DAPL1, a susceptibility locus for age-related macular degeneration, acts as a novel suppressor of cell proliferation in the retinal pigment epithelium

Abstract

The retinal pigment epithelium (RPE) forms a monolayer at the back of the vertebrate eye and is fundamental to retinal function and homoeostasis. During early development, RPE cells undergo rapid proliferation, but in the adult, they remain normally nonproliferative throughout life. Nevertheless, under pathological conditions such as in proliferative vitreoretinopathy or after retinal ablation, mature RPE cells can re-enter the cell cycle and form nodules or multiple cell layers. Here we show that Dapl1, whose human homolog represents a susceptibility locus for age-related macular degeneration (AMD), is highly up-regulated in quiescent but not proliferating RPE cells and that experimental overexpression of DAPL1 in proliferating RPE cells inhibits their proliferation. Consistent with this observation, the percent of Ki67-positive cells is significantly higher in E11.5 Dapl1 knockout mouse embryos compared to age-matched controls. In adult Dapl1-/- mice, which survive without showing any overt pathology, RPE overgrowth leads to multiple cell layers and/or cellular nodules. The antiproliferative effect of DAPL1 is associated with an increase in CDKN1A protein levels. Reduction of CDKN1A by siRNA in DAPL1-overexpressing RPE cells in vitro partially restores cell proliferation. Hence, we show that DAPL1 is a novel regulator of RPE cell proliferation that is important for the maintenance of the RPE as a monolayer. The findings suggest that DAPL1 dysregulation may be involved in abnormal RPE-related proliferative diseases and corresponding retinal dysfunctions in humans.

Introduction

The retinal pigment epithelium (RPE) plays critical roles in eye development, retinal functions, and homoeostasis in the eye. RPE cells not only absorb scattered light but also secrete growth factors, maintain the blood-retinal barrier, participate in the visual cycle, provide antioxidant functions, and phagocytose photoreceptor outer segments (1). Not surprisingly, RPE cell damage or dysfunction cause retinal degeneration and related diseases, such as retinitis pigmentosa, proliferative vitreoretinopathy (PVR), and age-related macular degeneration (AMD), the latter being the leading cause of irreversible vision loss among the elderly in industrialized countries (2,3).

RPE cells have long served as an excellent model for the study of regulatory mechanisms in cell proliferation and regeneration (4,5). In vertebrates, RPE cells are derived from the dorsal portion of the optic vesicle. During early development, RPE cells proliferate but in the adult normally remain nonproliferative throughout life (5–7), except in the course of specific diseases such as retinal detachment or PVR where they migrate into the vitreous, undergo epithelial–mesenchymal transition (EMT), start to proliferate, and eventually develop into contractile membranes on retinal surfaces (8,9). It has been demonstrated that the transcription factors MITF, ZONAB, ZEB1, as well as Notch signaling, growth factors and microRNAs participate in RPE cell proliferation in mouse models (10–15). Nevertheless, in vivo support for these findings is still largely missing and little is known about the underlying molecular mechanisms. Furthermore, PVR is a major adverse effect of retinal detachment surgery and difficult to treat. Therefore, the analysis of RPE proliferation in the adult is critical to eventually design rational approaches to treat the above diseases.

In the present study, we show that the death-associated protein like-1 (DAPL1, also known as early epithelial differentiation-associated protein, EEDA) functions as a cell proliferation repressor in mature RPE cells both in vitro and in vivo. DAPL1 is known to be expressed in skin epithelial cells (16) but its biological functions are unknown. It has been reported that DAPL1 is expressed in RPE/retinal cells and that based on the analysis of a synonymous polymorphism, DAPL1 may serve as a female-specific susceptibility locus for AMD (17). Nevertheless, both the spatiotemporal expression and function of DAPL1 in the RPE are still unclear. Here we show that DAPL1 is highly expressed in adult RPE cells in mice as well as in mature RPE cells derived from human embryonic stem cells (hESC). Furthermore, overexpression of DAPL1 in RPE cells in vitro significantly inhibits cell proliferation and the lack of DAPL1 in Dapl1 knockout mice leads to an increase in cell proliferation. DAPL1 appears to act by upregulating CDKN1A (Cyclin-dependent kinase inhibitor 1) expression as knockdown of CDKN1A in DAPL1-overexpressing cells partially rescues cell proliferation through the regulation of E2F1, P107 and p-RB. Hence, DAPL1 inhibits RPE cell proliferation by regulating cell cycle-related proteins.

Results

Identification of DAPL1 expression in non-proliferative mature RPE cells

In order to elucidate the molecular mechanisms underlying the regulation of RPE cell proliferation, we first used an hESCs-based system of RPE differentiation (see Materials and Methods and Supplementary Material, Fig. S1). ESC-derived RPE cells show the typical hexagonal shape, are pigmented and express the RPE transcription factors MITF and OTX2. To examine the RPE cell proliferation, we performed Ki67 immunostaining. Similar to mature RPE cells in vivo, ESC-derived pigmented RPE cells were Ki67-negative while non-pigmented, MITF-positive cells were Ki67-positive (Fig. 1A) , suggesting that pigmented RPE cells lose proliferative activity. It was conceivable that one or more critical regulator was responsible for cell cycle exit of the pigmented RPE cells, and so we tested whether maturing ESC-derived RPE cells would express genes known to be associated with physiological RPE maturation in vivo. As shown in Figure 1B, RPE cell differentiation was associated with an increased expression of RPE65, an isomerase involved in the visual cycle, and the typical pigmentation genes DCT and TYRP1. We also observed up-regulated expression of several RPE proliferation-related genes, including MITF, ZEB1, RBPJK, PDGF-C, ZO-1, and DAPL1. DAPL1 is of particular interest here because it has been shown that it is expressed in epithelial cells and RPE/retinal cells (16,17). As compared to expression in proliferative ESC-derived RPE cells, DAPL1 RNA expression is much higher in non-proliferative, pigmented RPE cells (Fig. 1C).

Figure 1

DAPL1 is highly expressed in mature (nonproliferative) RPE cells and inhibits RPE cell proliferation. (A) hESC-derived pigmented, MITF-positive RPE cells are Ki67-negative, while unpigmented, MITF-positive RPE cells are Ki67-positive. (B) Real-time PCR analysis shows that the expression of RPE-specific and cell proliferation-related genes dramatically changes upon differentiation of hESC to pigmented RPE cells. (C) mRNA levels of DAPL1 in proliferative and non-proliferative mature RPE cells as examined by real-time PCR (the expression level of DAPL1 in proliferative RPE cells was set as 1.0). (D) Overexpression of DAPL1 (marked by co-expression of EGFP) in proliferative RPE cells inhibits cell proliferation. White arrows indicate absence of Ki67 staining in cells overexpressing DAPL1 (lower Ki67 panel) compared to control (upper Ki67 panel). (E) Statistical analysis of the number of Ki67-positive cells based on Fig. 1D. Results are presented as mean ± SD, ** indicates P < 0.01. Bar, 50 µm.

The above experiments suggested that DAPL1 may play a role in inhibiting RPE cell proliferation. We, therefore, tested whether over-expression of EGFP-DAPL1 in proliferative RPE cells would induce cell cycle exit. Indeed, four days after transfection, EGFP-DAPL1 overexpression led to a reduction in the number of Ki67-positive cells compared to transfection with EGFP alone (Fig. 1D and E). Hence, high level DAPL1 expression represses RPE cell proliferation.

DAPL1 localization and functional domain analysis

In order to determine DAPL1’s subcellular localization, we expressed epitope-tagged DAPL1 (DAPL1-HA) from an appropriate expression plasmid. As shown in Figure 2A, a positive DAPL1-HA signal can be detected in the nucleus. To test which of the three predicted DAPL1 domains (16) is functionally important in inhibiting RPE cell proliferation, we generated three distinct deletion plasmids. DAPL1-Del1 lacked a sequence predicted to be phosphorylated by PKC, DAPL1-Del2 one predicted to be phosphorylated by CKII, and DAPL1-Del3 one predicted to be N-glycosylated (Fig. 2B). These distinct plasmids were transfected into ARPE-19 cells and cell proliferation was assessed two days later by Ki67 immunostaining. As shown in Figure 2C, compared with wild type DAPL1, the DAPL1-Del1 mutant did not affect cell proliferation, while both the Del2 and Del3 mutants did. These results suggest that the PKC domain is required for DAPL1 to inhibit RPE cell proliferation.

Figure 2

Subcellular localization and functional domain analysis of DAPL1 protein. (A) Immunofluorescent staining of EGFP-IRES-DAPL1-HA protein 24 hours after transfection of a corresponding plasmid (see schematic diagram, top panel) into ARPE-19 cells. (B) Schematic diagram illustrating full length DAPL1 and various deletion constructs. DAPL1-Del1 represents a deletion of the protein kinase C (PKC) phosphorylation domain; DAPL1-Del2 represents a deletion of the casein kinase II (CKII) phosphorylation domain; DAPL1-Del3 represents a deletion of the N glycosylation (N-Gly) domain. (C) The corresponding plasmids were transfected into ARPE-19 cells and cell proliferation was analyzed using Ki67 immunofluorescence. White arrows mark transfected cells. (D) Statistical analysis of data based on Figure 2C. Results are presented as mean ± SD. ** indicates P < 0.01. Bar, 20 µm.

DAPL1 is expressed in mature RPE cells in mice

To address the question of the spatiotemporal expression pattern of DAPL1 in the RPE in vivo, we performed in situ hybridization (ISH) at different developmental stages. For this we used albino ICR mice as the presence of melanin can confound the ISH signal. As shown in Figure 3, there was no DAPL1 RNA signal at E10.5, and only a weak signal restricted to the dorsal part of the RPE was detected at E13.5. Strong expression was seen, however, at P1, and this expression was further increased at P60 (Fig. 3A–D). Hence, the DAPL1 expression in the RPE increased with increasing levels of RPE maturation. This increasing expression was paralleled by a decreasing level of cell proliferation as analyzed by Ki67 staining (Fig. 3E). If, however, adult RPE cells were dissociated and put in culture for a week, the number of Ki67-positive RPE cells increased (Figs. 3C and 5E), concomitant with a significant decrease of DAPL1 RNA levels as measured by RT-PCR (Fig. 3G). These results indicate that DAPL1 expression and cell proliferation are inversely correlated in vivo but do not yet establish a causal relationship between the two.

Figure 3

DAPL1 is highly expressed in mature RPE cells in mice and decreases after re-entry of cells into the cell cycle. (A–D) Dapl1 mRNA levels were examined by in situ hybridization in albino ICR mice using an Dapl1 probe in different developmental stages as indicated. (A'-D') The sense probe was used as negative control. Dapl1 was first detected in RPE cells at E13.5 and its expression is increased from P1 to P60 (black arrows). (E) Ki67 immunostaining was carried out in RPE cells of different development stages as indicated, The Ki67 signal can be detected in early developmental stage RPE cells, marked by white arrows. (F) Primary RPE cells were isolated from 2-month-old C57BL/6J mice, cultured for one week, and Ki67 immunostaining was used to mark proliferative cells (white arrows). (G) Both RT-PCR (left panels) and real-time PCR (right panel) were used to analyze Dapl1 mRNA levels in primary or cultured RPE cells (the expression level of Dapl1 in the cultured RPE cells was set as 1.0). Results are presented as mean ± SD. ** indicates P < 0.01. Bar, 50μm.

RPE cells are hyperproliferative in DAPL1 knockout mice

To determine whether DAPL1 regulates RPE cell proliferation in vivo, we generated Dapl1 knockout mice (hereafter called Dapl1-/- mice) using a CRISPR-Cas9 system in mouse ES cells (Fig. 4A). In the targeted mice, this CRISPR/Cas9-mediated gene disruption led to a genomic deletion of 104 bp comprising part of intron 1 and exon 2 of Dapl1 (Fig. 4B, Supplementary Material, Fig. S2A). In homozygous mice, this deletion was associated with the complete absence Dapl1 mRNA in RPE cells (Fig. 4C). Consistent with the mRNA result, western blotting and immunostaining suggested that DAPL1 protein is present in adult wild type though not Dapl1-/- RPE (Supplementary Material, Fig. S2B and C). Interestingly, Dapl1-/- mice did not show any obvious abnormal phenotypes, neither in the eye nor in other organs. Using double Ki767/PMEL17 immunostaining of RPE in sections of E11.5 embryos, however, we noticed an increased percentage of Ki67-positive RPE cells in Dapl1-/- compared to age-matched wildtype embryos (Fig. 4D and E), suggesting increased RPE proliferation. Interestingly, about 50% of eight month-old Dapl1-/- mice (n = 6/13) show multiple layers of RPE or RPE nodules, in contrast to the uniform single cell layer observed in age-matched wildtype mice (n = 5), (Fig. 4F). That these ectopic cells are indeed RPE cells was supported by the finding that they were positive for the RPE transcription factor OTX2 (Fig. 4G, white arrow). Hence, germline disruption of Dapl1 clearly increases RPE cell proliferation.

Figure 4

RPE cells are hyperproliferative in Dapl1 knockout mice. (A) Diagram illustrating CRISPR/Cas9 knockout of Dapl1. (B) Genotyping of C57BL/6 Dapl1-/- mice by RT-PCR using primer F and R indicated in A. (C) Dapl1 mRNA expression in wild type and Dapl1-/- RPE cells as assayed by RT-PCR using primers of q F and q R indicated in A (blue arrows). (D) Double PMEL17/Ki67 staining of E11.5 embryonic eyes. Note increase in the number of PMEL/Ki67 double-positive cells in the RPE of Dapl1-/- embryos (white arrows). (E) Quantitation of PMEL17/Ki67 double-positive cells in sections as shown in Figure 4D. Mean and S.D. based on 20 sections from three embryos. (F) Representative example of hematoxylin-eosin staining of paraffin-embedded sections of 8 month-old wild type (n = 5) and Dapl1-/- mice (n = 13). Note that the RPE displays multiple layers or raised cells (red arrow) in Dapl1-/- but not wildtype mice. (G) OTX2 immunostaining marking RPE cells in 8-month-old wildtype and Dapl1-/- mouse eyes. A single layer of OTX2-positive cells is seen in wildtype while raised OTX2-positive RPE cells are seen in Dapl1-/- mice (white arrow). ** indicates P < 0.01. Bar, 50 µm.

A high proliferative activity in RPE cells is a risk factor that can induce visual impairment under pathological conditions, such as retinal detachment (8,9,18). To test whether the presence or absence of functional Dapl1 would affect RPE cell proliferation after retinal detachment, we injected 0.25% hyalurate into the subretinal space of 3-months-old wildtype or Dapl1-/- mice, which is known to result in long-lasting retinal detachment. Ten days after hyalurate injection, the anatomical structure of the retina and RPE was analyzed by a hematoxylin-eosin (HE) staining. Interestingly, in Dapl1-/- mice, in areas where there is detachment, the RPE appears multi-layered or forms nodules, in contrast to areas of detachment in wild-type mice (Fig. 5A). These ectopic cells indeed represent proliferating RPE cells, as demonstrated by using Ki67 staining in combination with OTX2 staining. As shown in Figure 5B and C, in areas of detachment in wild-type, OTX2-positive cells were Ki67-negative and formed a single layer while in corresponding areas in Dapl1-/- mice, the ectopic cells were Ki67- and OTX2-positive. Taken together, these results indicate that disruption of Dapl1 leads to RPE hyperproliferation in embryos and can be further enhanced by retinal detachment in the adult.

Figure 5

Following retinal detachment, RPE cells show higher proliferative activity in Dapl1-/- compared to wildtype mice. (A) Hematoxylin-eosin staining of retinal sections from 3-month-old mice 10 days after hyalurate injection into the subretinal space. The RPE layer became thicker in Dapl1-/- mice compared with wildtype mice (red line) (B) OTX2 immunostaining marking RPE cells in the detached retinas. Multi-layers of OTX2-positive signal can be detected in Dapl1-/- but not wildtype mice (white arrows). (C) Ki67 immunostaining marking proliferative RPE cells, which can be detected in Dapl1-/- mice but not wildtype mice (white arrow). Bar, 50 µm.

DAPL1 mediates its role on RPE proliferation by regulating CDKN1A

In order to determine the downstream pathways by which DAPL1 regulates RPE proliferation, we analyzed the expression of cell cycle-related proteins in primary RPE cell cultures that were established from 3 month-old wild-type and Dapl1-/- mice and cultured for one week. As shown by Flow cytometry and Ki67 immunostaining, cultured Dapl1-/- RPE cells show higher proliferation rates compared to wild-type controls (Fig. 6A–D). Western blotting showed that in comparison with wild-type controls, the expression levels of the cell cycle proteins P107, P-RB and E2F1 were increased more than 1.5 fold in Dapl1-/- RPE cells and those of CDKN1A protein decreased by about 50% (Fig. 6E and F).

Figure 6

CDKN1A protein expression is reduced in Dapl1-/- RPE cells. (A) Primary RPE cells were isolated from 3-month-old wild type and Dapl1-/- mice and cultured for 7 days. Cell cycle parameters were then analyzed by fluorescence-activated cell sorting (FACS). (B) The statistical analysis data of the cell phases based on Figure 6A. (C) Increase in the numbers of proliferating cells as analyzed by Ki67 immunostaining. (D) Quantitation of Ki67-positive cells as seen in Figure 6C. (E) Western blots showing expression of a set of cell proliferation-associated proteins in wild type and Dapl1-/- RPE. (F) Quantitation of the western blot results shown in Figure 6E based on analysis using image J software (the protein levels in wildtype RPE cells were set as 1.0). Results are presented as mean ± SD. * indicates P < 0.05, ** indicates P < 0.01. Bar, 50μm.

As it is known that CDKN1A inhibits cell proliferation through down regulation of P107, P-RB and E2F1 and high-level expression of CDKN1A in RPE cells inhibits RPE cell proliferation (19,20), it is likely that DAPL1 inhibits RPE cell proliferation at least in part through the regulation of Cdkn1a.

To test this possibility, we overexpressed DAPL1 in ARPE-19 cells in which CDKN1A expression was reduced by siRNA-mediated knock-down. As expected, overexpression of DAPL1 led to an increase in CDKN1A expression, a concomitant inhibition of cell proliferation (Fig. 7A–D), and a decrease of P107, p-RB and E2F1 expression (Fig. 6E). Upon downregulation of CDKN1A by siRNA, however, P107 and p-RB downregulation was less pronounced after DAPL1 overexpression, although E2F1 levels showed no obvious change (Fig. 7I and J). Nevertheless, the number of Ki67-positive cells increased, as did total cell counts (Fig. 7F–J). These results indicate that DAPL1 inhibits RPE cell proliferation at least in part by regulating CDKN1A and its targets P107 and p-RB.

Figure 7

Role of CDKN1A in mediating the regulatory functions of DAPL1 in RPE cell proliferation. (A) DAPL1 mRNA levels in DAPL1 lentivirus-infected ARPE-19 cells (ARPE-19 + DAPL1). (B) Growth curves of ARPE-19 cells infected with DAPL1 lentivirus (ARPE19 + DAPL1) or control EGPF lentivirus (ARPE-19 + EGFP). (C) Ki67 immunostaining in ARPE-19 + EGFP and ARPE19 + DAPL1 cells shown in Figure 7B. (D) Percentage of Ki67-positive cells (mean ± SD) based on Figure 7C. (E) Western blots showing expression of cell proliferation-associated proteins. GAPDH was used as loading control. (F) Knock down of CDKN1A in ARPE-19 + DAPL1 cells (DAPL1/Si-CDKN1A) leads to reduced Ki67-positivity compared to control (DAPL1/Si-NC). (G) Quantitation (mean ± SD) of the number of Ki67-positive cells as seen in Figure 7F. (H) Cell numbers counted in DAPL1/Si-NC and DAPL1/Si-CDKN1A 48 hours after transfection. (I) CDKN1A mRNA levels determined by real-time PCR after control or Si-CDKN1A transfection of DAPL1 lentivirus-infected cells. (J) Western blots of cell cycle-associated proteins in control EGFP infected cells and DAPL1/Si-NC as well as DAPL1/Si-CDKN1A cells. * indicates <0.05, ** indicates P < 0.01. Bar, 20 µm.

Discussion

In the present study, we identify DAPL1 as a novel protein that plays a critical role in keeping RPE cells quiescent in vivo. The evidence for this is based on the findings that knockout of Dapl1 in mice induces RPE cell hyperproliferation, thereby leading to a multilayered epithelium, and that overexpression of DAPL1 favors exit of RPE cells from the cell cycle. In addition, knockdown of CDKN1A in DAPL1 overexpressing cells increases cell proliferation, suggesting that induction of CDKN1A is one of the downstream pathways of the anti-proliferative action of DAPL1.

The importance of keeping RPE cells quiescent in the adult (21) is evident from the abnormalities resulting from their re-entering the cell cycle in PVR. It is indeed the hyperproliferation and migration of RPE cells that lead to the formation of the pathologic membranes on the neural retina, which may eventually induce retinal detachment and visual impairment. The severity of PVR following surgical interventions is associated with enhanced RPE proliferation (18). RPE proliferation has also been reported in other retinal diseases besides PVR, such as in malignant congenital hypertrophy of the RPE, in Vogt-Koyanagi-Harada (VKH) Disease, and in RPE rips (22–24). However, at the present time, we do not know whether DAPL1 plays any functional roles in the pathogenesis of retinal diseases associated with RPE hyperproliferation in humans as no DAPL1 mutations or deficiencies have been reported. Nevertheless, the analysis of Dapl1-/- mice points to a functional role of this gene in RPE physiology as the lack of Dapl1 leads to RPE hyperproliferation and experimental retinal detachment to increased cell cycle re-entry in adult Dapl1-/- mice. These findings suggest a similar role in humans and hence may open new ways to investigate and treat these types of eye diseases.

Interestingly, in mouse models of AMD, multiple layers of RPE cells have been observed, and optical coherence tomography (OCT) has shown elevated RPE cell signal in AMD patients (25,26). Hence, it is conceivable that DAPL1 is also involved in this degenerative retinal disorder. Consistent with this hypothesis, when our research was under way, an SNP site in the DAPL1 gene has been reported to be associated with AMD, though no biological function has so far been delineated (17).

Cell proliferation is regulated by a complex network of transcription factors, signaling pathways, cell cycle-related proteins, and non-coding RNAs, many of which operating in similar ways across many different cell types. As DAPL1 is also expressed in other epithelial cells (16), it is conceivable that it not only controls cell proliferation in RPE cells but also in other cells. Besides its expression in RPE cells, Dapl1 is also expressed in the lens and cornea in wildtype though not in Dapl1-/- mice (Supplementary Material, Fig. S3). Unexpectedly, however, the absence of functional DAPL1 is not associated with a visible phenotype in these two tissues, even though each depends highly on proliferation during development. Future studies will reveal the underlying reasons for this absence of a phenotype in the lens and cornea.

In sum, the present study not only enhances our understanding of the cellular and molecular mechanisms of DAPL1-regulated RPE cell proliferation but also provides insights into the complex regulatory mechanisms of RPE function. The work clearly reveals a functional link between DAPL1 and CDKN1A that plays important roles in the maintenance of the structure and functions of RPE cells. It appears that these findings warrant a number of additional studies to establish a link between DAPL1 and the pathophysiology of RPE and retinal disorders, and they may point to therapeutic interventions in these disorders.

Materials and Methods

Ethics statement

All the animal procedures were performed according to a protocol approved by the Animal Care Committee guidelines of the Wenzhou Medical University (Permit Number: WZMCOPT-090316).

Animal

C57BL/6J mice were obtained from The Jackson Laboratory and were maintained in the specific pathogen-free facility of the Wenzhou Medical University, China. Retinal detachment experiments were carried out in 3-month-old C57B6 mice as previously described (27). CRISPR/Cas9 mediated Dapl1 knockout mice were generated in the Nanjing Biomedical Research Institute of Nanjing University, China as described (28). Newborn pups were genotyped by PCR using tail-derived genomic DNA and primers as follows: DAPL1-F: cttggg tgt gagt cctgtct and DAPL1-R: aacaggacagaagcctggct. The Dapl1 mRNA level determinations were carried out using the primers of: Dapl1-q F: gaaagctggagggatgcgaa and Dapl1-q R: tgatg tccg tgt g aactgt.

Cell culture and transfection

Human embryonic stem cells (H9 hESCs) were purchased from the WiCell Research Institute under agreement No.08-W640 and cultured in dishes that had been coated with 0.1% gelatin (millipore) and seeded with mitomycin-treated 129 mouse embryonic fibroblast feeders. H9 hESCs were maintained in hESC culture medium: DMEM/F12 (Invitrogen) with 20% knockout serum replacement (Invitrogen), 0.1% non-essential amino acid (Invitrogen), 1mM L-Glutamin (Invitrogen), 0.1mM β-meraptoethanol and 10ng/ml bFGF (Millipore). Culture medium was changed every day and cells were sub-cultured every third day. hESC-derived RPE cells were obtained under conditions as described (29) .

The human RPE cell lines ARPE-19 and D407 were purchased from ATCC and cultured in F12/DMEM medium supplemented with 10% fetal bovine serum (FBS) and antibiotics (50 μg/ml gentamicin) at 5% CO2, 37 °C. Plasmid or siRNA transfections were performed using LipoJet (SignaGen) as the standard protocol.

Plasmid construct and lentivirus infection

Lentiviral vector (TG005) was purchased from Bi'ang Biomedical Technology Co., Ltd (Shanghai, China). DAPL1 cDNA was amplified by specific primer H-DAPL1-F (atacgcgtatggcaaatgaagtgcaaga) and H-DAPL1-R (cgactagtttaacattttcgaggctgct). Plasmids suitable to express different deletions of DAPL1 were constructed using the following primer pairs:: H-DAPL1-D-F1: aagc tgg aggaatgcaagaaattg and H-DAPL1-D-R1:caattt cttgcattc ctcca g ctt; H-DAPL1-D-F2: ggaaagacataccgccattgcaaat and H-DAPL1-D-R2: atttgcaatggcggtatgtctttcc; H-DAPL1-D-F3: gacactggatgccaagctcaactataa and H-DAPL1-D-R3: ttatagttgagcttggcatccagtgtc. The primers used for construction of the DAPL1-HA plasmid were: H-DAPL1-F: atacgcgtatggcaaatgaagtgcaaga and DAPL1-HA R: cgactagtttaggcataatcgggcacgtcgtagggatacgcacattttcgaggctgct. Both DAPL1 and EGFP expression were under control of the promoter of EF1a and separated by the sequence of IRES. Lentiviruses were packed in Bi'ang biomedical technology Co.,Ltd (Shanghai, China). 40μl of lentivirus (2 × 10⁸TU/ml) were used to infect cells at 50% cell confluency.

PCR and immunostaining

All PCR primer sequences were designed using Primer 5 Software based on the sequences from human GenBank and displayed in Supplementary Material, Table S1. Total RNAs were isolated from cultured cells using Trizol reagent (Invitrogen) and were reverse transcribed into cDNA using a reverse transcriptase kit and random primers (Promega) according to the manufacturer's instructions. cDNAs were used for examining gene expression levels using RT-PCR or real-time PCR.

Lentivirus-EGFP-infected ARPE-19 cells (hereafter, EGFP-infected cells) or lentivirus-EGFP-DAPL1-infected ARPE-19 cells (hereafter, DAPL1-infected cells) were cultured for 24 hours in dishes containing 10% FBS F12/EDEM medium. The cells were fixed with 4% PFA in phosphate-buffered saline (PBS) for 25 minutes at room temperature (RT) and permeabilized with 0.4% Triton X-100 (Sigma) in PBS for 10 minutes at RT. Immunostaining was done by using a rabbit anti-Ki67 (1:200, Sigma) serum in PBS contain 10% goat serum at 37 °C. The primary antibodies were revealed with Alexa Fluor^® 594 goat anti-rabbit IgG (1:400, Invitrogen) diluted in PBS containing 2% goat serum at RT for 30 minutes. The specimens were examined and photographed with a Zeiss fluorescence microscope and photographic images were processed digitally.

siRNA knock down

SiRNA sequences were designed and synthesized by Gene Pharma (Shanghai, China) as follows: si-NC (negative control):5′ UUCUCCGAACGUGUCACGUTT; si-DAPL1: 5′GCACUUGC UUGG UAAAUUATT. si-CDKN1A: CCUCUGGCAUUAGAAUUAUTT 4 μl of 20 μM siRNA solution was added to 25 μl of transfection buffer, mixed with 3 μl LipoJet and placed at RT for about 15 minutes, and then added to one well of a 12-well plate containing cells at 60% confluency. After 2 days of treatment with siRNA, knockdown efficiency was tested by real-time PCR and the cells used for functional assays.

In situ hybridization

DAPL1 cDNA was amplified using the primer of m-DAPL1-f2: atggcaaacgaagtacaagttct and m-DAPL1-r2: ctaacattttc gaggttgctgaa. The cDNA was cloned into the PCR^® 2.1 -TOPO vector that was used for making DAPL1 specific probe. Briefly, enucleated eyes were fixed in 4% PFA overnight at 4 °C and dehydrated with 30% sucrose, then embedded in OCT compound and snap frozen immediately. 14 µm cryosections were postfixed in 4% PFA at RT for 15 minutes and premeabilized with 10 μg/ml proteinase K. The sections were hybridized to a DIG-labeled Dapl1 RNA probe at 58 °C for 12 hours, then immersed in anti-DIG antibody fused to Alkaline Phosphatase (1: 1500, Roch) overnight at 4 °C. After washing, the sections were stained with BM purple (Roche) overnight at 25 °C in the dark and postfixed in 4% PFA.

Statistical analysis

Each experiment was repeated at least three times and results were presented as mean ± standard deviation (SD). Statistical significance between experimental and control groups was assessed using Student's t-test. P < 0.05 was considered significant.

Supplementary Material

Supplementary Material is available at HMG online.

Acknowledgements

We thank Dr. Heinz Arnheiter for reagents and thoughtful comments on the manuscript and Huaicheng Chen for technical assistance.

Conflict of Interest statement. None declared.

Funding

National Natural Science Foundation of China (81570892, 81600748), National Basic Research Program (973 Program, 2009CB526502), Zhejiang Provincial NSF (Y2101213, LZ12C12001, LY13C090004, LQ13H120004), Medical Scientific Research Foundation of Zhejiang Province, China (2016KYB205, 2017 KY487), and Research Grant of Wenzhou Medical University and Wenzhou Medical University Eye Hospital.