https://orcid.org/0000-0002-0267-379X
Abstract
The zinc finger protein ZNF224 plays a dual role in cancer, operating as both tumour suppressor and oncogenic factor depending on cellular and molecular partners.
In this research we investigated the role of ZNF224 in melanoma, a highly invasive and metastatic cancer, and provided evidence for the involvement of ZNF224 in the TGF-β signalling as a mediator of the TGF-β pro-oncogenic function.
Our results showed that ZNF224, whose expression increased in melanoma cell lines after TGF-β stimulation, potentiated the activation induced by TGF-β on its target genes involved in epithelial–mesenchymal transition (EMT). Accordingly, overexpression of ZNF224 enhanced the tumourigenic properties of melanoma cells, promoting cell proliferation and invasiveness, whereas ZNF224 knockdown had the opposite effect. Moreover, ZNF224 positively modulates the expression of TGF-β itself and its type 1 and 2 receptors (TβR1 and TβR2), thus highlighting a possible mechanism by which ZNF224 could enhance the endogenous TGFβ/Smad signalling.
Our findings unveil a positive regulatory loop between TGF-β and ZNF224 to promote EMT, consequently increasing the tumour metastatic potential.
Introduction
ZNF224 is a ubiquitous transcription factor with a growing number of known activities, molecular partners and transcriptional targets. It was initially identified as a transcriptional repressor of genes involved in metabolic pathways (1,2). Later, a dual role for ZNF224 as a tumour suppressor or oncogene in human cancer was highlighted.
In chronic myelogenous leukaemia, ZNF224 plays a key pro-apoptotic and antiproliferative role, acting as a transcriptional cofactor of Wilms’ tumour protein 1, WT1 (3,4) and operating as a transcriptional repressor of the oncogene c-myc (5) and receptor tyrosine kinase Axl (6).
Conversely, an important oncogenic role for ZNF224 was reported in different cancer types. In these cases, ZNF224 contributes to the impaired growth and apoptosis resistance of cancer cells, operating through the transcriptional modulation of genes involved in proliferation and cell survival (7–9). These findings show the dual functions of ZNF224 in cancer, depending on specific sets of interactors and different cellular contexts.
Melanoma is a highly invasive and metastatic cancer that begins in melanocytes and accounts for 80% of deaths arising from skin cancer (10). The pleiotropic cytokine TGF-β plays a relevant role in melanoma progression. In normal melanocytes, TGF-β exerts a potent antiproliferative activity, whereas in advanced melanoma, it acts as a tumour promoter (11,12), favouring cancer cell proliferation and escape from immune surveillance and later invasion and metastasis, thus stimulating tumour cells to undergo the epithelial–mesenchymal transition (EMT) (13,14).
Melanoma cells produce large amounts of TGF-β isoforms, whose expression correlates with the tumour stage and metastatic progression in patients (12,15). The TGF-β pathway is constitutively activated in melanoma cells in response to autocrine TGF-β secretion (16). This activation is crucial in promoting melanoma progression through the induction of EMT (11).
In this study, we investigated the role of ZNF224 as a mediator of TGF-β pro-oncogenic functions in melanoma. A deeper knowledge of the contribution of ZNF224 as a modulator of TGF-β signalling may lead to a better understanding of the molecular mechanisms underlying tumour-promoting functions of TGF-β in melanoma and to novel treatment options.
Results
ZNF224 expression was induced by TGF-β and affected the TGF-β signalling pathway
The analysis of ZNF224 protein levels in various melanoma cell lines and non-cancerous human fibroblasts, performed by western blot, showed that malignant cells exhibited higher ZNF224 expression than normal cells (Fig. 1A). Furthermore, ZNF224 expression was induced by TGF-β in a time-dependent manner in A375 cells. TGF-β-induced Smad2 phosphorylation was analyzed to verify the activation of signalling pathways downstream of TGF-β (Fig. 1B).
ZNF224 expression was induced by TGF-β treatment and its overexpression prolonged Smad2/3 phosphorylation. (A) Western blot analysis of ZNF224 in protein extracts from melanoma cell lines (A7, A375, A2058 and SAN), human fibroblast cell line (IMR90) and human primary dermal fibroblasts. β-tubulin was used as a loading control. (B) Western blot analysis of ZNF224, p-Smad2 and total Smad2/3 levels in A375 cells treated with TGF-β for 1, 3, 6 or 9 h. β-tubulin was used as a loading control. Densitometric analysis of ZNF224 protein levels is shown. (C) Western blot analysis of phosphorylated Smad2 and total Smad2 levels in A375 cells transfected with Flag-ZNF224 plasmid or its empty vector as a control and treated with TGF-β for 1, 3, 6 or 9 h. β-tubulin was used as a loading control.
To evaluate if ZNF224 expression could affect the TGF-β/Smad pathway in melanoma cells, we examined the phosphorylation status of Smad2 protein in A375 cells transfected with a p3xFlagZNF224 expression vector. In A375 transfected with an empty control vector (Flag), the phosphorylation of Smad2 was detected 1 h after TGF-β stimulation and gradually decreased as expected, whereas the overexpression of ZNF224 was accompanied by prolonged Smad2 phosphorylation (Fig. 1C). This result suggests that high ZNF224 expression may play a role in enhancing TGF-β/Smad signalling in A375 cells, thus affecting the expression of TGF-β-regulated genes.
In support of this hypothesis, we examined mRNA and protein levels of some TGF-β target genes in A375 cells overexpressing ZNF224 and found altered expression, thus indicating that ZNF224 mimics the TGF-β effect (Fig. 2A and B). Specifically, we observed increased expression of the transcription factors Slug and Snail, regulators of TGF-β-induced EMT and the mesenchymal markers Vimentin and N-cadherin. Interestingly, ZNF224 overexpression was also accompanied by decreased expression of the epithelial marker E-cadherin and increased expression of β-catenin, whose signalling is activated in melanoma progression and promotes growth and survival of melanoma cells (17,18). Immunofluorescence staining confirmed the increased expression of N-cadherin in A375 cells overexpressing ZNF224 (Fig. 2C).
ZNF224 affected the expression of TGF-β target genes. (A) Reverse Transcription quantitative PCR (RT-qPCR) analysis of N-cadherin, β-catenin, Vimentin, Slug, Snail and E-cadherin mRNA expression levels in A375 cells transfected with the Flag-ZNF224 plasmid or its empty vector (Flag). (B) Western blot analyses of N-cadherin, β-catenin, Slug, Snail, Vimentin and E-cadherin expression levels in A375 cells transfected with the Flag-ZNF224 plasmid or its empty vector as a control. β-tubulin was used as a loading control. (C) N-cadherin immunofluorescence in A375 cells transfected with the Flag-ZNF224 construct or its empty vector (Flag). Microscopy images (Z-slices) showing N-cadherin expression in A375 cells overexpressing Flag empty vector (upper panel) and Flag-ZNF224 constructs (lower panel).
Subsequently, to evaluate the effects of ZNF224 on the TGF-β-induced expression of its target genes, A375 cells were transfected with Flag-ZNF224 or Flag as a control and then treated with TGF-β for different lengths of time. Notably, the expression of N-cadherin, β-catenin, Slug and Snail mRNA was induced by TGF-β as expected but was significantly increased further in the presence of ZNF224 overexpression (Fig. 3A).
ZNF224 enhanced induction of TGF-β responsive genes. (A) RT-qPCR analysis of N-cadherin, β-catenin, Snail and Slug mRNA expression levels in A375 cells transfected with the Flag-ZNF224 plasmid or its empty vector as a control and stimulated with TGF-β for 18 or 24 h. (B) Western blot analysis of N-cadherin, β-catenin, Slug, Snail and Vimentin protein levels in A375 cells transfected with the Flag-ZNF224 plasmid or its empty vector as a control and stimulated with TGF-β for 18 or 24 h. β-tubulin was used as a loading control. (C) RT-qPCR analysis of ZNF224 mRNA expression levels in A375 cells transfected with ZNF224 siRNA or scramble siRNA (upper panel). Western blot analysis of ZNF224 levels in A375 cells transfected with ZNF224 siRNA or scramble siRNA. α-actin was used as a loading control (lower panel). (D) RT-qPCR analysis of N-cadherin, β-catenin, Vimentin, Slug and Snail mRNA expression levels in A375 cells transfected with ZNF224 siRNA or scramble siRNA. (E) Western blot analysis of N-cadherin, β-catenin, Slug and Snail protein levels in A375 cells transfected with ZNF224 siRNA or scramble siRNA and stimulated with TGF-β for 18 or 24 h. β-tubulin was used as a loading control.
These results highlight a synergistic effect between ZNF224 and TGF-β in the regulation of TGF-β target genes. We further confirmed the existence of this cooperative effect by western blot analysis (Fig. 3B).
We also examined the effects of short interfering RNA (siRNA)-mediated knockdown of ZNF224 on the expression of these genes. Silencing of ZNF224 (Fig. 3C) was accompanied by reduced mRNA expression of N-cadherin, β-catenin, Slug, Snail and Vimentin, thus indicating that ZNF224 depleted cells fail to activate EMT-promoting factors (Fig. 3D).
Furthermore, we confirmed the effect of ZNF224 in sustaining TGF-β/Smad signalling by evaluating the TGF-β-induced expression of N-cadherin, β-catenin, Slug and Snail in A375 cells silenced for ZNF224. Figure 3E shows that silencing of ZNF224 before TGF-β treatment counteracted the TGF-induced expression of these targets compared with cells transfected with scrambled siRNA, indicating that ZNF224 is required for TGF-β-dependent regulation of its target genes.
ZNF224 positively modulated the expression of TGF-β, TGF-βR1 and TGF-βR2
TGF-β signalling is subjected to fine-tuning by a variety of regulators operating at different levels of the TGF-β pathway and both positive and negative feedback loops. Modulation of TGF-β production and TGF-β receptors activity is a critical step for signalling regulation.
In particular, to amplify its signalling, the TGF-β ligand induced a rapid translocation of its receptors to the cell surface (19). Furthermore, TGF-β also stimulated its own expression and expression of its receptors (20).
To investigate the molecular mechanism by which ZNF224 takes part in the modulation of TGF-β signalling, we measured the mRNA levels of TGF-β and type 1 and 2 TGF-β receptors in A375 cells overexpressing or silenced for ZNF224. Interestingly, we found increased expression of TGF-β, TGF-βR1 and TGF-βR2 because of ZNF224 overexpression (Fig. 4A left panel). Conversely, ZNF224 silencing resulted in reduced expression of these mRNAs (Fig. 4A right panel). Western blot analysis confirmed the induced expression of TGFBR1 and TGF-β following ZNF224 overexpression (Fig. 4B).
ZNF224 affected the expression of TGF-β, TGFβR1 and TGFβR2. (A) RT-qPCR analysis of TGFβ, TGFβR1 and TGFβR2 mRNA levels in A375 cells overexpressing FlagZNF224 compared with cells transfected with the empty vector (Flag) (left panel) and in A375 cells transfected with ZNF224 siRNA or scramble siRNA (right panel). (B) Western blot analysis of TGFβR1 and TGFβ protein levels in A375 cells transfected with the FlagZNF224 plasmid or empty vector (−). β-tubulin was used as a loading control. Densitometric analysis of TGFβR1 and TGFβ protein levels is shown (right panel). (C) ZNF224 binds in vivo TGFβ, TGFβR1 and TGFβR2 genes. X-ChIp assay was performed in A375 cells overexpressing Flag-ZNF224 with the Flag antibody or IgG as a control. The immunoprecipitated chromatin was analyzed by qPCR using specific primers spanning the putative ZNF224 binding sites shown in the upper panel. An UNR was used as a negative control. (D) RT-qPCR analysis of TGF-β, TGFβR1 and TGFβR1 mRNA expression levels in A375 cells transfected with the Flag-ZNF224 plasmid or its empty vector as a control and stimulated with TGF-β for 18 or 24 h.
Subsequently, by in silico analysis, we found ZNF224 binding motifs (6) in the promoter region of TGF-β and in the first intron of TGF-βR1 and TGF-βR2 genes. A chromatin immunoprecipitation assay (X-ChIP) was performed to verify ZNF224 occupancy on these genomic regions. The crosslinked chromatins of A375 cells transfected with the FlagZNF224 plasmid were immunoprecipitated with a Flag antibody. Quantitative PCR (qPCR) analysis confirmed the binding of ZNF224 to the TGF-β, TGFβR1 and TGF-βR2 DNA regions containing its consensus sequences (Fig. 4C).
These results showed that ZNF224 sustains endogenous TGFβ/Smad signalling by upregulating the expression of TGF-βR1, TGF-βR2 and TGF-β.
Accordingly, as shown in Figure 4D, ZNF224 overexpression further increased the expression of TGF-β and its receptors compared with the induction observed in the presence of TGF-β treatment alone. These data indicate that ZNF224 potentiated TGF-β signalling in melanoma cells through the simultaneous activation of the cytokine and its receptors, which are essential for TGF-induced effects (19).
ZNF224 promoted anchorage-independent growth, migration and invasion of melanoma cells
To address the functional role of ZNF224 in melanoma cell growth, we first assessed the clonogenic potential of A375 and A2058 cells in condition of overexpression and silencing of ZNF224 (Fig. 5). The number of colonies formed was significantly increased in A375 cells following ZNF224 overexpression compared with the control cells. Conversely, fewer colonies were observed in A375 cells silenced for ZNF224 by short hairpin RNA (shRNA) transfection (shC3 and shE7) compared with control cells [short hairpin green fluorescent protein (shGFP)] (Fig. 5A and B). Similar effects were found in A2058 cells (Fig. 5D and E), thus demonstrating that ZNF224 can increase the proliferation rate of melanoma cells.
Effects of ZNF224 overexpression and silencing on A375 and A2058 cell growth. (A) Colony formation assay in A375 cells overexpressing (Flag-ZNF224) or silenced (shC3, shE7) for ZNF224 and their respective control cells (Flag and shGFP). (B) Plating efficiency and A570 after crystal violet elution were evaluated. Flag and shGFP control cells were arbitrarily set at 1. The histograms represent the mean of two independent experiments performed in triplicate. (C) Western blot analysis was used to verify Flag-ZNF224 overexpression and ZNF224 silencing in A375 cells. β-tubulin was used as a loading control. (D) Colony formation assay in A2058 cells overexpressing (Flag-ZNF224) or silenced (shC3, shE7) for ZNF224 and their respective control cells (Flag and shGFP). (E) Plating efficiency and A570 after crystal violet elution were measured. Flag and shGFP control cells were arbitrarily set at 1. (F) Western blot analysis was used to verify Flag-ZNF224 overexpression and ZNF224 silencing in A2058 cells. β-tubulin was used as a loading control.
To evaluate the ability of ZNF224 to promote the anchorage-independent growth of melanoma cells, we performed a soft agar colony formation assay in A375 and A2058 cells overexpressing ZNF224. There was a remarkable increase in the colony-forming ability of both cell lines transfected with Flag ZNF224 compared with cells transfected with the empty vector (Flag) (Fig. 6).
ZNF224 overexpression stimulated anchorage-independent growth of A375 and A2058 cells. Soft agar colony formation assay in A375 (A) and A2058 (B) cells overexpressing ZNF224 (FlagZNF224) compared with control cells (Flag). Twenty-four hours post-transfection, the cells were cultured in soft agar medium for 2 weeks. Then, the colonies were counted, and images of A375 and A2058 colonies were acquired using a light microscope. Scale bar 250 μm. The experiment was performed once in triplicate.
Subsequently, we explored the potential impact of ZNF224 on A375 cells migration and invasion using transwell assays. As shown in Figure 7, A375 cells transfected with ZNF224 exhibited a significantly increased migratory and invasive potential compared with cells transfected with the empty vector (Flag) (Fig. 7A). Conversely, the downregulation of ZNF224 induced by siRNA transfection significantly suppressed cell migration and invasion compared with control cells (Fig. 7B). The enhanced migratory ability of cells overexpressing ZNF224 was also demonstrated in A2058 cells through a wound healing assay (Fig. 7C). Overall, these results support the idea that in melanoma cancer cells, ZNF224 promotes the acquisition of anchorage-independent cell growth and migration and invasion abilities, which are critical steps in cancer progression and metastasis.
ZNF224 affected the migration and invasion of melanoma cells. (A) Representative images of the migration and invasion assay performed in A375 cells overexpressing ZNF224 (FlagZNF224) and control cells (Flag). (B) Representative images of the migration and invasion assay performed in A375 cells silenced for ZNF224 (siRNAZNF224) and control cells (scramble). The histograms of absorbance measured at 570 nm of eluted crystal violet were obtained from the mean of two independent experiments performed in triplicate. (C) A2058 cells overexpressing Flag-ZNF224 and control cells (Flag) were subjected to an in vitro scratch assay and the images were captured at 0, 24 and 48 h after the injury using a phase-contrast microscope. The histogram indicates the percentage of wound closure in the area. (D) The expression of exogenous 3xFlag-ZNF224 protein in transfected cells was verified by western blot analysis. β-tubulin was used as a loading control.
Discussion
Melanoma progression and metastasis are complex processes, and the mechanisms that mediate the switch from primary to metastatic melanoma remain poorly understood (21).
TGF-β exerts important and pleiotropic effects in melanoma progression. It acts in autocrine and paracrine manners to control and shape tumour growth, invasion, escape from immune surveillance and metastasis (11,22).
Positive and negative feedback regulatory loops modulate TGF-β signalling (23,24). TGF-β positively regulates its own expression and induces the upregulation of TGF-β receptors (19,20), thus amplifying signalling and Smad-mediated gene responses. TGF-β also induces the expression of some transcription factors that may cooperate with Smad in the transcriptional regulation of TGF-β target genes (24–26).
Increasing evidence indicates a role for the zinc finger protein ZNF224 in carcinogenesis, demonstrating that this transcription factor behaves as a tumour suppressor or oncogene in different types of cancer (27).
Here, we provided compelling evidence that ZNF224 is a positive modulator of the TGF-β pathway in melanoma to mediate the pro-oncogenic function of the cytokine.
Moreover, we found that TGF-β induces ZNF224 expression in melanoma cell lines and that ZNF224 overexpression is accompanied by prolonged Smad2 phosphorylation. Furthermore, overexpression and silencing experiments showed that ZNF224 was able to enhance the effects of TGF-β on some TGF-β-inducible genes, such as the EMT-related transcription factors Slug and Snail, which are associated with cell invasion and development of metastases and some EMT markers.
Although the molecular mechanisms of the transcriptional regulatory functions of ZNF224 within the TGF-β pathway were not extensively investigated here, it could be hypothesized that the DNA-binding activity of ZNF224 may facilitate the recruitment of Smad transcriptional complexes to target promoter sites, favouring high-affinity and selective interactions with cognate DNA. Numerous DNA-binding transcription factors play a crucial role in Smad-controlled target gene selection (24). However, considering that TGF-β can also activate intracellular pathways other than Smad-mediated canonical signalling (26), we cannot rule out that ZNF224 could also modulate the transcription of some TGF-β target genes in a Smad-independent manner. Moreover, ZNF224 may promote TGF-β signalling, activating or repressing other transcriptional regulators of this pathway.
Here, we identified one of the possible mechanisms by which ZNF224 could exert a regulatory role in the TGF-β pathway. By chromatin immunoprecipitation experiments and the evaluation of mRNAs expression changes following ZNF224 overexpression or silencing, we demonstrated that TGF-βR1, TGF-βR2 and TGF-β itself are target genes of ZNF224 transcriptional activation. The augmented expression of TGF-β and its receptors and prolonged Smad2 phosphorylation induced by ZNF224 contributes to the constitutive activation of the pathway, thus resulting in enhanced induction of some TGF-β-responsive genes, associated with EMT and subsequent malignant progression.
Furthermore, our data highlight the existence of a positive regulatory loop between TGF-β and ZNF224 in melanoma. Indeed, we also showed that ZNF224 expression was, in turn, induced by TGF-β, thus further contributing to the deregulated activation of this pathway.
In vitro functional assays, performed by modulating ZNF224 expression, strongly indicate that its high expression in malignant and metastatic melanoma cell lines contributes to the aggressive growth and spread of human malignant melanoma.
The medium/high ZNF224 expression in melanoma, reported in the Human Protein Atlas, strengthen our findings on the pro-oncogenic potential of ZNF224 in this malignancy.
Altogether, our data show that ZNF224 is required for the proliferation, migration and invasiveness of melanoma cells. Its overexpression could represent a critical event in the multi-step process that leads to tumour cell invasion and metastasis. Furthermore, ZNF224 could act by promoting the acquisition of a mesenchymal phenotype and the metastatic behaviour of melanoma by modulating different EMT cancer-related proteins.
Great efforts are being made to develop drugs targeting TGF-β in melanoma (28–30). However, these approaches have proven challenging for rapid application in clinical practice because of the numerous physiological functions in which this signalling pathway is involved (31,32).
The identification of ZNF224 as one of the modulators of TGF-β signalling will provide a deeper knowledge of the molecular events involving this pathway in melanoma progression and invasion. Further experiments will be performed to characterize the molecular network between ZNF224 and TGF-β, thus contributing to find new strategies for targeting TGF-β signalling and, consequently, new molecular therapeutic targets to treat this deadly disease.
Materials and Methods
Cell cultures and treatments
A375 and A2058 melanoma cell lines were provided by the Cell Culture Facility of CEINGE (Naples, Italy). The melanoma cell line SAN was established from a patient’s biopsy (33).
Cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) (Corning, NY) supplemented with 10 or 15% fetal bovine serum (FBS) (Corning) at 37°C in 5% CO2.
For TGF-β treatments, A375 cells were plated at a density of 1.5 × 105 cells/well in a 12-well plate. The next day, cells were treated with TGF-β1 (10 ng/ml) (Sigma-Aldrich, St. Louis, MO).
Transient transfection
For ZNF224 overexpression, A375 and A2058 cells were transfected with the p3X-Flag ZNF224 expression plasmid or p3X-Flag empty vector as a control. Transient transfection experiments were performed using Metafectene (Biontex, Munchen, Germany) according to the manufacturer’s instructions.
For ZNF224 knockdown, A375 cells were transfected with shRNA plasmids SH2351C3 or SH2352E7 and with the shGFP RNA plasmid as a control (Open Biosystems, AL, USA). Alternatively, cells were transfected with Dharmacon™ ON-TARGETplus HumanZNF224 siRNA -SMARTpool or a non-targeting pool as a control at 50 nM final concentrations for 96 h using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA) For the TGF-β treatment, 24 h after transfection the cells were seeded in multiwell plates. The next day, the cells were treated with TGF-β for 0–9 h or 18–24 h.
Cell lysates and western blot assays
Total protein extracts were obtained by cell lysis in radio-immunoprecipitation assay (RIPA) Pierce buffer (Thermo Fisher Scientific, Waltham, MA) or as described previously (34). Total protein extracts were resolved by sodium dodecyl sulphate (SDS) polyacrylamide gel electrophoresis and then transferred to a nitrocellulose membrane with a RTA Transfer Kit (Bio-Rad) and Trans-Blot turbo (Bio-Rad), according to the manufacturer’s instructions. The membranes were incubated with the following antibodies: anti-ZNF224 (rabbit polyclonal, T3) (4) diluted 1:300 in Super-Block Blocking Buffer (Thermo Fisher Scientific, Waltham, MA), anti-p-Smad2, anti-Smad2/3, anti-Slug, anti-Snail, anti-Vimentin, anti-β-Catenin and anti-N-Cadherin (Cell Signalling Technology, Danvers, MA) anti-β-Tubulin (Millipore, Burlington, MA), anti-α-actin (Sigma-Aldrich), anti-Flag (Sigma-Aldrich), anti-TβRI (Abcam, Cambridge, UK) diluted 1:1000 in 3% phosphate-buffered saline (PBS)-milk, anti-TGF-β1 (V) and anti-Smad2 (Santa Cruz Biotechnology, Inc., Dallas, TX) diluted 1:300 in 3% PBS-milk. The secondary antibodies were goat-anti-mouse IgG (H + L)-horseradish peroxidase (HRP) or goat-anti-rabbit IgG (H + L)-HRP conjugated (Bio-Rad, Bio-Rad, Hercules, CA) antibodies (1:5000) in 3% PBS-milk. Signals were detected with ImmunoCruz Western Blotting Luminol Reagent (Santa Cruz Biotechnology) and Clarity Western Blotting Luminol Reagent (Bio-Rad) by enhanced chemiluminescence. The band intensities were quantified by densitometry using ImageJ software.
RNA extraction, reverse transcription and real-time q-PCR
Total RNA was extracted using the Quick-RNA MiniPrep (ZymoSearch, Irvine, CA), according to the manufacturer’s protocol. Reverse-transcription and quantitative real-time PCR were performed as previously described (7,35). The specific primers used were: N-cadherin (Forward: 5′-TCCAGACCCCAATTCAATTAATATTAC-3′; Reverse: 5′-AAAATCACCATTAAGCCGAGTGA-3′); β-catenin (Forward: 5′-TGGATGGGCTGCCTCCAGGTGAC-3′: Reverse: 5′-ACCAGCCCACCCCTCGAGCCC-3′); E-cadherin (Forward: 5′-GCCTCCTGAAAAGAGAGTGGAAG-3′; Reverse: 5′-TGGCAGTGTCTCTCCAAATCCG-3′); Vimentin (Forward 5′-TACAGGAAGCTGGAAGG-3′ Reverse 5′-ACCAGAGGGAGTGAATCCAG-3′); TGFβR1 (Forward: 5′-TCCTGGGATTTATAGCAGCAGAC-3′; Reverse: 5′-CGTGGACAGAGCAAGTTTTATCA-3′); TGFβR2 (Forward: 5′- TCCTTCAAGCAGACCGATGT-3′; Reverse: 5’-GAACCAAATGGAGGCTCATAATC-3′); HPRT and ZNF224 (7). Snail, slug and TGF-β1 were validated primers from QuantiTect (Qiagen, Valencia, CA).
The relative quantification in gene expression was determined using the ΔΔCT method.
Immunofluorescence assay
A375 cells were plated on coverslips and transfected with the p3X-Flag ZNF224 expression plasmid or p3X-Flag empty vector. Forty-eight hours post-transfection, the cells were washed with 1× PBS and fixed with 4% paraformaldehyde for 10 min at room temperature. The cells were permeabilized with 0.1% Triton X-100 (AppliChem, Ottoweg, Germany) for 5 min and incubated with the blocking solution for 30 min at room temperature. For antigen detection, the cells were incubated with the primary antibody N-Cadherin (D4R1H) XP® Rabbit mAb #13116 (1:100, Cell Signalling Technology) overnight at 4°C. The following day, the coverslips were washed with 1× PBS and incubated with the secondary antibody IgG (H + L) Highly Cross-Adsorbed Donkey anti-Rabbit, Alexa Fluor™ 488 (Invitrogen, USA) for 1 h at room temperature. The nuclei were stained with DAPI, Dihydrochloride (Calbiochem, San Diego, USA) for 5 min at room temperature. A Leica Thunder Imaging System (Leica Microsystems Wetzlar, Germany) equipped with a LEICA DFC9000 GTC camera, lumencor fluorescence LED light source and 63× oil immersion objective was used to acquire Z-slice images. Small volume computational clearing was used to remove the background signal derived from out-of-focus blur.
Chromatin immunoprecipitation assay
Chromatin immunoprecipitation was performed as previously described (7,36). Briefly, 48 h post-transfection with FlagZNF224 plasmid, A375 cells were cross-linked with HCHO (1%) for 10 min at room temperature, lysed and fixed chromatin was sheared using an ultrasonic liquid processor. Chromatin was immunoprecipitated overnight on the wheel at 4° with 1 μg anti-Flag antibody (Sigma) or 1 μg IgG (Sigma). On the following day, the immunocomplexes were recovered by protein A/G plus Agarose (Santa Cruz). The isolated complexes were washed twice in RIPA buffer [0.1% SDS, 1 mM EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1% Na-Deoxycholate, 10 mM Tris–HCl (pH 8) and 140 mM NaCl], four times in 10 mM HEPES (pH 8), 0.1% Igepal, 5 mM EDTA and 250 mM NaCl solution, and once in 10 mM Tris (pH 8) and 1 mM EDTA. Crosslinking was reversed at 65°C overnight in 10 mM Tris–HCl (pH 8), 1 mM EDTA and 1% SDS. Subsequently, DNA was recovered by phenol/chloroform extraction and ethanol precipitation. The analysis of immunoprecipitated DNA and input controls was performed in triplicate by quantitative real-time PCR using a Master Mix SYBRGreen (Bio-Rad). The Ct values were calculated by using appropriate Biorad software. Relative enrichment was calculated as fold enrichment, obtained by subtracting the Ct value for the IgG antibody background from the Ct value for the antibody of interest (Flag): 2^-(Ct IP-Ct IgG). The negative sample was given a value of 1. Primer sequences were as follows: TGFβ1 (Forward: GAACTGTGTTCTGAGGACATGG; Reverse: CCTCTCTGTGTTATCCTCCTCC); TGFβR1 (Forward: GCTTTGCTAAAAGCTGGAGGAGGAT; Reverse: TAAATGTCTGGCTCTGCCTTTG); TGFβR2 (Forward: AAGGGATAGCTCTGTGTGTGTG; Reverse: AAGAGAGACATCATCCTGAGCC) and unrelated region (UNR) (Forward: CTGACAAGGTGATGGGCTTATG; Reverse: AAGGATTCGGTGATGGCTCTA).
Colony formation assay
A375 and A2058 cells overexpressing or silenced for ZN224 and their respective control cells were detached 24 h after transfection and seeded at a density of 5 × 102 in a six-well plate in triplicate and incubated for 15 days. The culture medium was replaced every 2 days. After fixing with 25% methanol and staining with 0.1% crystal violet, the colonies were counted. The average colony count for the three dishes was used to calculate the plating efficiency (plating efficiency = number of colonies counted/number of cells plated). After elution of crystal violet with 1% SDS, absorbance at a 570 nm wavelength was measured using a Microplate Reader-BioTek Synergy H1 (BioTek US, Winooski, VT).
Migration and invasion assays
The migration of A375 cells was evaluated using Transwell Supports for 24-well plates with an 8-μm pore membrane size (Falcon, Corning Inc.). For the invasion assay, the upper side of the Transwell Supports (Corning) was precoated with 100 μl of Matrigel Basement Membrane Matrix (Corning) diluted 1:5 in DMEM-free medium and allowed to dry out at 37°C for at least 1 h. In the lower panel, 600 μl of DMEM supplemented with 15% FBS was added. A375 cells overexpressing or silenced for ZN224 were seeded on the upper side of the membrane at a density of 2 × 104 cells/100 μl of DMEM supplemented with FBS 1%. After 20 h of incubation at 37°C, cells on the upper surface of the membrane were removed using a cotton wool swab and migrated or invasive cells on the lower side of the membrane were fixed with 25% methanol and stained with 0.1% crystal violet. The images of stained cells were captured under a light microscope (Leica DFC365 FX, Leica Microsystem, Wetzlar, Germany) at a magnification of ×5 to ×10 in five random fields in each well. The percentage of migratory and invasive cells was evaluated by eluting fixed cells with 1% SDS and reading the absorbance at λ570 nm.
Soft-agar assay
A375 and A2058 cells transiently transfected with 3xFlag-ZNF224 or the 3xFlag empty vector were used to evaluate anchorage-independent growth. Dishes (60 mm) were precoated with a solution containing DMEM 2× (Sigma, St Louis, MO), Tryptose Phosphate Broth Buffer (Difco, BD, Franklin Lakes, NJ) and 1.25% Noble Agar (Difco, BD, Franklin Lakes, NJ) and left to dry for 10 min. Next, 104 cells were resuspended in 2 ml AGAR DMEM and plated on top of the dried Noble Agar layer in the 60-mm dishes. Cells were grown for 2 weeks in the incubator at 37°C in 5% CO₂, and fresh medium was added once a week. Cell clumps were observed, and their pictures were captured under a light microscope (Leica DFC365 FX, Leica Microsystem, Germany) at a magnification of ×5 in five random fields in each well. Cell colonies were counted using ImageJ software (Version 1.49).
Wound healing assay
A2058 cells overexpressing ZNF224 and control cells (Flag) were seeded in 60-mm dishes at a density of 4 × 105. After 24 h, a yellow pipette tip was used to make a scratch. Cells were rinsed three times with 1× PBS and once with growth medium to remove the detached cells. Then, 3 ml of fresh DMEM were added. Scratch closure was monitored, and images were captured at 0, 24 and 48 h using a light microscope (Leica DFC365 FX, Leica Microsystem, Germany). Wound closure was measured by calculating the density of the pixels in the area where the cut was made and expressed as a percentage of wound closure in the area. The percentage of wound closure was calculated by Image J software (Version 1.49).
Statistical analyses
Data were presented as the mean ± standard error of the mean from three or more independent experiments unless indicated otherwise. Statistical analysis was performed with Prism 7™ (GraphPad Software Inc., La Jolla, CA). P ≤ 0.05 was considered a significant difference (*P ≤ 0.05; **P ≤ 0.01).
Acknowledgments
We thank the Centre of Interdepartmental Services (CIS), ‘Magna Graecia’ University of Catanzaro, Italy for supporting part of this research.Conflict of Interest statement. None declared.
Funding
Regione Campania ‘SATIN’ grant 2018–2020.
