Abstract

BACKGROUND: Human embryonic stem (hES) cells are pluripotent cells usually derived from the inner cell mass (ICM) of blastocysts. Because of their ability to differentiate into all three embryonic germ layers, hES cells represent an important material for studying developmental biology and cell replacement therapy. hES cell lines derived from blastocysts diagnosed as carrying a genetic disorder after PGD represent in vitro disease models. METHODS: ICMs isolated by immunosurgery from human blastocysts donated for research after IVF cycles and after PGD were plated in serum-free medium (except VUB01) on mouse feeder layers. RESULTS: Five hES cell lines were isolated, two from IVF embryos and three from PGD embryos. All lines behave similarly in culture and present a normal karyotype. The lines express all the markers considered characteristic of undifferentiated hES cells and were proven to be pluripotent both in vitro and in vivo (ongoing for VUB05_HD). CONCLUSIONS: We report here on the derivation of two hES cell lines presumed to be genetically normal (VUB01 and VUB02) and three hES cell lines carrying mutations for myotonic dystrophy type 1 (VUB03_DM1), cystic fibrosis (VUB04_CF) and Huntington disease (VUB05_HD).

Introduction

Human embryonic stem (hES) cells are usually derived from the inner cell mass (ICM) of preimplantation embryos (Thomson et al., 1998). Once removed from the blastocyst, the ICM can be cultured into ES cells that have the ability to remain undifferentiated and proliferate indefinitely in vitro while maintaining the potential to differentiate into all three embryonic germ layers (Thomson et al., 1998; Reubinoff et al., 2000) and trophoblast (Gerami-Naini et al., 2004). Because of these characteristics, they are of significant interest as a renewable source of cell populations for different applications.

An important field of research on hES cells focuses on the study of the mechanisms of cell differentiation and developmental biology. Another major research area on hES cells concentrates on their potentially promising use in cell replacement therapies for the treatment of degenerative human diseases. Finally, because animal models are not fully representative and experiments on humans are restricted, derivation of hES cell lines known to be carriers of a monogenic disease can offer the opportunity of an in vitro model of the disease. Those affected hES cell lines would be a readily accessible source for pharmacogenetic tests or in vitro gene therapy experiments.

PGD is a procedure that allows for the detection of a genetic defect at the level of an embryo fertilized in vitro and prior to transfer in utero (Sermon et al., 2004). PGD is performed by fluorescent in situ hybridization for the diagnosis of aneuploidies or X-linked pathologies and by PCR for the diagnosis of single gene disorders. PGD embryos diagnosed as affected by monogenic diseases such as myotonic dystrophy type 1 (DM1), cystic fibrosis (CF) and Huntington disease (HD) have been used in our centre for derivation of new hES cell lines.

DM1 (OMIM 160900) is an autosomal dominant disorder caused by a mutation in the dystrophia myotonica protein kinase gene (DMPK) with a prevalence of 9.3 cases per 100,000 (Siciliano et al., 2001). The symptoms are characterized by myotonia, muscular dystrophy, cataract, cardiac conductance disturbance and cognitive impairment. The molecular basis of the disorder is an unstable trinucleotide CTG repeat in the 3′-untranslated region of the DMPK gene. The severity of the disease and the age of onset vary with the number of repeats: DM1 is commonly an adult onset disease, but a very high number of repeats leads to the congenital form, which is usually transmitted through the mother.

CF (OMIM 219700) is the most common autosomal recessive disease in Caucasians, with a carrier frequency of 5%, affecting 1 out of 2000 newborns (Davis, 2001). The early childhood onset of clinical features such as chronic bronchopulmonary infections, pancreatic insufficiency and disturbed sweat gland function is caused by mutations in the coding region of the cystic fibrosis transmembrane conductance regulator gene (CFTR). The majority of male CF patients are infertile due to a congenital bilateral absence of the vas deferens (CBAVD). In patients presenting CBAVD only, CFTR mutations are found in 80% of the patients. The intron 8 splice variant 5T (5T variant) is an example of a CFTR mutation restricted to CBAVD (Lissens et al., 1996).

HD (OMIM 143100) is an autosomal dominant neurodegenerative disease associated with an increase in the length of a triplet CAG expansion present in the huntingtin gene. HD has a prevalence in the Caucasian population of 5 per 100,000 (Evers-Kiebooms et al., 2002). The classic clinical features, typically of adult onset, are progressive motor impairment, cognitive decline, chorea and seizures. The course of the disease is fatal usually 15–20 years after onset.

In our centre, since July 2003, IVF embryos without any known genetic defect or PGD embryos identified as affected were donated for research and used for the derivation of hES cell lines. Here, we describe the establishment of five new hES cell lines: two from IVF embryos (VUB01 and VUB02), one from a PGD embryo identified as affected by DM1 (VUB03_DM1), one from a PGD embryo diagnosed as compound heterozygous for the F508del mutation and the 5T variant (VUB04_CF) and finally one from a PGD embryo identified as affected by HD (VUB05_HD).

Materials and methods

Source of embryos

Human embryos at blastocyst stage that had been donated for research after IVF and PGD cycles were used for this study with the informed consent of the couples and the approval of the ethical committee at the University Hospital of the Vrije Universiteit Brussel (Brussels Free University).

Frozen and spare fresh embryos whose morphology was considered insufficient for transfer or freezing after IVF or ICSI cycles were used for the derivation of hES cell lines. Embryos diagnosed after PGD cycles as carrying genetic mutations of DM1, CF or HD were used for the derivation of genetically affected hES cell lines.

PGD procedure

Mature oocytes were fertilized using ICSI (Liebaers et al., 1998; Devroey and Van Steirteghem, 2004), and the zygotes were cultured in sequential medium G3 (Vitrolife, Faktorvägen, Sweden). Good quality embryos containing at least six cells on the morning of day 3 were biopsied (De Vos and Van Steirteghem, 2001).

The biopsied blastomeres were analysed by simplex PCR as described in Sermon et al. (2001) for the DM1 and HD mutations, while diagnosis of the CF mutation was performed with a duplex PCR, amplifying the mutation F508del and the intragenic polymorphic marker IVS17BTA (Goossens et al., 2004).

Derivation of hES cell lines

Human blastocysts were subjected to immunosurgery as previously described by Reubinoff et al. (2000). Isolated ICMs were transferred to 0.1% gelatin-coated (Sigma-Aldrich, Schnelldorf, Germany) culture dishes (Nalgene NUNC; Rochester, MN) containing inactivated mouse embryonic fibroblast (MEF) feeder layers, and cultured further at 37°C in 10% CO2.

VUB01 was derived on γ-inactivated MEFs isolated from 129/Sv mice. The derivation and culture medium (hES medium) consisted of 80% Knockout Dulbecco’s modified Eagle’s medium (KO DMEM; Invitrogen, Carlsbad, CA) supplemented with 20% fetal bovine serum (FBS; Hyclone, Logan, UT), 2 mmol/l L-glutamine (Invitrogen), 1% non-essential amino acids (Invitrogen), 0.1 mmol/l β-mercaptoethanol (Sigma-Aldrich), 103 U/ml human recombinant leukaemia inhibitory factor (hrLIF; Sigma-Aldrich) and 4 ng/ml human recombinant basic fibroblast growth factor (hrbFGF; Invitrogen). After a few passages, the culture conditions were changed by omitting hrLIF and replacing FBS with Knockout-Serum Replacement (KO SR; Invitrogen). From passage 20 on, mitomycin C- (Sigma-Aldrich) inactivated MEFs isolated from CF1 mice were used for the maintenance of VUB01.

For the derivation and culture of the next lines (VUB02, VUB03_DM1, VUB04_CF and VUB05_HD), CF1 MEFs and the hES culture medium with KO SR and without hrLIF were used.

Cryopreservation of the cells was successfully performed using a modified version of the ‘vitrification in open pulled straws’ protocol (Reubinoff et al., 2001). In brief, after collagenase type IV (Invitrogen) treatment, cells were collected and equilibrated for 1 min in HM medium which consists of KO DMEM supplemented with 20% KO SR and 10 mol/l HEPES (Invitrogen). After an incubation of 1 min in solution I [HM supplemented with 10% dimethylsulfoxide (DMSO) and 10% ethylene glycol], cells were incubated for 25 s in solution II (HM supplemented with 20% DMSO, 20% ethylene glycol and 0.5 mol/l sucrose) and transferred into cryovials, which were immediately submerged in liquid nitrogen.

The thawing was performed by sequential incubation of the colonies in HM containing 0.2 and 0.1 mol/l sucrose, followed by an incubation step in HM. Surviving colonies were plated on new feeder layers in hES cell medium.

Characterization of the hES cell lines

Karyotyping was performed using the G-banding method (Gosden et al., 1992), and 20 metaphases were analysed for each line.

Alkaline phosphatase activity was detected using the Vector Blue substrate kit (Vector Laboratories, Burlingame, CA).

The presence of cell surface markers was tested by immunocytochemistry on colonies cultured on feeder layers and fixed with 4% neutral phosphate-buffered formalin. The antibodies used were mouse primary antibodies for SSEA-1 [IgM, Developmental Studies Hybridoma Bank (DSHB), IA; 1:25 dilution], SSEA-3 (IgM, DSHB; 1:20 dilution), SSEA-4 (IgG3, DSHB; 1:20 dilution), TRA-1–60 (IgM, Chemicon, Temecula, CA; 1:100 dilution) and TRA-1–81 (IgM, Chemicon; 1:100 dilution). For the detection of the first antibodies, the fluorescein-conjugated F(ab¢)2 fragment of goat anti-mouse IgG and IgM (DakoCytomation, Glostrup, Denmark; 1:150 dilution) was used.

Gene expression studies were carried out on predominantly undifferentiated stem cells by reverse transcriptase–PCR (RT–PCR). RNA was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and was reverse transcribed using the First-strand cDNA Synthesis Kit (GE Healthcare, Buckinghamshare, UK) with the NotI-d(T)18 primer. PCR was performed using 2 µl of cDNA in a 25 µl total PCR volume containing 10 pmol of primers, 0.2 mmol dNTP and 2.5 U of Taq polymerase (GE Healthcare). For DNTM3B, PCR was performed using the Expand High Fidelity PCR System (Roche Diagnostics GmbH, Mannheim, Germany). The primer sequences and conditions of the PCRs (35 cycles) are described in Table I. PCR products were analysed on a 2% agarose gel.

Table I.

Primer sequences and conditions for the PCRs

Gene Forward primer Reverse primer Annealing temperature (°C) Product size (bp) 
NANOG CAGAAGGCCTCAGCACCTAC CTGTTCCAGGCCTGATTGTT 55 216 
OCT-4 GACAACAATGAGAACCTTCAGGAGA TTCTGGCGCCGGTTACAGAACCA 55 218 
HPRT GCCGGCTCCGTTATGGCG AGCCCCCCTTGAGCACACAGA 55 226 
REX-1 GCGTACGCAAATTAAAGTCCAGA CAGCATCCTAAACAGCTCGCAGAAT 58 306 
SOX-2 CCCCCGGCGGCAATAGCA TCGGCGCCGGGGAGATACAT 58 448 
LIN 28 AGTAAGCTGCACATGGAAGG ATTGTGGCTCAATTCTGTGC 58 420 
NPM1 TGGTGCAAAGGATGAGTTGC GTCATCATCTTCATCAGCAGC 58 343 
GDF3 AGACTTATGCTACGTAAAGGAGCT CTTTGATGGCAGACAGGTTAAAGT 58 150 
DNMT3B TTGTAGCCATGAAGGTTGGC TGTGTAGTGCACAGGAAAGC 59 351 
Gene Forward primer Reverse primer Annealing temperature (°C) Product size (bp) 
NANOG CAGAAGGCCTCAGCACCTAC CTGTTCCAGGCCTGATTGTT 55 216 
OCT-4 GACAACAATGAGAACCTTCAGGAGA TTCTGGCGCCGGTTACAGAACCA 55 218 
HPRT GCCGGCTCCGTTATGGCG AGCCCCCCTTGAGCACACAGA 55 226 
REX-1 GCGTACGCAAATTAAAGTCCAGA CAGCATCCTAAACAGCTCGCAGAAT 58 306 
SOX-2 CCCCCGGCGGCAATAGCA TCGGCGCCGGGGAGATACAT 58 448 
LIN 28 AGTAAGCTGCACATGGAAGG ATTGTGGCTCAATTCTGTGC 58 420 
NPM1 TGGTGCAAAGGATGAGTTGC GTCATCATCTTCATCAGCAGC 58 343 
GDF3 AGACTTATGCTACGTAAAGGAGCT CTTTGATGGCAGACAGGTTAAAGT 58 150 
DNMT3B TTGTAGCCATGAAGGTTGGC TGTGTAGTGCACAGGAAAGC 59 351 

The pluripotency of the hES cell lines was tested both in vitro and in vivo. For the in vitro differentiation study, embryoid bodies (EBs) generated as previously described (Itskovitz-Eldor et al., 2000) were cultured in hES cell medium containing FBS (Hyclone) and lacking hrbFGF (Invitrogen). At day 22, EBs were fixed in 4% neutral phosphate-buffered formalin, and embedded in paraffin and processed for both routine histology and immunohistological examination. Immunohistochemistry was performed with markers for endoderm (α-fetoprotein; IgG2a, BioGenex Laboratories, San Ramon, CA; 1:5 dilution), mesoderm (myosin heavy chain; IgG, Novocastra, Newcastle upon Tyne, UK; 1:100 dilution) and ectoderm (β-tubulin III; IgG, Chemicon; 1:100 dilution). In the next step, a biotin-labelled anti-mouse secondary antibody (IgG, GE Healtcare; 1:300 dilution) was used, followed by a peroxidase-labelled streptavidin anti-biotin complex (DakoCytomation).

For in vivo differentiation studies, 1–2 × 107 cells were injected into the rear leg muscle of 4- to 6-week-old male SCID-beige mice. The resulting teratomas were excised, fixed in 4% neutral phosphate-buffered formalin, and embedded in paraffin. For immunohistochemistry, primary mouse antibodies cytokeratin 18 (IgG1, BioGenex Laboratories; 1:100 dilution), actin (IgG1, Enzo Diagnostics, Inc., Farmingdale, NY; 1:5 dilution) and CK14 (IgG3, BioGenex Laboratories; 1:100 dilution) or neurofilament 200k (NF200, IgM, ICN Cappel, Aurora, CO; 1:20 dilution) were used for the detection of endoderm, mesoderm and ectoderm, respectively. Biotin-labelled anti-mouse secondary antibody and the peroxidase-labelled streptavidin anti-biotin complex (iVIEW Detection Kit; Ventana Medical System, Tucson, AZ) were used for the recognition of the first antibodies.

Genetic testing of the affected hES cell lines

Small clumps of cells of the VUB03_DM1 line were collected in alkaline lysis buffer [200 mmol/l KOH, 50 mmol/l dithiothreitol (DTT)] and analysed by a specific long PCR protocol to amplify the expanded repeat. The size of the repeat was visualized by the Southern blotting technique in comparison with the molecular size marker VI (Roche Diagnostics) and the PCR products obtained from the genomic DNA of the affected parent (De Temmerman et al., 2004).

For the VUB05_HD line, cells were collected in the same way. The repeat was analysed by PCR (Sermon et al., 2001) and the size of the repeat could be determined by fragment analysis on an ABI 3130 (Applied Biosystem, Niewerkerken a/d Ijsel, The Netherlands).

DNA extracted from VUB04_CF (Dneasy tissue Extraction Kit, Qiagen) was used to test for CF mutations using the LIPA kit (Innogenetics, Gent, Belgium).

Results

Source of embryos

Fifty-five fresh and cryopreserved human embryos were used for this study and two hES lines were obtained after immunosurgery (Figure 1A and B) from a frozen (line VUB01) and a fresh (line VUB02) blastocyst (Table II).

Figure 1.

Human ES cell derivation and culture. (A) Hoffman modulation optics image of a blastocyst during immunosurgery showing lysed trophectoderm cells after complement reaction. (B) Hoffman modulation optics image of ICM and trophectoderm separated after immunosurgery. (C and D) Phase contrast micrographs of line VUB01 at different stages of development: (C) ICM outgrowth 5 days after immunosurgery; (D) ICM outgrowth before first passaging at 8 days after immunosurgery. (E and F) Phase contrast micrographs of line VUB03_DM1 at different stages of development: (E) ICM outgrowth 5 days after immunosurgery; (F) ICM outgrowth before first passaging at 11 days after immunosurgery. Original magnification: (A–F) ×200.

Figure 1.

Human ES cell derivation and culture. (A) Hoffman modulation optics image of a blastocyst during immunosurgery showing lysed trophectoderm cells after complement reaction. (B) Hoffman modulation optics image of ICM and trophectoderm separated after immunosurgery. (C and D) Phase contrast micrographs of line VUB01 at different stages of development: (C) ICM outgrowth 5 days after immunosurgery; (D) ICM outgrowth before first passaging at 8 days after immunosurgery. (E and F) Phase contrast micrographs of line VUB03_DM1 at different stages of development: (E) ICM outgrowth 5 days after immunosurgery; (F) ICM outgrowth before first passaging at 11 days after immunosurgery. Original magnification: (A–F) ×200.

Table II.

Overall outcome of immunosurgeries performed in IVF and PGD embryos

 No. of blastocysts No. of isolated ICMs No. of outgrowths No. of stem cell lines (%)a Name of hES cell line derived 
IVF embryos      
    Frozen embryos 15 12 1 (6.6) VUB01 
    Fresh embryos 40 26 1 (2.5) VUB02 
Total 55 38 2 (3.6)  
PGD embryos      
    Myotonic dystrophy (DM1) 1 (11) VUB03_DM1 
    Cystic fibrosis (CF) 1 (100) VUB04_CF 
    Huntington disease (HD) 1 (25) VUB05_HD 
Total 14 14 3 (21.4)  
 No. of blastocysts No. of isolated ICMs No. of outgrowths No. of stem cell lines (%)a Name of hES cell line derived 
IVF embryos      
    Frozen embryos 15 12 1 (6.6) VUB01 
    Fresh embryos 40 26 1 (2.5) VUB02 
Total 55 38 2 (3.6)  
PGD embryos      
    Myotonic dystrophy (DM1) 1 (11) VUB03_DM1 
    Cystic fibrosis (CF) 1 (100) VUB04_CF 
    Huntington disease (HD) 1 (25) VUB05_HD 
Total 14 14 3 (21.4)  
a

The percentage was calculated as the ratio of stem cell lines to the number of blastocysts used.

Fourteen blastocysts from PGD cycles for DM1, CF and HD were used for the derivation of three lines (Table II). The DM1 hES cell line (VUB03_DM1) was derived from a blastocyst donated by a couple of which the wife was affected with the adult form of the disease (120 CTG repeats). The CF hES cell line (VUB04_CF), isolated from an embryo donated by a couple of which the wife carried the F508del mutation and the husband was affected with CBAVD, was compound heterozygous for the R31C mutant and the 5T variant. In order to avoid a child affected with a CF mutation as well as CBAVD, the patients decided, following genetic counselling, to have no transfer of embryos that were carriers of the F508del mutation. The HD hES cell line (VUB05_HD) was derived from a blastocyst donated by a couple of which the husband was affected with HD, carrying 42 CAG repeats in the huntingtin gene.

Derivation of hES cell lines

The isolated ICMs were plated on MEFs and observed daily for their attachment, survival and outgrowth (Figure 1C–F). When the outgrowths showed a compact colony structure with cells of stem cell-like morphology, a mechanical dissociation was performed. The clumps of cells were plated on new feeder layers and the resulting colonies were passaged further by mechanical slicing or by using 1 mg/ml collagenase type IV (Invitrogen).

VUB01 was derived from a frozen blastocyst with a clear ICM and trophectoderm, which failed to re-expand fully after thawing. VUB02 was derived from a fresh blastocyst of insufficient quality for transfer or freezing as a result of a delayed development. The resulting outgrowths were first passaged at day 8 and 10, respectively.

VUB03_DM1 was isolated from a fully expanded blastocyst that was not biopsied during PGD because of a delayed development at day 3. The outgrowth was passaged at day 11. VUB04_CF was derived from a blastocyst with a clear ICM and trophectoderm, carrying at least the F508del mutation in the CFTR gene. The outgrowth was passaged for the first time at day 11. Good quality blastocysts affected with HD were used for isolation of ICMs, and two outgrowths were obtained. One was lost due to an infection, while the second was passaged at day 8 (VUB05_HD).

At the moment, VUB01, VUB02, VUB03_DM1, VUB04_CF and VUB05_HD are at passage P135, P65, P60, P45 and P25, respectively.

Characterization of the hES cell lines

All the established lines present morphological features considered characteristic of hES cells: a compact colony structure, cells with a high nucleus-to-cytoplasm ratio and prominent nucleoli (Thomson et al., 1998; Reubinoff et al., 2000).

A summary of the analyses performed on the five established lines is presented in Table III.

Table III.

Characterization table for the five hES cell lines

 VUB01 VUB02 VUB03_DM1 VUB04_CF VUB05_HD 
Karyotype 46XY 46XY 46XX 46XX 46XY 
Alkaline. phosphatase 
Immunostaining      
    SSEA-1 – – – – – 
    SSEA-3 
    SSEA-4 
    TRA-1–60 
    TRA 1–81 
RT–PCR      
    OCT-4 
    NANOG 
    REX-1 
    SOX-2 
    GDF3 
    DNMT3B 
    LIN28 
    NPM1 
EB formation (endo/ecto/mesoderm) Ongoing 
Teratoma formation (endo/ecto/mesoderm) Ongoing 
Freezing/thawing 
 VUB01 VUB02 VUB03_DM1 VUB04_CF VUB05_HD 
Karyotype 46XY 46XY 46XX 46XX 46XY 
Alkaline. phosphatase 
Immunostaining      
    SSEA-1 – – – – – 
    SSEA-3 
    SSEA-4 
    TRA-1–60 
    TRA 1–81 
RT–PCR      
    OCT-4 
    NANOG 
    REX-1 
    SOX-2 
    GDF3 
    DNMT3B 
    LIN28 
    NPM1 
EB formation (endo/ecto/mesoderm) Ongoing 
Teratoma formation (endo/ecto/mesoderm) Ongoing 
Freezing/thawing 

The lines were analysed for the expression of surface markers that characterize undifferentiated hES cells (Thomson et al., 1998). In this regard, colonies of undifferentiated cells from all the five lines have been shown to be positive for SSEA-3, SSEA-4, TRA-1–60 and TRA-1–81, and negative for SSEA-1. The lines also revealed a positive alkaline phosphatase activity (Figure 2).

Figure 2.

Expression of cell markers in VUB04_CF, VUB05_HD and VUB02. Immunohistochemical marker expression analysis of cell lines VUB04_CF (A and B), VUB05_HD (C and D) and VUB02 (E). (A) SSEA-3, (B) SSEA-4, (C) TRA-1–60, (D) TRA-1–81. (E) Detection of a positive alkaline phosphatase activity. Original magnification: (A, B and E) ×100; (C, D) ×200.

Figure 2.

Expression of cell markers in VUB04_CF, VUB05_HD and VUB02. Immunohistochemical marker expression analysis of cell lines VUB04_CF (A and B), VUB05_HD (C and D) and VUB02 (E). (A) SSEA-3, (B) SSEA-4, (C) TRA-1–60, (D) TRA-1–81. (E) Detection of a positive alkaline phosphatase activity. Original magnification: (A, B and E) ×100; (C, D) ×200.

In addition, gene expression analysis (RT–PCR) revealed that all lines expressed genes regarded as ES specific: OCT-4, SOX-2, REX-1, NANOG and GDF3. New candidate human ES-specific genes (Richards et al., 2004) such as DNMT3B, an embryonic DNA methyltransferase, LIN28, an RNA-binding protein, and NPM1, a nucleolar protein, were also expressed.

The pluripotency tests showed that the hES cell lines were able to form EBs when grown in suspension (in vitro differentiation), and teratomas (except VUB05_HD for which the tests are still in progress) when injected in SCID mice (in vivo differentiation). In both cases, immunohistochemistry revealed the capacity of the cells to differentiate into representatives of all three germ layers: endoderm, mesoderm and ectoderm (Figure 3). Moreover, in a minority of EBs, rhythmically contracting regions of cells typical of cardiomyocytes were observed. After repeated freezing–thawing procedures, the hES cell lines still maintained the potential to be expanded in an undifferentiated state and then to differentiate in derivatives of all three germ layers when injected in SCID mice.

Figure 3.

In vivo and in vitro differentiation of hES cell lines. Immunohistochemistry on a teratoma from VUB03_DM1 (A–C) and VUB04_CF (D–F) showing differentiation into the three embryonic layers. Images were taken after immunostaining for CK18 (A and D) to show the presence of primitive epithelium (endoderm), for actin (B and E) to show the presence of smooth muscle (mesoderm), and for CK14 (C and F) to show the presence of.primitive squamous epithelium (ectoderm, F is probably primitive skin adnex). Immunostaining of EBs from VUB02 (G–I) with α-fetoprotein (G, endoderm), myosin heavy chain (H, mesoderm) and tubulin βIII (I, ectoderm). All the positively stained structures are marked with arrows. Phase contrast images of EBs from VUB05_HD day 5 (J) and day 10 (K). Histological staining of EBs of VUB03_DM1 day 22 (L). Original magnifications: (A, B, D, G, H and I) ×200; (C, E, F, J, K and L) ×100.

Figure 3.

In vivo and in vitro differentiation of hES cell lines. Immunohistochemistry on a teratoma from VUB03_DM1 (A–C) and VUB04_CF (D–F) showing differentiation into the three embryonic layers. Images were taken after immunostaining for CK18 (A and D) to show the presence of primitive epithelium (endoderm), for actin (B and E) to show the presence of smooth muscle (mesoderm), and for CK14 (C and F) to show the presence of.primitive squamous epithelium (ectoderm, F is probably primitive skin adnex). Immunostaining of EBs from VUB02 (G–I) with α-fetoprotein (G, endoderm), myosin heavy chain (H, mesoderm) and tubulin βIII (I, ectoderm). All the positively stained structures are marked with arrows. Phase contrast images of EBs from VUB05_HD day 5 (J) and day 10 (K). Histological staining of EBs of VUB03_DM1 day 22 (L). Original magnifications: (A, B, D, G, H and I) ×200; (C, E, F, J, K and L) ×100.

Genetic testing of the affected hES cell lines

At the time of isolation of VUB03_DM1, the diagnosis had not yet been established because the original embryo was not suitable for biopsy during PGD. At passage 1, cells were tested using PCR for the presence of an expanded CTG repeat. After Southern blot detection, an expansion of 470 repeats was found. This expansion showed an enlargement of 350 repeats in comparison with the mother’s expanded repeat (Figure 4). This size of repeat defines the cell line as belonging to the range of the ‘non-congenital’ form of DM1.

Figure 4.

Southern blot image of PCR products for genetic testing of VUB03_DM1. (A) Molecular size marker VI from Roche. (B) Genomic DNA from the husband (6 + 13 repeats). (C) Genomic DNA from the affected wife (11 repeats + expansion). (D and E) Small clump of cells of VUB03_DM1, passage one (13 repeats + expansion of 470 repeats) and (F) blank.

Figure 4.

Southern blot image of PCR products for genetic testing of VUB03_DM1. (A) Molecular size marker VI from Roche. (B) Genomic DNA from the husband (6 + 13 repeats). (C) Genomic DNA from the affected wife (11 repeats + expansion). (D and E) Small clump of cells of VUB03_DM1, passage one (13 repeats + expansion of 470 repeats) and (F) blank.

The F508del mutation and the 5T variant of the VUB04_CF cell line were confirmed on DNA from cells at passage 10 using the Lipa-kit.

VUB05_HD was shown to carry 44 CAG repeats, which represent a small enlargement in comparison with the 42 repeats of the affected father. The size of the repeat in the embryo had already been established during PGD and was confirmed on VUB05_HD cells at passage 3 (Figure 5).

Figure 5.

Fragment analysis on an ABI 3130 after amplification of the HD mutation (green) through PCR of (A) genomic DNA of the wife showing two healthy alleles (17 + 23 repeats); (B) genomic DNA of the husband showing a healthy (22 repeats) and affected alleles (42 repeats); (C and E) PCR product from a single blastomere of the affected embryo during PGD (23 + 44 repeats); (D and F) PCR product of the blank of each blastomere during PGD; (G and H) PCR product of a small clump of cells from VUB05_HD at passage three (23 + 44 repeats). The length of the PCR product was calculated in comparison with the ROX-GS500 standard (red, Applied Biosystems).

Figure 5.

Fragment analysis on an ABI 3130 after amplification of the HD mutation (green) through PCR of (A) genomic DNA of the wife showing two healthy alleles (17 + 23 repeats); (B) genomic DNA of the husband showing a healthy (22 repeats) and affected alleles (42 repeats); (C and E) PCR product from a single blastomere of the affected embryo during PGD (23 + 44 repeats); (D and F) PCR product of the blank of each blastomere during PGD; (G and H) PCR product of a small clump of cells from VUB05_HD at passage three (23 + 44 repeats). The length of the PCR product was calculated in comparison with the ROX-GS500 standard (red, Applied Biosystems).

Discussion

IVF and ICSI cycles are offered to patients with infertility problems and PGD to couples at risk of transmitting genetic diseases (Sermon et al., 2005). As a consequence, surplus normal embryos and embryos carrying genetic disorders donated for research by the patients are available for the derivation of hES cell lines. The creation of new hES cell lines, with or without known genetic mutations, is of utmost importance for further research into the fundamental biological processes in these cells.

We describe here the derivation of five new hES cell lines of which two originated from surplus IVF embryos (VUB01 and VUB02). The three other hES cell lines were derived from PGD embryos diagnosed as carriers of mutations of monogenic diseases: DM1 (VUB03_DM1), CF (VUB04_CF) and HD (VUB05_HD).

All the lines have a similar behaviour in culture and present a normal karyotype. The lines express all the markers considered characteristic of undifferentiated hES cells, and were proven to have pluripotent capacity both in vitro and in vivo. For VUB05_HD, the tests are ongoing.

A remarkable difference in the derivation rate was obtained between IVF and PGD embryos (3.6 versus 21.4%, Table II). An explanation for this difference may be the learning curve for the setting up of the derivation techniques for hES cell lines. This explains why more embryos (75% of IVF embryos) were used for the derivation of VUB01 while only a few additional attempts were necessary to derive VUB02. In the meantime, the culture and derivation conditions were improved by replacing FBS with KO SR. Another explanation for the low derivation rate may be that spare IVF embryos were donated for research because of their poor quality, while PGD embryos were donated because of their genetic abnormalities, not because of their poor quality. The influence of PGD embryo quality is also reflected in a higher success rate for immunosurgery compared with IVF embryos (100 versus 69%).

Except for VUB01, all the VUB hES cell lines were derived in serum-free conditions using mouse feeder layers. This technique does not prevent any animal contamination as recommended for a possible future therapeutic use (Hovatta and Skottman, 2005). However, these culture conditions are reliable and remain standard practice for hES cells to be used for in vitro research. The derivation of hES cell lines in feeder-free culture conditions has been reported recently (Klimanskaya et al., 2005). This significant advance in hES cell research will be beneficial in further attempts to optimize derivation techniques of lines that are totally free of animal contamination.

The establishment of new hES cell lines from surplus IVF embryos is still necessary, though an increasing number of hES cell lines has been reported recently (Cowan et al., 2004). More evidence is becoming available that different hES cell lines show significantly different behaviour at the level of gene expression (Zeng et al., 2004). On the other hand, there are still no standard criteria for the derivation, characterization and maintenance of hES cell lines. Our hES cell lines present differences in genetic background, but not in derivation techniques (except VUB01) or in culture conditions. The normal lines can therefore be used in experiments as a reference for the affected lines.

PGD embryos diagnosed as affected were also used to obtain hES cell lines. DM1, CF and HD are three of the most common serious genetic diseases for which therapeutics are inefficient or even non-existent. Studies of the pathology of these diseases are hampered by the difficulties encountered in manipulating the cultures of cell types relevant for the disease, e.g. central nervous system neurons in HD. Moreover, transgenic animal models do not always fully represent the human pathogenesis of the disease, such as is illustrated by the example of the Dmpk-/Dmpk-mouse model (Reddy et al., 1996). To overcome these problems, an important research area is currently concentrating on creating and studying models for human diseases. An important recent breakthrough has been the derivation of patient-specific hES cell lines after nuclear transfer using somatic cells obtained from patients suffering from diseases (Hwang et al., 2005). With the derivation of hES cells carrying well-defined mutations, an unlimited source of material has been made available for differentiation into the specific cell types involved in the pathology of the disease.

Derivation of hES cell lines that carry dynamic mutations caused by unstable triplet repeats, such as DM1 or HD, provides an opportunity to study the mechanisms of instability. With regard to DM1, it is still not clear how the expanded CTG repeat in the 3′-untranslated region of the DMPK gene leads to the clinical features. It has been shown recently that DMPK mutant RNA binds and sequesters other mRNAs from active chromatin, thereby giving rise to the formation of RNA foci. In this way, the processing of mRNA transcripts is altered, resulting in an aberrant splicing and a consequent reduction in gene expression of diverse genes (Ebralidze et al., 2004). One of the consequences of this phenomenon is the already described intergenerational instability in adults and in embryos (De Temmerman et al., 2004). VUB03_DM1 can therefore be used as an in vitro model to study the behaviour of triplet repeats.

Regarding HD, the huntingtin gene contains an unstable polyglutamine (CAG) repeat, which is located in the N-terminal portion of the protein (Squiteieri et al., 2000). Because of an enlarged polyglutamine tail, the mutant protein aggregates inside the cell leading to a toxic effect due to the sequestration of targets including the normal huntingtin protein (Dyer and Mc Murray, 2001). To analyse this process, cultures of hES cell lines carrying the HD mutation may represent an interesting study material.

In the case of CF, a myriad of CFTR mutations that cause defects in CFTR protein production and function have been reported. The resulting function of CFTR modulates the type and severity of the clinical features. In this regard, future therapeutic management will vary with CF mutation types (Kerem et al., 2005). Derivation of new CF hES cell lines will be interesting for comparing the effect of different CF mutation types at the cell culture level (Pickering et al., 2005). In this regard, a 46,XX line carrier for the F508del and 5T variant may be useful to be compared with similar 46,XY lines in order to clarify the pathogenesis of CBAVD.

In conclusion, we present here the first hES cell lines established in Belgium. The legal status of research on embryos and on their use for derivation in hES cells is clearly defined in our country, and is making research in this field feasible (Pennings, 2003). Our study therefore contributes to the increasing number of available genetically normal (Cowan et al., 2004) and abnormal hES cell lines (Pickering et al., 2005; Verlinsky et al., 2005). The VUB hES cell lines will be available through a concluded material transfer agreement.

Acknowledgements

Ariane Stengers contributed to the derivation of the VUB01 cell line. We gratefully acknowledge the assistance of the IVF team for providing us with embryos; W.Lissens and M.Urbina and their teams of the Centre of Medical Genetics for the genetic testing of the lines. We wish to thank W.Meul of the Centre of Reproductive Medicine, N.Buelens of the Pathology Department, G.Cresens of the Animal Facility of VUB. We also thank M.Whitburn of the Language Education Centre of the Vrije Universiteit Brussel for proofreading this manuscript. K.S. is a postdoctoral fellow and U.U is a PhD student at the Fund for Scientific Research, Flanders (FWO-Vlaanderen). I.M. is supported by the Foundation for Reproductive Medicine (Stichting Reproductieve Geneeskunde). The research work was supported from a grant from the FWO-Vlaanderen and a Concerted Research Action of the VUB.

References

Cowan
CA
, Klimanskaya I, McMahon J, Atienza J, Witmyer J, Zucker JP, Wang S, Morton CC, McMahon AP, Powers D et al. (
2004
) Derivation of embryonic stem-cell lines from human blastocysts.
N Engl J Med
 
350
,
1353
–1356.
Davis
P
(
2001
) Cystic fibrobsis.
Pediatr Rev
 
22
,
257
–264.
De Temmerman
N
, Sermon K, Seneca S, De Rycke M, Hilven P, Lissens W, Van Steirteghem A and Liebaers I. (
2004
) Intergenerational instability of the expanded CTG repeat in the DMPK gene: studies in human gametes and preimplantation embryos.
Am J Hum Genet
 
75
,
325
–329.
De Vos
A
and Van Steirteghem A (
2001
) Aspects of biopsy procedures prior to preimplantation genetic diagnosis.
Prenat Diagn
 
21
,
767
–780.
Devroey
P
and Van Steirteghem A (
2004
) A review of ten years experience of ICSI.
Hum Reprod Update
 
10
,
19
–28.
Dyer
RB
and McMurray CT (
2001
) Mutant protein in Huntington disease is resistant to proteolysis in affected brain.
Nat Genet
 
29
,
270
–278.
Ebralidze
A
, Wang Y, Petkova V, Ebralidse K and Junghans RP (
2004
) RNA leaching of transcription factors disrupts transcription in myotonic dystrophy.
Science
 
303
,
383
–387.
Evers-Kiebooms
G
, Nys K, Harper P, Zoeteweij M, Durr A, Jacopini G, Yapijakis C and Simpson S (
2002
) Predictive DNA-testing for Huntington’s disease and reproductive decision making: a European collaborative study.
Eur J Hum Genet
 
10
,
167
–176.
Gerami-Naini
B
, Dovzhenko OV, Durning M, Wegner FH, Thomson JA and Golos TG (
2004
) Trophoblast differentiation in embryoid bodies derived from human embryonic stem cells.
Endocrinology
 
145
,
1517
–1524.
Goossens
V
, Sermon K, Lissens W, De Rycke M, Saerens B, De Vos A, Henderix P, Van de Velde H, Platteau P, Van Steirteghem A et al. (
2004
) Improving clinical preimplantation genetic diagnosis for cystic fibrosis by duplex PCR using two polymorphic markers or one polymorphic marker in combination with the detection of the ΔF508 mutation.
Mol Hum Reprod
 
9
,
559
–567.
Gosden
C
, Davdson C and Robertson M (
1992
) Lymphocyte culture. In DE Rooney and BH Czepulkowsky (eds), Human Cytogenetics. Oxford University Press, Oxford, UK pp.
37
–47.
Hovatta
O
and Skottman H (
2005
) Feeder-free derivation of human embryonic stem-cell lines.
Lancet
 
365
,
1601
–1603.
Hwang
WS
, Roh SI, Lee BC, Kang SK, Kwon DK, Kim S, Kim SJ, Park SW, Kwon HS, Lee CK et al. (
2005
) Patient-specific embryonic stem cells derived from human SCNT blastocysts.
Science
 ,
308
,
1777
–1783.
Itskovitz-Eldor
J
, Schuldiner M, Karsenti D, Eden A, Yanuka O, Amit M, Soreq H and Benvenisty N (
2000
) Differentiation of human embryonic stem cells into embryoid bodies comprising the three embryonic germ layer.
Mol Med
 
6
,
88
–95.
Kerem
E
(
2005
) Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol
 ,
40
,
183
–196.
Klimenskaya
I
, Chung Y, Meisner L, Johnson J, West MD and Lanza R (
2005
) Human embryonic stem cells derived without feeder layers.
Lancet
 
365
,
1636
–1641.
Liebaers
I
, Sermon K, Staessen C, Joris H, Lissens W, Van Assche E, Nagy P, Bonduelle M, Vandervorst M, Devroey P et al. (
1998
) Clinical experience with preimplantation genetic diagnosis and intracytoplasmic sperm injection.
Hum Reprod
 
13
Suppl 1,
186
–195.
Lissens
W
, Mercier B, Tournaye H, Bonduelle M, Ferec C, Seneca S, Devroey P, Silber S, Van Steirteghem A and Liebaers I (
1996
) Cystic fibrosis and infertility caused by congenital bilateral absence of the vas deferens and related clinical entities.
Hum Reprod
 
11 Suppl 4
,
55
–78.
Pennings
G
(
2003
) New Belgian law on research on human embryos: trust in progress through medical science.
J Assist Reprod Genet
 
20
,
343
–346
Pickering
SJ
, Minger SL, Patel M, Taylor H, Black C, Burns CJ, Ekonomou A and Braude PR (
2005
) Generation of a human embryonic stem cell line encoding the cystic fibrosis mutation deltaF508, using preimplantation genetic diagnosis.
Reprod Biomed Online
 
10
,
390
–397.
Reddy
S
, Smith DB, Rich MM, Leferovich JM, Reilly P, Davis BM, Tran K, Rayburn H, Bronson R, Cros D et al. (
1996
) Mice lacking the myotonic dystrophy protein kinase develop a late onset progressive myopathy.
Nat Genet
 
13
,
325
–335.
Reubinoff
BE
, Pera MF, Fong CY, Trounson A and Bongso A (
2000
) Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro.
Nature Biotechnol
 
18
,
399
–404.
Reubinoff
BE
, Pera MF, Vajta G and Trounson AO (
2001
) Effective cryopreservation of human embryonic stem cells by the open pulled straw vitrification method.
Hum Reprod
 
16
,
2187
–2194.
Richards
M
, Tan SP, Tan JH, Chan WK and Bongso A (
2004
) The transcriptome profile of human embryonic stem cells as defined by SAGE.
Stem Cells
 
22
,
51
–64.
Sermon
K
, Seneca S, De Rycke M, Goossens V, Van de Velde H, De Vos A, Platteau P, Lissens W, Van Steirteghem A and Liebaers I (
2001
) PGD in the lab for triplet repeat diseases—myotonic dystrophy, Huntington’s disease and fragile-X syndrome.
Mol Cell Endocrinol
 
183 Suppl 1
,
S77
–S85.
Sermon
K
, Van Steirteghem A and Liebaers I (
2004
) Preimplantation genetic diagnosis.
Lancet
 
363
,
1633
–1641
Sermon
K
, Moutou C, Harper J, Geraedts J, Scriven P, Wilton L, Magli MC, Michiels A, Viville S and De Die C. (
2005
) ESHRE PGD Consortium data collection IV: May–December 2001.
Hum Reprod
 
20
,
19
–34.
Siciliano
G
, Manca M, Gennarelli M, Angelini C, Rocchi A, Iudice A, Miorin M and Mostacciuolo M (
2001
) Epidemiology of myotonic dystrophy in Italy: re-appraisal after genetic diagnosis.
Clin Genet
 
59
,
344
–349.
Squitieri
F
, Berardelli A, Nargi E, Castellotti B, Mariotti C, Cannella M, Lavitrano ML, de Grazia U, Gellera C and Ruggieri S (
2000
) Atypical movement disorders in the early stages of Huntington’s disease: clinical and genetic analysis.
Clin Genet
 
58
,
50
–6.
Thomson
JA
, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS and Jones JM (
1998
) Embryonic stem cell lines derived from human blastocysts.
Science
 
282
,
1145
–11477.
Verlinsky
Y
, Strelchenko N, Kukharenko V, Rechitsky S, Verlinsky O, Galat V and Kuliev A (
2005
) Human embryonic stem cell lines with genetic disorders.
Reprod Biomed Online
 
10
,
105
–110.
Zeng
X
, Miura T, Luo Y, Bhattacharya B, Condie B, Chen J, Ginis I, Lyons I, Mejido J, Puri RK, Rao MS and Freed WJ (
2004
) Properties of pluripotent human embryonic stem cells BG01 and BG02.
Stem Cells
 
22
,
292
–312.

Author notes

1Research Centre for Reproduction and Genetics, 2Centre for Medical Genetics, 3Centre for Reproductive Medicine and 4Department of Pathology, University Hospital and Medical School of the Vrije Universiteit Brussel (Dutch-speaking Brussels Free University) Laarbeeklaan 101, 1090 Brussels, Belgium