Proteins were detected using ECL Plus Western Blotting detection system (GE Healthcare, Little Chalfont, Buckinghamshire, UK). The anti-Krt8 was used as described (16). The anti-CFTR antibodies used were an anti-human polyclonal antibody (ref. 2269, Cell Signaling Technology, St Quentin en Yvelines, France), anti-NBD1 Cftr antibody from the Cystic Fibrosis Foundation Therapeutics (CFFT) Antibody Distribution Program. A specific P62 antibody was provided by Dr J. Moscat (Sanford-Burnham Medical Research Institute, La Jolla, CA, USA). RNA polymerase II subunit (RPB1) or tubulin were used as loading controls (Euromedex, Souffelweyersheim, France).

Immunohistochemical analyses were performed on histological sections of mouse vertebrae fixed in 4% PFA, decalcified, dehydrated and embedded in paraffin, using the ImmPRESS reagent Kit (Vector, Abcys, France). After paraffin removal, sections were incubated in citrate buffer at 70° overnight for antigenic retrieval and treated with hyaluronidase (Sigma, St Louis, USA, 1 mg/ml) at 37° for 15 min. Endogenous peroxidase was inhibited by incubating the tissue section in 0.3% H2O2 for 10 min. Tissue sections were incubated with appropriate serum for 1 h before primary antibody incubation with anti-P62 (1/500) or anti-β-catenin (1/100, clone 247, Fisher Scientific, Illkirch, France) and were stained according to manufacturer's instructions. A semi-quantitative analysis was performed on separate sections from 3 to 5 mice using 0, 1 or 2 for no detectable staining, weak staining or intense staining, respectively.

PCR analyses

Total RNA was extracted from homogenized bone marrow-free long bones, kidneys or cultured bone cells from the number of mice indicated, using Trizol reagent (InVitrogen, Cergy Pontoise, France) and then used for PCR analysis or quantitative RT-PCR analysis. One µg of total RNA from each sample was reverse-transcribed (Applied Biosystems kit, Courtaboeuf, France). Quantitative PCR analysis (LightCycler; Roche Applied Science, Indianapolis, OH, USA) was conducted according to the manufacturer's instructions (www.roche-applied-science.com) using a SYBR Green PCR kit (ABGen, Courtabœuf, France) and specific primers (Table 1). Primers for Cftr (40) and Krt8 (41) were as described. Thermal conditions were: 10 min at 95°C then 40 cycles of 95°C—30 s, 60°C—30 s and 72°C—1 min. Signals were normalized to Hprt as internal control.

Table 1.

Sequences of primers used

Murine 
Hprt AS caacatcaacaggactcctcgtatt 
Hprt S gttggatatgcccttgactataatga 
Runx2 aggttggaggcacacatagg 
Runx2 AS ttgacctttgtcccaatgc 
Alp AS ggccttaccctcatgatgtcc 
Alp S aaggcttcttcttgctggtg 
Col1a1 S cttggtggttttgtattcgatgac 
Col1a1AS gcgaaggcaacagtcgct 
Oc AS ccaaggtagcgccggagtct 
Oc S ctcacagatgccaagccca 
Opg S ccatctggacattttttgcaaa 
Opg AS agtcggtgaagcaggagtg 
Rankl S gagtgactttatgggaacccg 
Rankl AS ggccacagcgcttctcag 
Axin S ccatgacggacagtagcgta 
Axin AS gccattggccttcacact 
Wisp1 S gtggacatccaactacacatcaa 
Wisp1 AS aagttcgtggcctcctctg 
Krt8 S ggacatcgagatcaccacct 
Krt8 AS tgaagccagggctagtgagt 
Cftr S acctcattgcctcacggagacatc 
Cftr AS aacaagtcccagagaagccccatc 
Human 
HPRT S TGACACTGGCAAAACAATGCA 
HPRT AS GGTCCTTTTCACCAGCAAGCT 
RUNX2 S TCTGGCCTTCCACTCTCAGT 
RUNX2 AS GACTGGCGGGGTGTAAGTAA 
ALP S CCCAAAGGCTTCTTCTTG 
ALP AS CTGGTAGTTGTTGTGAGC 
COL1A1 S GGACACAATGGATTGCAAGG 
COL1A1 AS TAACCACTGCTCCACTCTGG 
OC S ATGAGAGCCCTCACACTCCTC 
OC AS GCCGTAGAAGCGCCGATAGGC 
Murine 
Hprt AS caacatcaacaggactcctcgtatt 
Hprt S gttggatatgcccttgactataatga 
Runx2 aggttggaggcacacatagg 
Runx2 AS ttgacctttgtcccaatgc 
Alp AS ggccttaccctcatgatgtcc 
Alp S aaggcttcttcttgctggtg 
Col1a1 S cttggtggttttgtattcgatgac 
Col1a1AS gcgaaggcaacagtcgct 
Oc AS ccaaggtagcgccggagtct 
Oc S ctcacagatgccaagccca 
Opg S ccatctggacattttttgcaaa 
Opg AS agtcggtgaagcaggagtg 
Rankl S gagtgactttatgggaacccg 
Rankl AS ggccacagcgcttctcag 
Axin S ccatgacggacagtagcgta 
Axin AS gccattggccttcacact 
Wisp1 S gtggacatccaactacacatcaa 
Wisp1 AS aagttcgtggcctcctctg 
Krt8 S ggacatcgagatcaccacct 
Krt8 AS tgaagccagggctagtgagt 
Cftr S acctcattgcctcacggagacatc 
Cftr AS aacaagtcccagagaagccccatc 
Human 
HPRT S TGACACTGGCAAAACAATGCA 
HPRT AS GGTCCTTTTCACCAGCAAGCT 
RUNX2 S TCTGGCCTTCCACTCTCAGT 
RUNX2 AS GACTGGCGGGGTGTAAGTAA 
ALP S CCCAAAGGCTTCTTCTTG 
ALP AS CTGGTAGTTGTTGTGAGC 
COL1A1 S GGACACAATGGATTGCAAGG 
COL1A1 AS TAACCACTGCTCCACTCTGG 
OC S ATGAGAGCCCTCACACTCCTC 
OC AS GCCGTAGAAGCGCCGATAGGC 

NF-κB reporter assay

WT or F508del-Cftr osteoblasts were seeded in 24-well plates and co-transfected with 0.5 μg/well of the reporter plasmid, 10 ng/well of phRL-SV40, a Renilla expression plasmid as internal transfection control (Clontech, Mountain View, CA, USA). Empty pGL3-BASIC served as control for reporter activity. Firefly and Renilla luciferase activities were measured sequentially using Luciferase Reporter Assay System (Promega, Charbonnières-les-Bains, France) after treatment for 24 h with 407 (10 µM) or the solvent, and luciferase activity was normalized both to Renilla activity, as transfection control, and to values obtained with cells transfected with an empty pGL3-BASIC, as control for the variations with phRL-SV40 induced by treatment. Results are expressed as arbitrary units (A.U.) (19).

Statistical analysis

The data are the mean ± SEM of 3–9 individual mice per group, as indicated in the legends of figures, or at least 6 replicates. Data were analyzed using the statistical package ANOVA and Fisher test (Statview Software). Differences between the mean values were evaluated with a minimal significance of P < 0.05.

Supplementary Material

Supplementary Material is available at HMG online.

Funding

This work was supported by grants from Inserm, University Paris Diderot Sorbonne Paris Cité, the Associations Prévention and Traitement des Décalcifications and Rhumatisme et Travail (Paris, France) to P.J.M. A.E.'s laboratory was supported by French Research Agency, ANR CORCF, Vaincre La Mucoviscidose (No 20130500942) and Mucoviscidose-ABCF2.

Acknowledgements

The authors thank the CDTA (CNRS, Orléans, France) for providing the mouse strains, Mrs Manon Ricquebourg for her technical assistance and Prof. N. Partridge (New York University College of Dentistry, New York, USA) for English corrections.

Conflict of Interest statement: None declared.

References

1
Riordan
J.R.
,
Rommens
J.M.
,
Kerem
B.
,
Alon
N.
,
Rozmahel
R.
,
Grzelczak
Z.
,
Zielenski
J.
,
Lok
S.
,
Plavsic
N.
,
Chou
J.L.
et al
. (
1989
)
Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA
.
Science
 ,
245
,
1066
1073
.
2
Edelman
A.
,
Fritsch
J.
,
Ollero
M.
(
2011
)
Twenty years after cystic fibrosis gene identification: where are we and what are we up to?
Pathol. Biol. (Paris)
 ,
59
,
131
133
.
3
Cheng
S.H.
,
Gregory
R.J.
,
Marshall
J.
,
Paul
S.
,
Souza
D.W.
,
White
G.A.
,
O'Riordan
C.R.
,
Smith
A.E.
(
1990
)
Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis
.
Cell
 ,
63
,
827
834
.
4
Tucker
T.A.
,
Fortenberry
J.A.
,
Zsembery
A.
,
Schwiebert
L.M.
,
Schwiebert
E.M.
(
2012
)
The DeltaF508-CFTR mutation inhibits wild-type CFTR processing and function when co-expressed in human airway epithelia and in mouse nasal mucosa
.
BMC Physiol.
 ,
12
,
12
.
5
Lukacs
G.L.
,
Verkman
A.S.
(
2012
)
CFTR: folding, misfolding and correcting the DeltaF508 conformational defect
.
Trends Mol. Med.
 ,
18
,
81
91
.
6
Paccou
J.
,
Fardellone
P.
,
Cortet
B.
(
2013
)
Cystic fibrosis-related bone disease
.
Curr. Opin. Pulm. Med.
 ,
19
,
681
686
.
7
Elkin
S.L.
,
Vedi
S.
,
Bord
S.
,
Garrahan
N.J.
,
Hodson
M.E.
,
Compston
J.E.
(
2002
)
Histomorphometric analysis of bone biopsies from the iliac crest of adults with cystic fibrosis
.
Am. J. Respir. Crit. Care Med.
 ,
166
,
1470
1474
.
8
Stalvey
M.S.
,
Clines
G.A.
(
2013
)
Cystic fibrosis-related bone disease: insights into a growing problem
.
Curr. Opin. Endocrinol. Diabetes Obes.
 ,
20
,
547
552
.
9
Shead
E.F.
,
Haworth
C.S.
,
Condliffe
A.M.
,
McKeon
D.J.
,
Scott
M.A.
,
Compston
J.E.
(
2007
)
Cystic fibrosis transmembrane conductance regulator (CFTR) is expressed in human bone
.
Thorax
 ,
62
,
650
651
.
10
Dif
F.
,
Marty
C.
,
Baudoin
C.
,
de Vernejoul
M.C.
,
Levi
G.
(
2004
)
Severe osteopenia in CFTR-null mice
.
Bone
 ,
35
,
595
603
.
11
Paradis
J.
,
Wilke
M.
,
Haston
C.K.
(
2000
)
Osteopenia in Cftr-deltaF508 mice
.
J. Cyst. Fibros.
 ,
9
,
239
245
.
12
Le Henaff
C.
,
Gimenez
A.
,
Haÿ
E.
,
Marty
C.
,
Marie
P.J.
,
Jacquot
J.
(
2010
)
The F508del mutation in cystic fibrosis transmembrane conductance regulator gene impacts bone formation
.
Am. J. Pathol.
 ,
180
,
2068
2075
.
13
Le Henaff
C.
,
Haÿ
E.
,
Velard
F.
,
Marty
C.
,
Tabary
O.
,
Marie
P.J.
,
Jacquot
J.P.
(
2014
)
Enhanced F508del-CFTR channel activity ameliorates bone pathology in murine cystic fibrosis
.
Am. J. Pathol.
 ,
184
,
1132
1141
.
14
Becq
F.
(
2010
)
Cystic fibrosis transmembrane conductance regulator modulators for personalized drug treatment of cystic fibrosis: progress to date
.
Drugs
 ,
70
,
241
259
.
15
Bell
S.C.
,
De Boeck
K.
,
Amaral
M.D.
(
2015
)
New pharmacological approaches for cystic fibrosis: promises, progress, pitfalls
.
Pharmacol. Ther.
 ,
145
,
19
34
.
16
Davezac
N.
,
Tondelier
D.
,
Lipecka
J.
,
Fanen
P.
,
Demaugre
F.
,
Debski
J.
,
Dadlez
M.
,
Schrattenholz
A.
,
Cahill
M.A.
,
Edelman
A.
(
2004
)
Global proteomic approach unmasks involvement of keratins 8 and 18 in the delivery of cystic fibrosis transmembrane conductance regulator (CFTR)/deltaF508-CFTR to the plasma membrane
.
Proteomics
 ,
4
,
3833
3844
.
17
Colas
J.
,
Faure
G.
,
Saussereau
E.
,
Trudel
S.
,
Rabeh
W.M.
,
Bitam
S.
,
Guerrera
I.C.
,
Fritsch
J.
,
Sermet-Gaudelus
I.
,
Davezac
N.
et al
. (
2012
)
Disruption of cytokeratin-8 interaction with F508del-CFTR corrects its functional defect
.
Hum. Mol. Genet.
 ,
21
,
623
634
.
18
Traweek
S.T.
,
Liu
J.
,
Battifora
H.
(
1993
)
Keratin gene expression in non-epithelial tissues. Detection with polymerase chain reaction
.
Am. J. Pathol.
 ,
142
,
1111
1118
.
19
Le Henaff
C.
,
Mansouri
R.
,
Modrowski
D.
,
Zarka
M.
,
Geoffroy
V.
,
Marty
C.
,
Tarantino
N.
,
Laplantine
E.
,
Marie
P.J.
(
2015
)
Increased NF-kappaB and decreased Wnt-beta-catenin signaling mediate the reduced osteoblast differentiation and function in F508Delta-Cftr Mice
.
J. Biol. Chem.
 ,
290
,
18009
18017
.
20
Boyce
B.F.
,
Yao
Z.
,
Xing
L.
(
2010
)
Functions of nuclear factor kappaB in bone
.
Ann. N. Y. Acad. Sci.
 ,
1192
,
367
375
.
21
Janig
E.
,
Stumptner
C.
,
Fuchsbichler
A.
,
Denk
H.
,
Zatloukal
K.
(
2005
)
Interaction of stress proteins with misfolded keratins
.
Eur. J. Cell. Biol.
 ,
84
,
329
339
.
22
Moscat
J.
,
Diaz-Meco
M.T.
,
Wooten
M.W.
(
2007
)
Signal integration and diversification through the p62 scaffold protein
.
Trends Biochem. Sci.
 ,
32
,
95
100
.
23
Komatsu
M.
,
Kageyama
S.
,
Ichimura
Y.
(
2012
)
p62/SQSTM1/A170: physiology and pathology
.
Pharmacol. Res.
 ,
66
,
457
462
.
24
Duran
A.
,
Linares
J.F.
,
Galvez
A.S.
,
Wikenheiser
K.
,
Flores
J.M.
,
Diaz-Meco
M.T.
,
Moscat
J.
(
2008
)
The signaling adaptor p62 is an important NF-kappaB mediator in tumorigenesis
.
Cancer Cell
 ,
13
,
343
354
.
25
Ralston
S.H.
,
Layfield
R.
(
2012
)
Pathogenesis of Paget disease of bone
.
Calcif. Tissue Int.
 ,
91
,
97
113
.
26
Chang
K.H.
,
Sengupta
A.
,
Nayak
R.C.
,
Duran
A.
,
Lee
S.J.
,
Pratt
R.G.
,
Wellendorf
A.M.
,
Hill
S.E.
,
Watkins
M.
,
Gonzalez-Nieto
D.
et al
. (
2014
)
p62 is required for stem cell/progenitor retention through inhibition of IKK/NF-kappaB/Ccl4 signaling at the bone marrow macrophage-osteoblast niche
.
Cell Rep.
 ,
9
,
2084
2097
.
27
Kim
S.J.
,
Skach
W.R.
(
2012
)
Mechanisms of CFTR folding at the endoplasmic reticulum
.
Front. Pharmacol.
 ,
3
,
201
.
28
Villella
V.R.
,
Esposito
S.
,
Bruscia
E.M.
,
Maiuri
M.C.
,
Raia
V.
,
Kroemer
G.
,
Maiuri
L.
(
2013
)
Targeting the intracellular environment in cystic fibrosis: restoring autophagy as a novel strategy to circumvent the cftr Defect
.
Front. Pharmacol.
 ,
4
,
1
.
29
Lee
J.
,
Jang
K.H.
,
Kim
H.
,
Lim
Y.
,
Kim
S.
,
Yoon
H.N.
,
Chung
I.K.
,
Roth
J.
,
Ku
N.O.
(
2013
)
Predisposition to apoptosis in keratin 8-null liver is related to inactivation of NF-kappaB and SAPKs but not decreased c-Flip
.
Biol. Open
 ,
2
,
695
702
.
30
Chang
J.
,
Liu
F.
,
Lee
M.
,
Wu
B.
,
Ting
K.
,
Zara
J.N.
,
Soo
C.
,
Al Hezaimi
K.
,
Zou
W.
,
Chen
X.
et al
. (
2013
)
NF-kappaB inhibits osteogenic differentiation of mesenchymal stem cells by promoting beta-catenin degradation
.
Proc. Natl Acad. Sci. USA
 ,
110
,
9469
9474
.
31
Odolczyk
N.
,
Fritsch
J.
,
Norez
C.
,
Servel
N.
,
da Cunha
M.F.
,
Bitam
S.
,
Kupniewska
A.
,
Wiszniewski
L.
,
Colas
J.
,
Tarnowski
K.
et al
. (
2013
)
Discovery of novel potent DeltaF508-CFTR correctors that target the nucleotide binding domain
.
EMBO Mol. Med.
 ,
5
,
1484
1501
.
32
Baron
R.
,
Kneissel
M.
(
2013
)
WNT signaling in bone homeostasis and disease: from human mutations to treatments
.
Nat. Med.
 ,
19
,
179
192
.
33
El Khouri
E.
,
Le Pavec
G.
,
Toledano
M.B.
,
Delaunay-Moisan
A.
(
2013
)
RNF185 is a novel E3 ligase of endoplasmic reticulum-associated degradation (ERAD) that targets cystic fibrosis transmembrane conductance regulator (CFTR)
.
J. Biol. Chem.
 ,
288
,
31177
31191
.
34
Rowe
S.M.
,
Verkman
A.S.
(
2013
)
Cystic fibrosis transmembrane regulator correctors and potentiators
.
Cold Spring Harb. Perspect. Med
 .,
3
,
a009761
.
35
Baribault
H.
,
Penner
J.
,
Iozzo
R.V.
,
Wilson-Heiner
M.
(
1994
)
Colorectal hyperplasia and inflammation in keratin 8-deficient FVB/N mice
.
Genes Dev.
 ,
8
,
2964
2973
.
36
Verdelis
K.
,
Lukashova
L.
,
Atti
E.
,
Mayer-Kuckuk
P.
,
Peterson
M.G.
,
Tetradis
S.
,
Boskey
A.L.
,
van der Meulen
M.C.
(
2011
)
MicroCT morphometry analysis of mouse cancellous bone: intra- and inter-system reproducibility
.
Bone
 ,
49
,
580
587
.
37
Haÿ
E.
,
Laplantine
E.
,
Geoffroy
V.
,
Frain
M.
,
Kohler
T.
,
Muller
R.
,
Marie
P.J.
(
2009
)
N-cadherin interacts with axin and LRP5 to negatively regulate Wnt/beta-catenin signaling, osteoblast function, and bone formation
.
Mol. Cell. Biol.
 ,
29
,
953
964
.
38
Parfitt
A.M.
,
Drezner
M.K.
,
Glorieux
F.H.
,
Kanis
J.A.
,
Malluche
H.
,
Meunier
P.J.
,
Ott
S.M.
,
Recker
R.R.
(
1987
)
Bone histomorphometry: standardization of nomenclature, symbols, and units. Report of the ASBMR histomorphometry nomenclature committee
.
J. Bone Miner. Res.
 ,
2
,
595
610
.
39
Modrowski
D.
,
Marie
P.J.
(
1993
)
Cells isolated from the endosteal bone surface of adult rats express differentiated osteoblastic characteristics in vitro
.
Cell Tissue Res.
 ,
271
,
499
505
.
40
Bronckers
A.
,
Kalogeraki
L.
,
Jorna
H.J.
,
Wilke
M.
,
Bervoets
T.J.
,
Lyaruu
D.M.
,
Zandieh-Doulabi
B.
,
Denbesten
P.
,
de Jonge
H.
(
2010
)
The cystic fibrosis transmembrane conductance regulator (CFTR) is expressed in maturation stage ameloblasts, odontoblasts and bone cells
.
Bone
 ,
46
,
1188
1196
.
41
Tao
G.Z.
,
Toivola
D.M.
,
Zhong
B.
,
Michie
S.A.
,
Resurreccion
E.Z.
,
Tamai
Y.
,
Taketo
M.M.
,
Omary
M.B.
(
2003
)
Keratin-8 null mice have different gallbladder and liver susceptibility to lithogenic diet-induced injury
.
J. Cell Sci.
 ,
116
,
4629
4638
.