Abstract

BACKGROUND

microRNAs (miRNAs) play an important role in development and are associated with birth defects. Data are scant on the role of miRNAs in birth defects arising from exposure to environmental factors such as alcohol.

METHODS

In this study, we determined the expression levels of 509 mature miRNAs in fetal mouse brains with or without prenatal ethanol exposure using a miRNA microarray technique, verified by northern blot and PCR. Mouse embryos in culture were used to examine the effect of ethanol treatment on expression of the putative target genes of miR-10a (Hoxa1 and other Hox members) at mRNA and protein level. Open field and Morris water maze tests were also performed at post-natal day 35.

RESULTS

Ethanol treatment induced major fetal teratogenesis in mice and caused mental retardation in their offspring, namely lower locomotor activity (P < 0.01) and impaired task acquisition. Of the screened miRNAs, miR-10a, miR-10b, miR-9, miR-145, miR-30a-3p and miR-152 were up-regulated (fold change >1.5) in fetal brains with prenatal ethanol exposure, whereas miR-200a, miR-496, miR-296, miR-30e-5p, miR-362, miR-339, miR-29c and miR-154 were down-regulated (fold change <0.67). Both miR-10a and miR-10b were significantly up-regulated (P < 0.01) in brain after prenatal ethanol exposure. Ethanol treatment also caused major obstruction in the development of cultured embryos, with down-regulated Hoxa1. Co-incubation with folic acid blocked ethanol-induced teratogenesis, with up-regulated Hoxa1 and down-regulated miR-10a (P < 0.01).

CONCLUSIONS

The study provided new insights into the role of miRNAs and their target genes in the pathogenesis of fetal alcohol syndrome.

Introduction

microRNAs (miRNAs) are small non-coding RNAs of ∼22 nucleotides that regulate gene expression by targeting mRNAs in a sequence-specific manner, leading to induction of translational repression and/or mRNA degradation (Ambros, 2004; Bartel, 2004). It is estimated that miRNAs account for ∼1% of predicted genes in higher eukaryotic genomes and that up to 30% of genes within the human genome might be regulated by miRNAs (Griffiths-Jones, 2004). A line of evidence indicates that miRNAs are involved in the regulation of a number of genes that are involved in development (Karp and Ambros, 2005), cell proliferation (Cheng et al., 2005) and apoptosis (Xu et al., 2004), and carcinogenesis (He et al., 2005a, b). Recent studies provide growing evidence for the involvement of miRNAs in embryo development and maintenance of tissue identity (Ambros and Chen, 2007; Yu et al., 2007). In Dicer1 (RNaseIII enzyme) mutant mice, miRNAs have wide-ranging roles in embryogenesis (Bernstein et al., 2003). Dicer mutant embryonic stem cells derived from conditional gene targeting have severe differentiation defects (Kanellopoulou et al., 2005). Removal of Dicer in the limb mesoderm leads to a dramatic apoptosis in the developing limb (Harfe et al., 2005). miRNA expression analysis has led to the discovery of a potential role for the miR-1 in mammalian heart development (Lee and Ambros, 2001). miR-1, the product of two genes, miR-1-1 and miR-1-2, is highly expressed in murine heart and muscle. Overexpression of miR-1 under the β-myosin heavy chain promoter resulted in developmental arrest after heart failure at embryonic day (E) 13.5 (Zhao et al., 2005). miR-181, which is highly expressed in B lymphoid cells of mouse bone marrow, has been directly implicated in B-cell development (Chen et al., 2004). When overexpressed in hematopoietic progenitor cells, miR-181 leads to an increase in the fraction of B-lineage cells.

Emerging evidence also suggests that miRNAs play prominent roles in human disease, including cancers, and neurodegenerative and metabolic diseases (Ambros, 2004; Bartel, 2004). miRNAs have been found to be associated with birth defects, such as fragile X syndrome (Perera and Ray, 2007) and neuroblastoma (Welch et al., 2007). Fragile X syndrome, an inherited mental retardation disease, is caused by a loss of expression of the fragile X mental retardation protein, which regulates neuronal function via miRNAs and thus links miRNAs with birth defects (Jin et al., 2004). Neuroblastoma, a cancer in children accounting for 15% of pediatric cancer deaths, is caused by hemizygous deletion of chromosome 1p, which leads to the loss of one or more tumor suppressor genes. It has been shown that miR-34a, a suppressor of neuroblastoma tumorigenesis, is expressed at low levels in primary neuroblastoma tumors and neuroblastoma cell lines (Welch et al., 2007).

miRNAs are essential in development and expected to play an important role in birth defects. Prenatal exposure to dietary and environmental risk factors have a detrimental effect, resulting in birth defects and diseases developed later in life (Reamon-Buettner and Borlak, 2007). Fetal alcohol syndrome (FAS) is a birth defect caused by heavy exposure to alcohol in utero, and brain development is most sensitive to the effects of prenatal alcohol exposure (Gohlke et al., 2005). Typical symptoms of FAS are mental retardation, poor growth, facial defects and behavioral problems. Indeed, in alcohol-related neurodevelopmental disorder (ARND), the predominant neurotoxic effects and a large spectrum of cerebral dysfunctions are more frequent than the full-blown FAS with facial dysmorphogenesis and mental retardation (Manning and Eugene Hoyme, 2007). The pathological and molecular mechanisms for FAS and ARND are not yet fully understood, although they are considered to result from interplay among multifaceted factors, including alcohol and its toxic metabolites, and maternal and fetal responses to these. Recently, several studies using DNA microarray analysis have identified a small number of genes which are significantly altered by prenatal ethanol exposure in rodents (Hard et al., 2005; Shankar et al., 2006). These genes are mainly associated with stress and external stimulus responses, transcriptional regulation, cellular homeostasis and protein metabolism. Additionally, Sathyan et al. (2007) have found that miRNA-9, -21, -153 and -335 were down-regulated by ethanol in mouse cortical neurons in vitro, and that these miRNAs exhibit both synergistic and antagonistic interactions. However, there are no reports of an association of miRNAs with ethanol-induced toxicity.

Folic acid (FA) is essential for nucleic acid synthesis, amino acid metabolism and protein synthesis. It is known that FA supplementation in young women can prevent intrauterine growth restriction, neural tube defects and other congenital anomalies (Eskes, 1997; Scholl and Johnson, 2000), and studies in experimental animals have demonstrated that FA can also ameliorate toxicity induced by ethanol (Gutierrez et al., 2007; Xu et al., 2008; Yanaguita et al., 2008). The mechanism for FA’s protective effect is still unclear, although proteomic analysis has indicated that FA can modulate alcohol-altered proteins involved in energy production, signal pathways and protein translation (Xu et al., 2008).

In the present study, we have investigated the miRNA gene expression patterns in fetal mouse brains following maternal exposure to ethanol. In vitro culture of whole mouse embryos was used to examine the effect of ethanol treatment on expression of the putative target genes of miR-10a, namely Hoxa1 and other Hox members. The effect of FA treatment on ethanol-induced teratogenesis in vitro and Hoxa1 expression was also examined.

Materials and Methods

Experimental animals

Virgin female C57BL/6J mice (19.0 ± 1.0 g) were housed in controlled temperature (22 ± 0.58°C), humidity (50 ± 10% relative humidity) and lighting (12/12 h light/dark cycle) conditions. Food and water were available ad libitum. At 10 ± 1 weeks of age, the virgin female mice were mated overnight with proven breeder C57BL/6J males. Pregnancy was confirmed the following morning, defined as gestation day (GD) 0, by the presence of a vaginal ‘plug’ day was. The ethics approval for animal use was obtained from the Ethics Committee of Peking University, China. All animals used in the present study were handled in compliance with the Guiding Principles for the Care and Use of Animals (DHEW Publication, NIH 80-23).

Ethanol exposure in vivo

Pregnant females were randomly allocated to five groups receiving: distilled water treatment, maltose/dextrin treatment (7.1 g/kg/day, 35.5% w/v maltose/dextrin solution to provide the caloric equivalence of intermediate-dose ethanol), low-dose ethanol treatment (2.0 g/kg/day, 12.67% v/v ethanol solution), intermediate-dose ethanol treatment (4.0 g/kg/day, 25.34% v/v ethanol solution) or high-dose ethanol treatment (6.0 g/kg/day, 38.01% v/v ethanol solution). Pregnant mice received one of the above solutions twice daily at 9 and 11 a.m. via gavage for 10 days from GD6 to 15. The ethanol doses used in this study are in the range of published regimens with mice (Gilliam et al., 1988; Opitz et al., 1997; Du and Hamre, 2001; Xu et al., 2006) to minimize incidence of maternal lethality. The period from GD6 to 15 for ethanol treatment was selected because it has been shown to produce neurobehavioral teratogenic effects in offspring, with minimal embryonic/fetal or maternal lethality (Abdollah et al., 1993; Opitz et al., 1997). On GD12, maternal tail blood samples were collected into heparinized capillary tubes at 1 h after the second divided dose of ethanol. The blood ethanol concentrations were analyzed by headspace capillary gas chromatography according to the method described by Livy et al. (2003). The lowest detectable concentration for ethanol in mouse blood was 0.4 µg/ml.

Litters were transferred to large plastic bins with wood chip bedding on the day of birth, defined as post-natal day (PD) 0. Beginning at PD1, offspring were weighed and monitored daily for general physical conditions and growth. The offspring were weaned and grouped by gender on PD21. The offspring of each gender and for all treatment groups were housed in groups of up to eight animals per bin.

Pregnancy outcome assessment

During the period of ethanol treatment (GD6 to 15), maternal death and spontaneous miscarriage were recorded, and maternal weight was determined. On GD17, individual pregnant mice were sacrificed by etherization followed by decapitation. The litter of each pregnant animal was delivered by Cesarean section. Placenta and maternal brain were excised and weighed. The litter size, number of implantation sites, live and dead fetuses, resorptions and gross morphology were assessed. Fetal data, including body weight, head length, crown-rump length, tail length and brain weight were determined.

Whole-embryo culture

In vitro whole-embryo culture was carried out according to the method developed by New (1978) and adapted by Van Maele-Fabry and Picard (1987). Briefly, the gravid uteri were removed from the dams on GD8.5 and placed in sterile Hank’s solution at pH 7.2. Maternal decidual tissue was removed. Mouse embryos displaying three to five somite pairs were selected for culture. The culture medium was composed of 100% male rat serum supplemented with 100 U/ml penicillin G and 100 mg/ml streptomycin. To prepare rat serum, blood from healthy rats was freshly collected and immediately centrifuged, heat-inactivated (56°C for 30 min) and filter sterilized. The embryos were incubated for 48 h at 37.5 ± 0.5°C in sealed 50 ml glass bottles (three embryos/bottle, one embryo/ml culture medium), rotated at 40 rev/min. The culture medium was initially pre-gassed for 5 min with 5% O2: 5% CO2: 90% N2. Subsequent re-gassings occurred at 20 h (20% O2: 5% CO2: 75% N2) and 30 h (40% O2: 5% CO2: 55% N2). The embryos were randomly divided into treatment groups: control [phosphate-buffered saline (PBS)], 2.0 mg/ml ethanol, 4.0 mg/ml ethanol with or without addition of FA at 0.01, 0.1 or 1.0 mmol/l, 8.0 mg/ml ethanol. Ethanol was directly added into culture medium. Ethanol and FA were administered at above dosages according to our previous studies (Xu et al., 2006; Li et al., 2007) and a study by Chen et al.( 2005). These dosages are considered to be physiologically relevant.

In vitro embryo morphological assessment

At the end of 48-h whole-embryo culture, mouse embryos were evaluated according to the morphologic scoring system of Van Maele-Fabry and Picard (1987). Only viable embryos displaying yolk sac circulation and heartbeat were examined. Diameters of the yolk sacs, crown-rump length and head length of each viable embryo were measured. Measurements of each viable embryo were taken on the standard 12 scoring items. The assessed morphological features included embryonic flexion, heart, neural tube, cerebral vesicles, otic, optic and olfactory organ, branchial arch, limb buds, yolk sac circulation, allantois and somites. The incidences of microcephaly, unclosed neural folds, branchial arch dysplasia and undifferentiated cardiac tube were recorded as observed abnormalities. The malformation was confirmed by the presence of at least one abnormality mentioned above.

miRNA microarray analysis

The microarray analysis was performed as described (Thomson et al., 2004). Briefly, total RNA was extracted from E17.5 fetus brains using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. An aliquot (5 µg) of the RNA sample was used for hybridization on miRNA microarray chips (CapitalBio Co., Beijing, China) which contained 509 mature miRNA probes spotted in quadruplicate (435 for human, 261 for mouse and 196 for rat) with annotated active sites, according to the miRNA database at Sanger Center in October 2005 (http://microrna.sanger.ac.uk). The hybridized chips were washed and processed for scanning using a LuxScan 10K/A dual-channel laser Microarray Scanner (CapitalBio Co.). Microarray images were analyzed using Luxscan3.0 (CapitalBio Co.). Average values for the replicate spots of each miRNA were background-subtracted, normalized and subjected to further analysis. Background-subtracted intensities were thresholded to 10 and log transformed. Flagged spots corresponding to absent or low-quality signals were removed from the analysis before global median normalization. Differentially expressed miRNAs were identified by SAM (Significance Analysis of Microarrays) analysis (Tusher et al., 2001), which calculates a score for each gene on the basis of the change in expression relative to the SD of all measurements. We identified genes with a false discovery rate of <5% and an absolute fold change of ≥1.5.

Northern blotting analysis

Total RNA (30 µg) was separated on a 15% denaturing polyacrylamide gel containing 8 M urea. The RNA was then electrophoretically transferred to Hybond N+ nylon membrane (Amersham, Buckinghamshire, UK) by semidry blotting (Bio-Rad). Probe was generated by T4 polynucleotide kinase (New England Biolabs, Ipswich, MA, USA)-mediated end-labeling of DNA oligonucleotides complementary to the mature miRNA with [γ -32P]ATP. The filter was hybridized in a thermo hybrid oven (ThermoHybrid, Ashford, Middlesex, UK) at 39°C for 16 h and then washed with 2× sodium citrate-0.5% sodium dodecyl sulphate (SDS) following manufacturer’s instructions. The oligonucleotide probes comprised the full complementary sequences of mature miRNAs: miR-10a, 5′-CACAAATTCGGATCTACAGGGTA-3′; miR-10b, 5′-ACACAAATTCGGTTCTACAGGG -3′. For U6 small nuclear (sn) RNA, the probe sequence was 5′-ATTTGCGTGTCATCCTTGCG-3′.

Quantitative real-time PCR and RT–PCR analysis

Quantitative real-time PCR was performed using the mir Vana™ qRT–PCR miRNA detection kit (Ambion, Austin, TX, USA), mir Vana™ qRT–PCR primer set (Ambion) and ABI PRISM 7700 DNA sequencer (Applied Biosystems, Foster City, CA, USA). Embryonic and fetal brains were prepared and the embryonic brains were separated from the body by cutting under the third branchial arch. Total RNA was extracted from the brain using Trizol (Invitrogen) according to the manufacturer’s instructions, DNA was removed with DNase-1 (Ambion) and complementary DNA (cDNA) was synthesized using ArrayScript enzyme kit (Ambion). The primers for amplification of U6 snRNA, miR-10a and miR-10b are listed in Table I. U6 snRNA is the endogenous control gene to normalize for RNA content among different samples. The three gene-specific miRNA amplicons were all ∼90 bp long. The expression of miRNA relative to U6 snRNA was determined using the 2−ΔΔCt method as described previously (Gibson et al., 1996; Heid et al., 1996). Ct is calculated based on the time (measured in PCR cycle numbers) at which the reporter fluorescent emission increases beyond a threshold level (based on the background fluorescence of the system). The Ct value is correlated to input target mRNA levels and a greater quantity of input mRNA target results in a lower Ct value, as a result of requiring fewer PCR cycles for reporter fluorescent emission intensity to reach the threshold (Gibson et al., 1996; Heid et al., 1996).

Table I

Primer sequences used in RT–PCR

Gene Forward primer (5′–3′) Reverse primer (5′–3′) Product size (bp) 
Hoxa1 AAGTTAAAAGAAACCCTCCC TTTCTCATCGCTGCCAGGAG 293 
Hoxb4 CCAGAACCCCCTGCATCCCA CATGTTCGAACTCCTGCTTG 178 
Hoxb5 GGATGAGGAAGCTTCACATC GCCAGACTCATACTTTTCAG 246 
Hoxd3 CGACAGAACTCCAAGCAGAA AGAATGCAGGATGCCCTTAG 280 
Hoxd4 TGAAAAAGGTGCACGTGAAT GAAGAAGACCTGCCCTTGGT 262 
β-Actin GTGGGCCGCTCTAGGCACCA CGGTTGGCCTTAGGGTTCAGG 234 
Gene Forward primer (5′–3′) Reverse primer (5′–3′) Product size (bp) 
Hoxa1 AAGTTAAAAGAAACCCTCCC TTTCTCATCGCTGCCAGGAG 293 
Hoxb4 CCAGAACCCCCTGCATCCCA CATGTTCGAACTCCTGCTTG 178 
Hoxb5 GGATGAGGAAGCTTCACATC GCCAGACTCATACTTTTCAG 246 
Hoxd3 CGACAGAACTCCAAGCAGAA AGAATGCAGGATGCCCTTAG 280 
Hoxd4 TGAAAAAGGTGCACGTGAAT GAAGAAGACCTGCCCTTGGT 262 
β-Actin GTGGGCCGCTCTAGGCACCA CGGTTGGCCTTAGGGTTCAGG 234 

Total RNA extracted from E10.5 embryo and E17.5 fetus brains was reverse transcribed to cDNA with a Superscript first-strand synthesis system (Invitrogen). The oligonucleotides used for PCR are listed in Table I. The primer pairs that flank at least one intron were designed to avoid amplification from any contaminating genomic DNA. Standard thermal cycle profile was as follows: a single denaturing step at 95°C for 10 min, followed by 35 cycles (95°C for 30 s, 56°C for 1 min and 72°C for 1 min, with the final extension for 10 min). The PCR products were electrophoresed on a 2% agarose gel, followed by ethidium bromide staining. Gels were photographed with an UV transilluminator. Negative controls included cDNA samples without reverse transcriptase, or a water control instead of cDNA, as templates in PCR. The β-actin gene was amplified as the internal standard.

Western blotting assay

Total protein extract was prepared using lysis buffer containing 50 mM Tris–HCl (pH 7.4), 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 1 mM EDTA, 1% sodium deoxycholate and 1 mM phenylmethylsulphonyl fluoride. The protein concentration was determined using the Bradford assay (Bradford, 1976). Proteins were separated by SDS-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride membrane (Millipore). The membranes were blocked with 5% skimmed milk in TBST (10 mM Tris, pH 7.5, 100 mM NaCl and 0.1% Tween 20) and incubated with primary antibodies in TBST with 0.5% skimmed milk overnight at 4°C. The membrane was treated with rabbit anti-Hoxa1 (1:400, sc-17146; Santa Cruz Biotechnology, Santa Cruz, CA, USA) as the primary antibody and horse-radish peroxidase-conjugated goat anti-rabbit immunoglobulin G antibody (1:3000, Santa Cruz Biotechnology) as the secondary antibody. Loading control was carried out by re-incubating the same membrane with an anti-β-actin antibody (Santa Cruz Biotechnology). The assay was conducted in triplicate for each sample.

Immunohistochemistry

Immunohistochemistry was performed using standard techniques as described previously (Wysolmerski et al., 1998). Mouse embryos were fixed overnight at 4°C with 4% formaldehyde in PBS and embedded in paraffin. Subsequently, serial 5 µm sagittal sections were cut and stained with hematoxylin and eosin for microscopic examination. The anti-Hoxa1 rabbit polyclonal antibody (sc-17146) was used at a dilution of 1:100. Slides were counterstained using hematoxylin. The number of Hoxa1-positive cells was counted for semi-quantification of expression levels by two independent observers who were blinded to the treatment. At least six fields (magnification ×400) were counted per section of each sample. The results were expressed as the average number of positive cells.

Morris water maze test

Male and female mice offspring, ∼PD40 (ranging from PD35 to 45), were tested in the Morris water maze (Morris, 1984) consisting of a circular pool (120 cm in diameter, 60 cm in height) filled with water (∼40 cm deep at 20°C). A hidden circular escape platform was located at the center of one of the four pool quadrants, away from the pool wall and submerged ∼0.8–1.0 cm. All offspring were tested over seven consecutive days, during which the escape platform remained in the same location in the pool. On each day, the animals received four trials, with a 5-min period between blocks. For each day, four start positions from the four cardinal compass points were used. A trial commenced with the animal being placed into the pool facing the pool wall. The animal was allowed a maximum of 90 s to locate and mount the escape platform. After climbing onto the platform, the animal remained there for 10 s before the commencement of the next trial. Animals that failed to locate the platform within the 90 s were placed on the platform for 10 s before the commencement of the next trial. The latency to reach the hidden platform was measured, and each trial was videotaped with a camera mounted directly above the pool. On the eighth day, each animal was tested for 60 s in a probe trial, in which the platform was removed from the pool.

Open-field spontaneous activity test

Locomotor activity in the open-field test was evaluated on PD35 mice. A clear plastic rectangular arena (100 × 100×30 cm) was placed in a sound attenuated room. Testing was conducted under red lighting conditions between 7:00 p.m. and 10:00 p.m. The floor of the arena was divided into 25 squares (each lattice 20 × 20 cm) without any covering material. All tests started with the individual animals being initially placed in the centre of the arena. During one 5-min session, the frequency, duration and latency of behavioral characteristics were measured.

Statistical analysis

The data for pregnancy outcome variables, locomotor activity, Morris water maze and embryo size, expressed as mean ± SD were analyzed by one-way analysis of variance (ANOVA), followed by Scheff’s multiple comparison test. The data for morphological score were analyzed by Kruskal–Wallis test. Relative gene expression was analyzed by one-way ANOVA. In addition, the data for embryotoxicity, reported as the number of occurrences, were analyzed using generalized linear model based on Poisson distribution or χ2 test. Differences were considered to be statistically significant when P < 0.05.

Results

Maternal blood ethanol levels, pregnancy outcome and embryotoxicity

The mean maternal blood ethanol concentrations in pregnant mice treated with 2.0, 4.0 or 6.0 g/kg/day ethanol were 0.29 ± 0.14, 1.25 ± 0.28 and 2.50 ± 0.24 mg/ml, respectively. Ethanol was not detected in the blood of pregnant mice treated with distilled water or maltose/dextrin. Food consumption of mice treated with distilled water was slightly higher than that of mice treated with maltose/dextrin or alcohol, but there was no significant difference in food intake among the groups with maltose, dextrin or alcohol (data not shown).

The pregnancy outcome data are presented in Table II. There was no evidence of maternal or fetal toxicity in the pregnant mice that received water or isocaloric-maltose/dextrin. Maternal death and spontaneous miscarriage increased with increasing ethanol dosage. There were three incidences of spontaneous miscarriage and one incidence of maternal death in the high ethanol dose group, and one incidence of spontaneous miscarriage and two incidences of maternal death in the intermediate-dose group. None of the ethanol dosages exhibited significant effect on maternal brain weight. However, the percentage maternal weight gain and placental weight were significantly lower in the high- and intermediate-dose groups compared with mice treated with water or maltose/dextrin. In addition, the litter size and weight, head length, crown-rump length, tail length, fetus weight, and fetus brain weight in high-dose group were significantly decreased compared with mice treated with water or maltose/dextrin-treated. Only the head length and fetus weight in intermediate-dose group were shown to be lower than the maltose/dextrin-treated group.

Table II

Effects of maternal administration of ethanol, isocaloric-maltose/dextrin or water between gestation day (GD) 6 and GD15, on pregnancy outcome in mice

Pregnancy outcome variable Treatment
 
Distilled water Maltose/dextrin Low ethanol dose (12.67% v/v) Intermediate ethanol dose (25.34% v/v) High ethanol dose (38.01% v/v) 
N 21 21 19 22 24 
Maternal death 
Spontaneous miscarriage 
Maternal data 
 Maternal weight gain (%) 60.44 ± 15.14 52.34 ± 11.42* 53.92 ± 7.56* 47.42 ± 8.64** 38.57 ± 8.64**▴▴ 
 Maternal brain weight (g) 0.42 ± 0.01 0.41 ± 0.03 0.42 ± 0.03 0.40 ± 0.04 0.41 ± 0.03 
 Placental weight (g) 0.12 ± 0.01 0.11 ± 0.01 0.11 ± 0.01 0.11 ± 0.01* 0.10 ± 0.01**▴▴ 
Fetal data 
 No. litters 20 20 19 19 20 
 Litter size 7.75 ± 0.82 7.35 ± 0.63 7.89 ± 0.45 7.02 ± 0.57 6.05 ± 0.36* 
 Litter weight (g) 8.45 ± 1.53 9.34 ± 1.21 9.15 ± 1.25 7.77 ± 2.79 6.07 ± 1.56**▴▴ 
Head length (mm) 0.95 ± 0.05 0.95 ± 0.05 0.92 ± 0.02 0.90 ± 0.04* 0.84 ± 0.04**▴▴ 
Crown-rump length (mm) 1.89 ± 0.14 1.89 ± 0.09 1.89 ± 0.06 1.82 ± 0.07 1.68 ± 0.06**▴▴ 
Tail length (mm) 0.96 ± 0.09 0.98 ± 0.04 0.97 ± 0.03 0.98 ± 0.21 0.87 ± 0.07**▴▴ 
Fetus weight (g) 0.81 ± 0.09 0.85 ± 0.10 0.83 ± 0.08 0.78 ± 0.08 0.63 ± 0.08**▴▴ 
Fetus brain weight (g) 0.06 ± 0.01 0.06 ± 0.01 0.05 ± 0.01 0.06 ± 0.02 0.05 ± 0.01* 
Pregnancy outcome variable Treatment
 
Distilled water Maltose/dextrin Low ethanol dose (12.67% v/v) Intermediate ethanol dose (25.34% v/v) High ethanol dose (38.01% v/v) 
N 21 21 19 22 24 
Maternal death 
Spontaneous miscarriage 
Maternal data 
 Maternal weight gain (%) 60.44 ± 15.14 52.34 ± 11.42* 53.92 ± 7.56* 47.42 ± 8.64** 38.57 ± 8.64**▴▴ 
 Maternal brain weight (g) 0.42 ± 0.01 0.41 ± 0.03 0.42 ± 0.03 0.40 ± 0.04 0.41 ± 0.03 
 Placental weight (g) 0.12 ± 0.01 0.11 ± 0.01 0.11 ± 0.01 0.11 ± 0.01* 0.10 ± 0.01**▴▴ 
Fetal data 
 No. litters 20 20 19 19 20 
 Litter size 7.75 ± 0.82 7.35 ± 0.63 7.89 ± 0.45 7.02 ± 0.57 6.05 ± 0.36* 
 Litter weight (g) 8.45 ± 1.53 9.34 ± 1.21 9.15 ± 1.25 7.77 ± 2.79 6.07 ± 1.56**▴▴ 
Head length (mm) 0.95 ± 0.05 0.95 ± 0.05 0.92 ± 0.02 0.90 ± 0.04* 0.84 ± 0.04**▴▴ 
Crown-rump length (mm) 1.89 ± 0.14 1.89 ± 0.09 1.89 ± 0.06 1.82 ± 0.07 1.68 ± 0.06**▴▴ 
Tail length (mm) 0.96 ± 0.09 0.98 ± 0.04 0.97 ± 0.03 0.98 ± 0.21 0.87 ± 0.07**▴▴ 
Fetus weight (g) 0.81 ± 0.09 0.85 ± 0.10 0.83 ± 0.08 0.78 ± 0.08 0.63 ± 0.08**▴▴ 
Fetus brain weight (g) 0.06 ± 0.01 0.06 ± 0.01 0.05 ± 0.01 0.06 ± 0.02 0.05 ± 0.01* 

Offspring were evaluated at GD17.5. Data for maternal death, spontaneous miscarriage and pregnant mice/litters are reported as the number of occurrences. Other pregnancy outcome variables mean ± SD of average littermate values for the individual litters. Percentage maternal weight gain was calculated as maternal weight at GD17.5d minus maternal weight at GD6d, divided by maternal weight at GD6d. The data are analyzed by one-way ANOVA, followed by Scheff’s multiple comparison test. *P < 0.05; **P < 0.01 (versus water-treated mice); P < 0.05; ▴▴P < 0.01 (versus maltose/dextrin-treated mice).

The fetal embryotoxicity and gross abnormality data at GD17.5 following in vivo prenatal alcohol exposure are shown in Table III. Ethanol exposure in utero retarded fetal growth, and exencephaly and cryptophthalmos were found in the ethanol-treated groups (Fig. 1B and C). We performed the analysis using a generalized linear model based on Poisson distribution for the embryotoxicity and gross abnormality data (Table III). After running the generalized linear model analysis, we found that (i) embryo resorption in mice exposed to the high dose of ethanol was significantly higher than that in mice without ethanol exposure; (ii) increasing the ethanol dose significantly increased the number of fetal deaths and (iii) exencephaly in the high-dose ethanol group was higher than the control groups.

Figure 1

Effects of ethanol treatment on fetus/embryo development in vivo (AC) and in vitro (DL).

The fetuses were at embryonic day (E) 17.5 with (B and C) or without (A) maternal ethanol exposure between gestation day (GD) 6 and GD15. (B) and (C) show exencephaly and cryptophthalmos, respectively. (D) and (E) show the visceral yolk sac of cultured embryos after 48 h with (E) or without (D) ethanol treatment. The visceral yolk sac in control embryos displays well-developed blood vessels, while the visceral yolk sac in embryos with ethanol treatment became thin and less branched. The blood island (BI) is shown with a white arrow. (F–L) illustrate the cultured embryos after 48 h without or with ethanol. (F) shows the normal organs, including heart (HT), forebrain (FB), midbrain (MB), hindbrain (HB), otic (OT), optic (OP) and olfactory organ (OL), branchial arch (BA), forelimb bud (FBD) and hindlimb bud (HBD). The deformities induced by ethanol, such as microcephaly (MC), unclosed neural folds (UNF), forebrain deformity (FD), branchial arch dysplasia (BAD), undifferentiated cardiac tube (UCT) and abnormal turning of embryo (ATE) are indicated with white arrows in (G–L), respectively. Scale bars: in (C) for plates (A–C), 2.5 mm; in (E) for plates (D and E), 1 mm; in (L) for plates (F–L), 1 mm.

Figure 1

Effects of ethanol treatment on fetus/embryo development in vivo (AC) and in vitro (DL).

The fetuses were at embryonic day (E) 17.5 with (B and C) or without (A) maternal ethanol exposure between gestation day (GD) 6 and GD15. (B) and (C) show exencephaly and cryptophthalmos, respectively. (D) and (E) show the visceral yolk sac of cultured embryos after 48 h with (E) or without (D) ethanol treatment. The visceral yolk sac in control embryos displays well-developed blood vessels, while the visceral yolk sac in embryos with ethanol treatment became thin and less branched. The blood island (BI) is shown with a white arrow. (F–L) illustrate the cultured embryos after 48 h without or with ethanol. (F) shows the normal organs, including heart (HT), forebrain (FB), midbrain (MB), hindbrain (HB), otic (OT), optic (OP) and olfactory organ (OL), branchial arch (BA), forelimb bud (FBD) and hindlimb bud (HBD). The deformities induced by ethanol, such as microcephaly (MC), unclosed neural folds (UNF), forebrain deformity (FD), branchial arch dysplasia (BAD), undifferentiated cardiac tube (UCT) and abnormal turning of embryo (ATE) are indicated with white arrows in (G–L), respectively. Scale bars: in (C) for plates (A–C), 2.5 mm; in (E) for plates (D and E), 1 mm; in (L) for plates (F–L), 1 mm.

Table III

Effects of maternal administration of ethanol, isocaloric-maltose/dextrin, or water during GD6-15, on embryotoxicity and gross abnormality of the offspring mice at GD17.5

Embryotoxicity/gross abnormity variable Treatment
 
Distilled water Maltose/dextrin Low ethanol dose (12.67% v/v) Intermediate ethanol dose (25.34% v/v) High ethanol dose (38.01% v/v) 
Litters 20 20 19 19 20 
Implantation sites 159 150 156 139 153 
Live fetuses 155 147 150 133 121 
Resorptions 19*▴▴ 
Dead fetuses 2** 1** 13**▴▴ 
Exencephaly 4* 
Embryotoxicity/gross abnormity variable Treatment
 
Distilled water Maltose/dextrin Low ethanol dose (12.67% v/v) Intermediate ethanol dose (25.34% v/v) High ethanol dose (38.01% v/v) 
Litters 20 20 19 19 20 
Implantation sites 159 150 156 139 153 
Live fetuses 155 147 150 133 121 
Resorptions 19*▴▴ 
Dead fetuses 2** 1** 13**▴▴ 
Exencephaly 4* 

The data are reported as the number of occurrences. Comparisons between groups were carried out by generalized linear model based on the Poisson distribution. *P < 0.05; **P < 0.01 (versus water-treated mice); P < 0.05; ▴▴P < 0.01 (versus maltose/dextrin-treated mice).

Effects of prenatal ethanol exposure on offspring brain development and function

There was no sex difference in the escape latency in the open field test and Morris water maze in any treatment group in this study (data not shown), and therefore the data for the male and female offspring in each treatment group were combined into a single treatment group for the purpose of analysis.

The open field test revealed a significant difference among the groups for number of crossing, time in the center and number of rearing. The offspring on PD35 from ethanol-treated mice showed significantly lower locomotor activity than maltose/dextrin- or water-treated mice (Table IV). Chronic prenatal exposure to ethanol caused an impairment of task acquisition in the Morris water maze (Fig. 2). This deficit was significant from the second to seventh day of the training phase, while offspring that had been exposed to intermediate-dose and high-dose ethanol throughout gestation required a significantly longer time to reach the hidden platform compared with both maltose/dextrin and water control animals. A probe trial conducted on the eighth day revealed that offspring from ethanol-treated groups spent less time in the platform quadrant looking for the platform and more time in the quadrant opposite the platform compared with maltose/dextrin- and water-treated animals (Fig. 3).

Figure 2

Chronic prenatal ethanol exposure impaired task acquisition in the Morris water maze.

Data are mean ± SD for 24 offspring obtained from at least 16 different litters in each treatment group.

Figure 2

Chronic prenatal ethanol exposure impaired task acquisition in the Morris water maze.

Data are mean ± SD for 24 offspring obtained from at least 16 different litters in each treatment group.

Figure 3

Effects of prenatal ethanol exposure on spatial exploring ability in the Morris water maze of offspring mice on post-natal day (PD) 40.

(A) Time of platform quadrant; (B) Time of quadrant opposite to platform. Data are mean ± SD for 24 offspring obtained from at least 16 different litters in each treatment group and analyzed by one-way ANOVA. *P < 0.05; **P < 0.01 (versus water-treated mice). P < 0.05 (versus maltose/dextrin-treated mice).

Figure 3

Effects of prenatal ethanol exposure on spatial exploring ability in the Morris water maze of offspring mice on post-natal day (PD) 40.

(A) Time of platform quadrant; (B) Time of quadrant opposite to platform. Data are mean ± SD for 24 offspring obtained from at least 16 different litters in each treatment group and analyzed by one-way ANOVA. *P < 0.05; **P < 0.01 (versus water-treated mice). P < 0.05 (versus maltose/dextrin-treated mice).

Table IV

Effects of maternal administration of ethanol between GD6 and GD15, on locomotor activity of offspring mice on PD35

Locomotor activity variable Treatment
 
Distilled water (n = 22) Maltose/dextrin (n=22) Low ethanol dose (12.67% v/v, n = 21) Intermediate ethanol dose (25.34% v/v, n = 22) High ethanol dose (38.01% v/v, n=21) 
Number of crossing 132.18 ± 29.58 134.77 ± 24.71 112.23 ± 34.51*▴▴ 114.57 ± 22.35* 106.27 ± 24.63**▴▴ 
Time in the center (s) 68.5 ± 16.97 56.04 ± 13.97 65.36 ± 26.33 50.52 ± 23.3 48.86 ± 14.46** 
Number of rearing 26.5 ± 12.41 32.64 ± 6.05 19.71 ± 11.98▴▴ 21.6 ± 8.59▴▴ 20.36 ± 13.05▴▴ 
Number of grooming 1.73 ± 0.83 1.23 ± 0.61 1.18 ± 0.96 2.7 ± 6.46 1.09 ± 0.75 
Locomotor activity variable Treatment
 
Distilled water (n = 22) Maltose/dextrin (n=22) Low ethanol dose (12.67% v/v, n = 21) Intermediate ethanol dose (25.34% v/v, n = 22) High ethanol dose (38.01% v/v, n=21) 
Number of crossing 132.18 ± 29.58 134.77 ± 24.71 112.23 ± 34.51*▴▴ 114.57 ± 22.35* 106.27 ± 24.63**▴▴ 
Time in the center (s) 68.5 ± 16.97 56.04 ± 13.97 65.36 ± 26.33 50.52 ± 23.3 48.86 ± 14.46** 
Number of rearing 26.5 ± 12.41 32.64 ± 6.05 19.71 ± 11.98▴▴ 21.6 ± 8.59▴▴ 20.36 ± 13.05▴▴ 
Number of grooming 1.73 ± 0.83 1.23 ± 0.61 1.18 ± 0.96 2.7 ± 6.46 1.09 ± 0.75 

The data are mean ± SD and analyzed by one-way ANOVA, followed by Scheff’s multiple comparison test. *P < 0.05; **P < 0.01 (versus water-treated mice); P < 0.05;▴▴P < 0.01 (versus maltose/dextrin-treated mice).

Effects of ethanol exposure on embryonic development in culture

Ethanol exposure in vitro also obstructed the development of mouse embryos (Table V). The visceral yolk sac, a membranous sac attached to the embryo providing early nourishment, was damaged by ethanol: the sac diameter was decreased and the blood island failed to coalesce into a primary vascular plexus, indicating that vasculogenesis is impaired (Fig. 1). The crown-rump length and head length of embryos at E10.5 were significantly reduced in all ethanol-treated groups when compared with the control embryos. Moreover, ethanol-treated embryos had significantly lower scores for 12 scoring items of morphological features compared with the control group. In vitro, ethanol treatment induced several major abnormalities, such as microcephaly, unclosed neural folds, branchial arch dysplasia and undifferentiated cardiac tube (Fig. 1). The number of malformations in the 2.0, 4.0 and 8.0 mg/ml ethanol groups was 5, 16 and 26, respectively, whereas none were observed in the control embryos (Table VI).

Table V

Effects of ethanol on in vitro mouse development at E10.5

Parameter Concentration of ethanol (mg/ml)
 
0 (n = 24) 2.0 (n = 22) 4.0 (n = 25) 8.0 (n = 26) 
Yolk sac diameter (mm) 5.33 ± 0.66 4.95 ± 1.37 4.70 ± 1.11 3.24 ± 0.82** 
Crown-rump length (mm) 4.48 ± 0.36 3.36 ± 0.64** 3.11 ± 0.66** 2.77 ± 0.53** 
Head-length (mm) 2.43 ± 0.39 1.90 ± 40.5** 1.50 ± 70.4** 1.25 ± 0.38** 
Morphological score 
 Flexion 4.96 ± 0.2 4.09 ± 0.87** 2.72 ± 1.28** 1.65 ± 0.98** 
 Heart 3.88 ± 0.95 3.55 ± 0.74 2.8 ± 0.71** 2.08 ± 0.69** 
 Neural tube 4.38 ± 1.06 3.91 ± 0.87* 3.08 ± 1.26** 1.69 ± 1.19** 
 Hindbrain 4.92 ± 0.28 3.64 ± 1.09** 2.96 ± 1.06** 1.85 ± 0.97** 
 Midbrain 4.83 ± 0.56 4.18 ± 0.91** 3.44 ± 1.19** 1.96 ± 0.82** 
 Forebrain 4.96 ± 0.2 4.23 ± 0.87** 3.481 ± .16** 2.00 ± 0.80** 
 Optic organ 4.04 ± 1.2 3.59 ± 0.59* 2.24 ± 0.97** 1.15 ± 0.73** 
 Otic organ 4.21 ± 1.5 3.77 ± 1.31 2.4 ± 0.87** 1.50 ± 0.99** 
 Olfactory organ 2.08 ± 0.78 1.55 ± 0.6** 1.28 ± 1.17* 1.00 ± 0.63** 
 Branchial arch 3.17 ± 0.48 3.00 ± 0.00 2.04 ± 0.93** 1.27 ± 0.96** 
 Forelimb bud 3.00 ± 0.78 2.86 ± 0.35 1.88 ± 1.27** 1.31 ± 0.97** 
 Hindlimb bud 2.67 ± 0.7 1.82 ± 0.39** 0.92 ± 0.76** 0.58 ± 0.76** 
Parameter Concentration of ethanol (mg/ml)
 
0 (n = 24) 2.0 (n = 22) 4.0 (n = 25) 8.0 (n = 26) 
Yolk sac diameter (mm) 5.33 ± 0.66 4.95 ± 1.37 4.70 ± 1.11 3.24 ± 0.82** 
Crown-rump length (mm) 4.48 ± 0.36 3.36 ± 0.64** 3.11 ± 0.66** 2.77 ± 0.53** 
Head-length (mm) 2.43 ± 0.39 1.90 ± 40.5** 1.50 ± 70.4** 1.25 ± 0.38** 
Morphological score 
 Flexion 4.96 ± 0.2 4.09 ± 0.87** 2.72 ± 1.28** 1.65 ± 0.98** 
 Heart 3.88 ± 0.95 3.55 ± 0.74 2.8 ± 0.71** 2.08 ± 0.69** 
 Neural tube 4.38 ± 1.06 3.91 ± 0.87* 3.08 ± 1.26** 1.69 ± 1.19** 
 Hindbrain 4.92 ± 0.28 3.64 ± 1.09** 2.96 ± 1.06** 1.85 ± 0.97** 
 Midbrain 4.83 ± 0.56 4.18 ± 0.91** 3.44 ± 1.19** 1.96 ± 0.82** 
 Forebrain 4.96 ± 0.2 4.23 ± 0.87** 3.481 ± .16** 2.00 ± 0.80** 
 Optic organ 4.04 ± 1.2 3.59 ± 0.59* 2.24 ± 0.97** 1.15 ± 0.73** 
 Otic organ 4.21 ± 1.5 3.77 ± 1.31 2.4 ± 0.87** 1.50 ± 0.99** 
 Olfactory organ 2.08 ± 0.78 1.55 ± 0.6** 1.28 ± 1.17* 1.00 ± 0.63** 
 Branchial arch 3.17 ± 0.48 3.00 ± 0.00 2.04 ± 0.93** 1.27 ± 0.96** 
 Forelimb bud 3.00 ± 0.78 2.86 ± 0.35 1.88 ± 1.27** 1.31 ± 0.97** 
 Hindlimb bud 2.67 ± 0.7 1.82 ± 0.39** 0.92 ± 0.76** 0.58 ± 0.76** 

The data are mean ± SD Yolk sac diameter, crown-rump length, and head-length are analyzed by one-way ANOVA, followed by Scheff’s multiple comparison test. Morphological score data are analyzed by Kruskal–Wallis H. *P < 0.05; **P < 0.01, compared with control group.

Table VI

Frequency and distribution of the observed abnormalities of embryos induced by ethanol at E10.5

Parameter Concentration of ethanol (mg/ml)
 
2.0 4.0 8.0 
Examined embryos 24 22 25 26 
Abnormal embryos 5* 16** 26** 
Microcephaly 7* 
Unclosed neural folds 5* 9** 15** 
branchial arch dysplasia 7* 13** 
Undifferentiated cardiac tube 8* 
Parameter Concentration of ethanol (mg/ml)
 
2.0 4.0 8.0 
Examined embryos 24 22 25 26 
Abnormal embryos 5* 16** 26** 
Microcephaly 7* 
Unclosed neural folds 5* 9** 15** 
branchial arch dysplasia 7* 13** 
Undifferentiated cardiac tube 8* 

The data are reported as the number of occurrences. Comparisons between groups were carried out by χ2 test. *P < 0.05; **P < 0.01, compared with control group (0 mg/ml ethanol).

Expression pattern of miRNAs in fetal mouse brain exposed to ethanol

To identify miRNAs that may play a role in FAS/ARND, the expression levels of 509 mature miRNAs were analyzed in fetal brains from mice with prenatal ethanol- or water treatment. The microarray analysis demonstrated that six miRNA genes were significantly overexpressed (fold change >1.5), and eight miRNA genes were significantly underexpressed (fold change <0.67) in fetal mouse brains with prenatal ethanol exposure. Of the screened miRNAs, miR-10a, miR-10b, miR-9, miR-145, miR-30a-3p and miR-152 were up-regulated, whereas miR-200a, miR-496, miR-296, miR-30e-5p, miR-362, miR-339, miR-29c and miR-154 were down-regulated (Table VII). miR-10a and miR-10b showed the greatest overexpression in ethanol-exposed fetal mouse brain, with 2.88 and 2.38-fold increases, respectively, compared with control mice.

Table VII

Differentially expressed miRNAs in fetal mouse brain after exposure to ethanol in uterus from GD6 to GD15

miRNA Fold change q-value Local false discovery rates (%) 
Overexpression 
 miR-10a 2.88 1.2 × 10−5 
 miR-10b 2.38 1.0 × 10−5 0.06 
 miR-9 1.91 6.2 × 10−6 2.13 
 miR-145 1.79 3.1 × 10−5 0.06 
 miR-30a-3p 1.74 2.2 × 10−5 0.1 
 miR-152 1.73 1.5 × 10−6 
Underexpression 
 miR-200a 0.48 9.3 × 10−7 0.51 
 miR-496 0.49 3.2 × 10−5 
 miR-296 0.62 1.5 × 10−5 
 miR-30e-5p 0.63 1.2 × 10−6 
 miR-362 0.64 4.7 × 10−5 
 miR-339 0.64 6.4 × 10−6 
 miR-29c 0.65 6.2 × 10−5 
 miR-154 0.65 4.4 × 10−5 
miRNA Fold change q-value Local false discovery rates (%) 
Overexpression 
 miR-10a 2.88 1.2 × 10−5 
 miR-10b 2.38 1.0 × 10−5 0.06 
 miR-9 1.91 6.2 × 10−6 2.13 
 miR-145 1.79 3.1 × 10−5 0.06 
 miR-30a-3p 1.74 2.2 × 10−5 0.1 
 miR-152 1.73 1.5 × 10−6 
Underexpression 
 miR-200a 0.48 9.3 × 10−7 0.51 
 miR-496 0.49 3.2 × 10−5 
 miR-296 0.62 1.5 × 10−5 
 miR-30e-5p 0.63 1.2 × 10−6 
 miR-362 0.64 4.7 × 10−5 
 miR-339 0.64 6.4 × 10−6 
 miR-29c 0.65 6.2 × 10−5 
 miR-154 0.65 4.4 × 10−5 

Analyses were carried out at GD17.5.

Northern blot assay for miR-10a and miR-10b in embryo brains was performed to verify the results obtained from miRNA chip analysis. Overexpression of miR-10a and miR-10b in ethanol-exposed mouse brain samples versus control was confirmed (Fig. 4A and B). Because mouse miR-10a and miR-10b differ by only a single nucleotide, they probably both hybridize to the probes used for the northern blot analysis, and our data for the expression of miR-10a and miR-10b in mouse brain might represent the combined pattern of these miRNAs. Both microarray and northern blot analysis could not discriminate a single-nucleotide difference. To avoid false positives, we used real-time PCR for further validation of the results obtained from microarray and northern blot analysis, and this confirmed the up-regulation of miR-10a and miR-10b in brains from mice with prenatal ethanol exposure (Fig. 4C and D).

Figure 4

Northern blots (A and B) and real-time PCR (C and D) validation of microarray analysis data in mouse brain after prenatal ethanol exposure.

Northern blots of total RNA obtained from embryo brain tissue (with or without ethanol exposure) hybridized with the probe for miR-10a and miR-10b. U6 small nuclear (Sn)RNA was used as RNA loading control. Real-time PCR analysis of miR-10a (C) and miR-10b (D) using total RNA obtained from ethanol exposure and non-exposure embryo brain tissue. Data are mean ± SD from three determinations. *P < 0.05; **P < 0.01 (versus with water-treated mice). P < 0.05; ▴▴P < 0.01 (versus with maltose/dextrin-treated mice).

Figure 4

Northern blots (A and B) and real-time PCR (C and D) validation of microarray analysis data in mouse brain after prenatal ethanol exposure.

Northern blots of total RNA obtained from embryo brain tissue (with or without ethanol exposure) hybridized with the probe for miR-10a and miR-10b. U6 small nuclear (Sn)RNA was used as RNA loading control. Real-time PCR analysis of miR-10a (C) and miR-10b (D) using total RNA obtained from ethanol exposure and non-exposure embryo brain tissue. Data are mean ± SD from three determinations. *P < 0.05; **P < 0.01 (versus with water-treated mice). P < 0.05; ▴▴P < 0.01 (versus with maltose/dextrin-treated mice).

Hox gene expression

Both miR-10a and miR-10b are close to the Hox cluster: miR-10a gene is adjacent to the Hoxb4 and Hoxb5 genes in the Hoxb cluster; miR-10b is embedded in Hoxd3 and Hoxd4 genes in the Hoxd cluster (http://www.ensembl.org). The relative positions of miR-10a and Hoxb, miR-10b and Hoxd suggest that common elements probably regulate these paralog clusters. It has been reported that miR-10a and miR-10b are expressed in Hox-like patterns in mouse embryos (Mansfield et al., 2004). miR-10a is predicted to target Hoxa1, Hoxa3 and Hoxd10, by three target prediction algorithms, including MIRANDA (http://www.microrna.org/miranda/new.html), TARGETSCAN (http://genes.mit.edu/targetscan) and PICTAR (http://pictar.bio.nyu.edu). To determine whether miR-10 affected the expression of the Hox genes, RT–PCR was performed and we showed that Hoxd3, Hoxd4, Hoxb4 and Hoxb5 in brain samples from mice with ethanol exposure were all up-regulated (Fig. 5).

Figure 5

Effects of ethanol treatment on the expression of miR-10a (A), miR-10b (B), Hoxb5 and Hoxb4 (C and D), and Hoxd3 and Hoxd4 (E and F) in E10.5 mouse brains after ethanol exposure.

The level of miR-10 and Hox mRNAs were determined by real-time RT–PCR. β-actin was used as control of RNA loading. Data are mean ± SD from three determinations. *P < 0.01, compared with control (by χ2 test).

Figure 5

Effects of ethanol treatment on the expression of miR-10a (A), miR-10b (B), Hoxb5 and Hoxb4 (C and D), and Hoxd3 and Hoxd4 (E and F) in E10.5 mouse brains after ethanol exposure.

The level of miR-10 and Hox mRNAs were determined by real-time RT–PCR. β-actin was used as control of RNA loading. Data are mean ± SD from three determinations. *P < 0.01, compared with control (by χ2 test).

To investigate the potential interaction of miR-10 with Hoxa1, the mRNA and protein levels of Hoxa1 were also examined in embryo brains after ethanol exposure by RT–PCR and western blot analysis (Fig. 6). We found that the Hoxa1 protein was down-regulated in brain samples with prenatal ethanol exposure whereas mRNA levels for Hoxa1 in ethanol-treated mice did not change. A previous study has showed that Hoxa1 is expressed in mouse embryos as early as E7.5, and by E8.0 Hoxa1 is found in the developing nervous system to an anterior limit between rhombomeres 3 and 4, then its expression subsequently decreases posteriorly and by E8.5 of development, Hoxa1 is no longer expressed in the hindbrain or associated mesoderm (Murphy and Hill, 1991). In contrast to these results, we found that Hoxa1 was detectable in E8.5 and E10.5 embryo (data not shown) and E17.5 fetus brains with gradually declining expression, and Hoxa1 expression at E17.5 was very weak. As illustrated in Fig. 7, the immunohistochemical signals revealed Hoxa1 protein expression in embryos at E10.5, and that the number of Hoxa1-positive cells was significantly lower in fetal mouse brain after prenatal ethanol exposure (43.2 ± 8.5) than control group (116.1 ± 12.7, P < 0.05, Student’s t-test). In addition, there was no significant difference in the expression of Hoxa1 in the heart and other tissues between ethanol-treated and control mice.

Figure 6

Effects of ethanol treatment on the expression of Hoxa1 in E10.5 and E17.5 mouse brain after ethanol exposure.

The mRNA (A and B: E10.5; E and F: E17.5) and protein (C and D: E10.5; G and H: 17.5) levels were determined by real-time RT–PCR and western blotting, respectively. Plates (I and J) show the mRNA levels of Hoxa3 and Hoxd10 in E10.5 mouse brain after ethanol exposure. β-Actin was used as control for RNA or protein sample loading.

Figure 6

Effects of ethanol treatment on the expression of Hoxa1 in E10.5 and E17.5 mouse brain after ethanol exposure.

The mRNA (A and B: E10.5; E and F: E17.5) and protein (C and D: E10.5; G and H: 17.5) levels were determined by real-time RT–PCR and western blotting, respectively. Plates (I and J) show the mRNA levels of Hoxa3 and Hoxd10 in E10.5 mouse brain after ethanol exposure. β-Actin was used as control for RNA or protein sample loading.

Figure 7

Immunohistochemical analysis of Hoxa1 expression in normal (A and C) and ethanol-treated mouse brain (B and D).

Immunohistochemical staining (brown) for Hoxa1 on E10.5 embryo sagittal sections was conducted, with hematoxylin counterstaining (blue). Cells positive for Hoxa1 expression are indicated by black arrows in (C) and (D). HB, hindbrain; HT, heart; BA, branchial arch. Scale bars: in (A) for (A and B), 350 µm; in (C) for (C and D), 35 µm.

Figure 7

Immunohistochemical analysis of Hoxa1 expression in normal (A and C) and ethanol-treated mouse brain (B and D).

Immunohistochemical staining (brown) for Hoxa1 on E10.5 embryo sagittal sections was conducted, with hematoxylin counterstaining (blue). Cells positive for Hoxa1 expression are indicated by black arrows in (C) and (D). HB, hindbrain; HT, heart; BA, branchial arch. Scale bars: in (A) for (A and B), 350 µm; in (C) for (C and D), 35 µm.

FA supplementation inhibits ethanol-induced teratogenesis

FA supplementation showed an apparent inhibitory effect on ethanol-induced teratogenesis at E10.5 in vitro (Table VIII). Yolk sac diameter, crown-rump length and head length were significantly increased in the FA groups compared with mice treated with ethanol alone. Moreover, with FA supplementation morphological scores were significantly higher than ethanol-treated mice. In addition, the observed abnormalities of embryos in the FA supplementation groups were significantly reduced compared with mice receiving ethanol only (Table IX).

Table VIII

Effects of FA supplementation on embryonic development at E10.5 in vitro, treated with 4.0 mg/ml ethanol

Parameter Concentration of FA (mmol/l)
 
0 (n = 21) 0.01 (n = 19) 0.1 (n = 20) 1 (n = 23) 
Yolk sac diameter (mm) 4.79 ± 1.07 4.83 ± 0.98 4.87 ± 0.83 5.52 ± 1.29* 
Crown-rump length (mm) 3.05 ± 0.7 3.36 ± 0.72 4.09 ± 0.62** 4.17 ± 0.79** 
Head-length (mm) 1.44 ± 0.28 1.81 ± 0.52* 2.19 ± 0.56** 2.22 ± 0.53** 
Morphological score 
 Flexion 2.62 ± 1.24 3.16 ± 0.96 3.55 ± 0.83 4 ± 0.74** 
 Heart 2.9 ± 0.54 2.89 ± 0.66 3.1 ± 0.79 3.48 ± 0.59* 
 Neural tube 2.86 ± 1.11 3.26 ± 0.73 3.6 ± 0.75* 4.26 ± 0.62** 
 Hindbrain 2.76 ± 1.14 3.21 ± 0.85 3.65 ± 0.75* 4.13 ± 1.01** 
 Midbrain 2.81 ± 1.08 3.32 ± 0.82 3.6 ± 0.88* 4.22 ± 0.8** 
 Forebrain 2.81 ± 1.17 3.21 ± 0.85 3.55 ± 0.83* 4.22 ± 0.74** 
 Optic organ 2.05 ± 0.97 2.11 ± 0.81 2.4 ± 0.94 3.87 ± 0.97** 
 Otic organ 2.14 ± 1.24 2.63 ± 1.26 2.95 ± 1.23 3.91 ± 0.95** 
 Olfactory organ 1.43 ± 0.98 1.89 ± 0.99 2.05 ± 0.83 2.13 ± 0.46 
 Branchial arch 2.00 ± 1.00 2.63 ± 0.68* 2.75 ± 0.44* 2.87 ± 0.34** 
 Forelimb bud 1.81 ± 1.36 2.32 ± 0.89 2.6 ± 0.68 2.83 ± 0.49* 
 Hindlimb bud 1.05 ± 0.97 1.47 ± 0.77 1.65 ± 0.67 2.22 ± 0.52** 
Parameter Concentration of FA (mmol/l)
 
0 (n = 21) 0.01 (n = 19) 0.1 (n = 20) 1 (n = 23) 
Yolk sac diameter (mm) 4.79 ± 1.07 4.83 ± 0.98 4.87 ± 0.83 5.52 ± 1.29* 
Crown-rump length (mm) 3.05 ± 0.7 3.36 ± 0.72 4.09 ± 0.62** 4.17 ± 0.79** 
Head-length (mm) 1.44 ± 0.28 1.81 ± 0.52* 2.19 ± 0.56** 2.22 ± 0.53** 
Morphological score 
 Flexion 2.62 ± 1.24 3.16 ± 0.96 3.55 ± 0.83 4 ± 0.74** 
 Heart 2.9 ± 0.54 2.89 ± 0.66 3.1 ± 0.79 3.48 ± 0.59* 
 Neural tube 2.86 ± 1.11 3.26 ± 0.73 3.6 ± 0.75* 4.26 ± 0.62** 
 Hindbrain 2.76 ± 1.14 3.21 ± 0.85 3.65 ± 0.75* 4.13 ± 1.01** 
 Midbrain 2.81 ± 1.08 3.32 ± 0.82 3.6 ± 0.88* 4.22 ± 0.8** 
 Forebrain 2.81 ± 1.17 3.21 ± 0.85 3.55 ± 0.83* 4.22 ± 0.74** 
 Optic organ 2.05 ± 0.97 2.11 ± 0.81 2.4 ± 0.94 3.87 ± 0.97** 
 Otic organ 2.14 ± 1.24 2.63 ± 1.26 2.95 ± 1.23 3.91 ± 0.95** 
 Olfactory organ 1.43 ± 0.98 1.89 ± 0.99 2.05 ± 0.83 2.13 ± 0.46 
 Branchial arch 2.00 ± 1.00 2.63 ± 0.68* 2.75 ± 0.44* 2.87 ± 0.34** 
 Forelimb bud 1.81 ± 1.36 2.32 ± 0.89 2.6 ± 0.68 2.83 ± 0.49* 
 Hindlimb bud 1.05 ± 0.97 1.47 ± 0.77 1.65 ± 0.67 2.22 ± 0.52** 

The data are mean ± SD Yolk sac diameter, crown-rump length, and head-length are analyzed by one-way ANOVA, followed by Scheff’s multiple comparison test. Morphological score data are analyzed by Kruskal–Wallis test. *P < 0.05; **P < 0.01 (compared with 0 mmol/l control group). FA, folic acid.

Table IX

Effects of FA supplementation on observed abnormalities induced in embryos at E10.5 by ethanol in vitro

Parameter Concentration of FA (mmol/l)
 
0 (n = 21) 0.01 (n = 19) 0.1 (n = 20) 1 (n = 23) 
Examined embryos 21 19 20 23 
Abnormal embryos 14 11 6* 7* 
Microcephaly 
Unclosed neural folds 3* 
branchial arch dysplasia 
Undifferentiated cardiac tube 
Parameter Concentration of FA (mmol/l)
 
0 (n = 21) 0.01 (n = 19) 0.1 (n = 20) 1 (n = 23) 
Examined embryos 21 19 20 23 
Abnormal embryos 14 11 6* 7* 
Microcephaly 
Unclosed neural folds 3* 
branchial arch dysplasia 
Undifferentiated cardiac tube 

The data are reported as the number of occurrences. Comparisons between groups were carried out by χ2 test. *P < 0.05 (compared with 0 mmol/l control group).

In the blank group, without ethanol or FA, there was moderate expression of miR-10a and Hoxa1. Ethanol tended to induce miR-10a and inhibit the expression of Hoxa1 protein in mouse embryos treated with 4.0 mg/ml ethanol alone (no FA). FA supplementation at 0.01, 0.1 and 1.0 mmol/l resulted in a suppressed miR-10a expression in embryo brain by 33.3,72.8 and 66.3% (both P < 0.01, versus the ethanol/no FA group), respectively (Fig. 8). In contrast, the Hoxa1 protein expression in embryo brain tended to increase by 77.0, 86.0 and 84.4%, respectively, when FA at 0.01, 0.1 or 1.0 mmol/l was co-incubated. FA at all concentrations did not alter the level of Hoxa1 mRNA.

Figure 8

Effect of folic acid treatment at 0.01–1.0 mmol/l on miR-10a (A) and Hoxa1 mRNA (B and C) and protein (D and E) expression in mouse embryos in vitro.

The levels of miR-10a and Hoxa1 mRNA in mouse brain were analyzed by real-time RT–PCR and Hoxa1 protein was evaluated by western blotting. β-Actin was used as control for RNA and protein sample loading. Embryos in the blank group received neither ethanol nor folic acid treatment. Data are mean ± SD from three determinations. *P < 0.01, compared with control group.

Figure 8

Effect of folic acid treatment at 0.01–1.0 mmol/l on miR-10a (A) and Hoxa1 mRNA (B and C) and protein (D and E) expression in mouse embryos in vitro.

The levels of miR-10a and Hoxa1 mRNA in mouse brain were analyzed by real-time RT–PCR and Hoxa1 protein was evaluated by western blotting. β-Actin was used as control for RNA and protein sample loading. Embryos in the blank group received neither ethanol nor folic acid treatment. Data are mean ± SD from three determinations. *P < 0.01, compared with control group.

Discussion

Although recent discoveries have pointed to the important roles of some miRNAs in development of diverse organisms, there are still scant data on how miRNAs are linked to birth defects. Discovering the miRNAs and their altered expression patterns during FAS/ARND development may provide insights into the functional roles of these tiny non-coding genes in normal and abnormal individuals. In this study, we have investigated the miRNAs involved in the generation and development of FAS/ARND. We have shown that miR-10a and miR-10b are up-regulated during FAS/ARND development using the prenatal ethanol exposure model (Fig. 4). miR-10a and miR-10b are both embedded in the Hox cluster during evolution, and miR-10a, miR-10b and their ‘host’ Hox genes are often expressed in early embryo development.

Distinct expression patterns of miRNAs in mouse brains exposed to ethanol prenatally were observed in this study. Six overexpressed miRNAs and eight underexpressed miRNAs were discriminated by the microarray analysis. To avoid of false positive results by microarray analysis, the expression microarray data of miR-10a and miR-10b were fully confirmed not only by northern blot and real-time RT–PCR (Fig. 4) but also by two FAS models (in vivo and in vitro Figs 4 and 5A and B). Our study showed that the alterations of miRNA expression induced by ethanol exposure are relatively moderate (<3–4-fold), whereas other studies have demonstrated that miRNAs exhibit dramatic changes (>10-fold) in cancer cells compared with normal cells (He et al., 2005a, b; Kluiver et al., 2006). It is unclear whether the magnitude of miRNA change is associated with cancer pathogenesis staging or the extent of ethanol-induced cellular/organ damage. The concordant expression patterns of miR-10a and miR-10b suggest that they may share similar regulatory mechanisms. However, the study by Sathyan et al. (2007) has found that miR-9, -21, -153 and -335 are significantly suppressed by ethanol in cultured cortical neurons ex vivo, which differs from our results in vivo, probably due to differences in model choice and alcohol exposure. The differential effect of ethanol exposure on cultured cortical neurons and fetal brain reflects the important role of other brain functional cells in ethanol-induced neurotoxicity.

miR-10 was first cloned from D. melanogaster embryos by Lagos-Quintana et al. (2002). Now it is known that miR-10 is also conserved in the Hox clusters of mouse, human, pufferfish, zebrafish, mosquito and red flour beetle (Lagos-Quintana et al., 2003). In mouse and human, the miR-10 gene is present in two variant forms, miR-10a and miR-10b. Mouse miR-10a is located at chromosome 11, while human miR-10a is located at chromosome 17q21. Both mouse and human miR-10a lie upstream of Hoxb4 and are located between Hoxb4 and Hoxb5. Mouse miR-10b is found within intron 4 of Hoxd4, intron 1 of Hoxd3-001 and intron 5 of Hoxd3-002, whereas human miR-10b is between Hoxd4 and Hoxd8. The Hox genes are known to regulate embryonic patterning and organogenesis, and 39 of the Hox genes are located in four separate chromosome clusters, Hoxa, Hoxb, Hoxc and Hoxd. In vertebrates, the Hox genes have been implicated in the patterning of the limbs, vertebrae and craniofacial structures by providing an ordered molecular system of positional values, or ‘Hox code,’ along the antero-posterior axis (Hunt et al., 1991). Given the positional conservation of miR-10 within the Hox clusters (Lagos-Quintana et al., 2003) and the spatial and temporal colinearity of Hox gene expression (Gaunt and Strachan, 1996; Mollard and Dziadek, 1997), miR-10 may play a role in regulating expression of the homeobox gene family, subsequently influencing developmental events.

We determined the expression level of miR-10 by real-time PCR and of Hoxb and Hoxd by RT–PCR simultaneously. Similar expression patterns were found for miR-10a and Hoxb, and also for miR-10b and Hoxd in embryos with different maternal ethanol exposure levels. It has been reported that miR-10a and miR-10b are expressed in Hox-like patterns in mouse embryos (Mansfield et al., 2004). The miR-10a sensor directed high levels of β-galactosidase activity in the head and anterior trunk of E10 d embryos but was down-regulated in the posterior trunk, with an anterior expression limit similar to that of Hoxb4. The similarities between the expression patterns of miR-10a and Hoxb, and miR-10b and Hoxd suggest that miR-10a and miR-10b may play an important role in the teratogenic effect of ethanol in conjunction with the Hox-Hom complex.

The Hox member Hoxa1 was predicted as a putative target gene of miR-10a using several target prediction algorithms. Recently, Garzon et al. (2006) have provided convincing evidence that there is a direct interaction of miR-10a and the 3′-untranslated sequence of the Hoxa1 gene using luciferase reporter assay in vitro, which is further confirmed in vivo by transfecting K562 cells with the pre-miR-10a precursor (Garzon et al., 2006). In mammalian cells, miRNAs are thought to down-regulate the expression of target genes predominantly via post-transcriptional inhibition (Engels and Hutvagner, 2006), instead of transcriptional inhibition. However, Garzon et al. (2006) have observed suppression of Hoxa1 mRNA through miR-10a-mediated pathways. In our experiments, the Hoxa1 protein level analyzed by western blot was reduced in embryos with ethanol exposure (Fig. 6), and the down-regulation of Hoxa1 protein was inversely correlated to the up-regulation of miR-10a in the ethanol-treated embryos, suggesting that miR-10a down-regulated the expression of Hoxa1: however, RT–PCR did not show any changes of Hoxa1 mRNA (Fig. 6), suggesting a post-transcriptional mechanism. Further studies are needed to determine whether post-transcriptional or translational repression, or both, is involved in the down-regulation of the Hoxa1 gene.

A few studies have revealed that miR-10a shows a clear correlation with Hox gene expression, not only in embryogenesis (Mansfield et al., 2004; Woltering and Durston, 2006) but also in primary adult acute myeloid leukemia (Debernardi et al., 2007). It has been shown that miR-10a was down-regulated in in vitro-differentiated megakaryocytes derived from CD34+ hematopoietic progenitors (Garzon et al., 2006), and in the ipsilateral mandibular division of trigeminal ganglion following inflammatory muscle pain (Bai et al., 2007). The function of miR-10a is so far unknown, however, our findings add an important complement for elucidating the role of miR-10a in teratology and disease pathogenesis.

Our study has demonstrated an association of miR-10a with birth defects induced by ethanol. Previous studies have revealed a link between Hoxa1 and birth defects (especially brain defects) (Carpenter et al., 1993; Mark et al., 1993; Krumlauf, 1994). Alterations in the normal pattern of Hox gene expression in embryos result in homeotic transformation and malformation and, frequently, in perinatal lethality (Krumlauf, 1994). The targeted inactivation in mouse Hoxa1 gene, the 3′-end member of Hoxa cluster, leads to numerous developmental defects, including hindbrain deficiencies and abnormal skull ossification, and ultimately, neonatal death (Carpenter et al., 1993; Mark et al., 1993). Numerous studies have demonstrated that the hindbrain defects in Hoxa1 knockout mice result partially from the failure of Hoxb1 to reach its anterior limit of expression at the presumptive rhombomere 3/rhombomere 4 boundary, which initiates a cascade of deregulated gene expression that gives misspecification of the hindbrain compartments from rhombomere 2 to rhombomere 5 (Barrow et al., 2000). Furthermore, the ectopic expression of Hoxa1 in transgenic mice leads to the ectopic activation of Hoxb1 in rhombomere 2, produces anterior abnormalities, including the reorganization of the developing hindbrain, and ultimately results in embryonic death (Zhang et al., 1994). Furthermore, a retinoic acid response element has been discovered in the 3′-enhancer of the Hoxa1 gene (Langston et al., 1997). All these observations highlight the importance of the Hoxa1 gene in development and that down-regulation of Hoxa1 protein is teratogenic, acting through the retinoic acid response element (Thompson et al., 1998).

The miRNAs and Hox genes were determined using both in vivo and in vitro FAS models in the present study. The period from GD6 to 15 for treatment with ethanol in vivo was selected as it has been shown to produce neural teratogenic effects in fetuses, with minimal embryonic/fetal or maternal lethality (Abdollah et al., 1993; Xu et al., 2006). Our experiments in vivo showed that ethanol consumption during pregnancy caused many birth defects that include intrauterine growth retardation, craniofacial dysmorphology and brain abnormality. Our experiment in vitro also showed similar morphological and developmental defects. In spite of some methodological differences, the observed specific morphological effects obtained in the present study are consistent with the previous reports in the literature (Hannigan, 1996; Xu et al., 2006). Various mechanisms by which ethanol consumption leads to FAS have been proposed, but none of them can elucidate it completely. Ethanol affects several physiological reactions that potentially can alter embryogenesis, including metabolism, hypoxia with interrupted blood supply to fetal organs, free radical production and a host of other actions. However, ethanol-induced FAS in humans may also involve interaction of ethanol and pathophysiological factors, such as gender, pregnancy and mental stress (Pohorecky, 1991; Sayal et al., 2007). It has been reported that mental stress can regulate alcohol ingestion and alcohol is involved in reducing anxiety in agoraphobics and improving hand tremor in tremor patients (Pohorecky, 1991).

It has been reported that the miR-10b induced by transcription factor Twist proceeds to inhibit translation of the mRNA encoding Hoxd10, resulting in increased expression of a well-characterized pro-metastatic gene, and the level of miR-10b expression in primary breast carcinomas correlates with clinical progression (Ma et al., 2007). There was no difference in mRNA expression of Hoxd10 in mouse brain between ethanol exposure and non-exposure groups, as analyzed by RT–PCR (data not shown). The relationship between miR-10b and Hoxd10 is not clear and it is unknown how miR-10b interacts with Hoxd10 or what roles they may play in the development of FAS.

It is well known that FA deficiency is linked with some birth defects. Numerous studies have indicated that periconceptional supplementation of FA lowers the rates of neural tube defects, congenital heart disease and cleft lip and palate (Christensen and Rosenblatt, 1995; Eskes, 1997; Scholl and Johnson, 2000). Acute ethanol ingestion induces a marked increase in urinary excretion of FA, while chronic ethanol exposure may deplete serum and hepatic FA, leading to FA deficiency (Mason and Choi, 2005; Schalinske and Nieman, 2005). Alcohol ingestion in animals is known to inhibit FA-mediated methionine synthesis and thereby may interrupt critical methylation processes that are mediated by S-adenosylmethionine (Mason and Choi, 2005). It has been suggested that supplementation of FA can suppress ethanol-induced developmental toxicity. Marsit et al. (2006) have reported that folate deficiency induced alterations in the expression of miRNAs, including hsa-miR-222, hsa-miR-145, hsa-miR-146, hsa-miR-345 and hsa-miR-205, in the human lymphoblast cell line TK-6 grown in folate-deficient medium for 6 days. Overexpression of hsa-miR-222 under folate-deficient conditions was further confirmed in in vivo studies using human peripheral blood cells from individuals with low folate intake. Similar to our study, Marsit et al. (2006) also observed overexpressed miR-145. Different results in Marsit’s study and our study may stem from the use of distinct models and experimental designs. Our study has demonstrated that FA supplementation was protective for mouse embryo exposure to ethanol and inhibited ethanol-induced teratogenesis, together with suppressed miR-10a expression and a tendency for increased Hoxa1 protein, suggesting a potential role of miR-10a and its target genes, such as Hoxa1, in the fetal protective activity of FA. The mechanism for FA’s fetal protective effect is unclear, but may be related to the important role of FA in DNA and RNA synthesis and in the transfer of methyl groups in the amino acid methylation cycle. It is unclear how FA exerts its protective effect via regulation of miR-10a and Hoxa1. FA may elicit its beneficial effect on fetal development via multiple biochemical pathways and molecular targets, and further studies are needed in the future.

In conclusion, this study has established an association between miR-10 and ethanol-induced teratogenesis, suggesting a possible role of miR-10 in the pathogenesis of birth defects induced by ethanol. Moreover, it has also highlighted the negative correlation of miR-10a expression with that of its target gene Hoxa1, suggesting a negative regulation of Hoxa1 by miR-10a. This study also demonstrated a suppression of ethanol-induced teratogenesis by FA supplementation, accompanied by a down-regulation of miR-10a expression. Further research is warranted to explore the role of miR-10a and the Hoxa1 gene, and their interactions, in ethanol-induced birth defects.

Funding

This work was supported by grants from the National Natural Sciences Foundations of People’s Republic of China (No. 30671760 and No. 30271364).

References

Abdollah
S
Catlin
MC
Brien
JF
Ethanol neuro-behavioural teratogenesis in the guinea pig: behavioural dysfunction and hippocampal morphologic change
Can J Physiol Pharmacol
 , 
1993
, vol. 
71
 (pg. 
776
-
782
)
Ambros
V
The functions of animal microRNAs
Nature
 , 
2004
, vol. 
431
 (pg. 
350
-
355
)
Ambros
V
Chen
X
The regulation of genes and genomes by small RNAs
Development
 , 
2007
, vol. 
134
 (pg. 
1635
-
1641
)
Bai
G
Ambalavanar
R
Wei
D
Dessem
D
Downregulation of selective microRNAs in trigeminal ganglion neurons following inflammatory muscle pain
Mol Pain
 , 
2007
, vol. 
3
 pg. 
15
 
Barrow
JR
Stadler
HS
Capecchi
MR
Roles of Hoxa1 and Hoxa2 in patterning the early hindbrain of the mouse
Development
 , 
2000
, vol. 
127
 (pg. 
933
-
944
)
Bartel
DP
MicroRNAs: genomics, biogenesis, mechanism, and function
Cell
 , 
2004
, vol. 
116
 (pg. 
281
-
297
)
Bernstein
E
Kim
SY
Carmell
MA
Murchison
EP
Alcorn
H
Li
MZ
Mills
AA
Elledge
SJ
Anderson
KV
Hannon
GJ
Dicer is essential for mouse development
Nat Genet
 , 
2003
, vol. 
35
 (pg. 
215
-
217
)
Bradford
MM
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding
Anal Biochem
 , 
1976
, vol. 
72
 (pg. 
248
-
254
)
Carpenter
EM
Goddard
JM
Chisaka
O
Manley
NR
Capecchi
MR
Loss of Hox-A1 (Hox-1.6) function results in the reorganization of the murine hindbrain
Development
 , 
1993
, vol. 
118
 (pg. 
1063
-
1075
)
Chen
CZ
Li
L
Lodish
HF
Bartel
DP
MicroRNAs modulate hematopoietic lineage differentiation
Science
 , 
2004
, vol. 
303
 (pg. 
83
-
86
)
Chen
SY
Charness
ME
Wilkemeyer
MF
Sulik
KK
Peptide-mediated protection from ethanol-induced neural tube defects
Dev Neurosci
 , 
2005
, vol. 
27
 (pg. 
13
-
19
)
Cheng
AM
Byrom
MW
Shelton
J
Ford
LP
Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis
Nucleic Acids Res
 , 
2005
, vol. 
33
 (pg. 
1290
-
1297
)
Christensen
B
Rosenblatt
DS
Effects of folate deficiency on embryonic development
Baillieres Clin Haematol
 , 
1995
, vol. 
8
 (pg. 
617
-
637
)
Debernardi
S
Skoulakis
S
Molloy
G
Chaplin
T
Dixon-McIver
A
Young
BD
MicroRNA miR-181a correlates with morphological sub-class of acute myeloid leukaemia and the expression of its target genes in global genome-wide analysis
Leukemia
 , 
2007
, vol. 
21
 (pg. 
912
-
916
)
Du
X
Hamre
KM
Increased cell death in the developing vestibulocochlear ganglion complex of the mouse after prenatal ethanol exposure
Teratology
 , 
2001
, vol. 
64
 (pg. 
301
-
310
)
Engels
BM
Hutvagner
G
Principles and effects of microRNA-mediated post-transcriptional gene regulation
Oncogene
 , 
2006
, vol. 
25
 (pg. 
6163
-
6169
)
Eskes
TK
Folates and the fetus
Eur J Obstet Gynecol Reprod Biol
 , 
1997
, vol. 
71
 (pg. 
105
-
111
)
Garzon
R
Pichiorri
F
Palumbo
T
Iuliano
R
Cimmino
A
Aqeilan
R
Volinia
S
Bhatt
D
Alder
H
Marcucci
G
, et al.  . 
MicroRNA fingerprints during human megakaryocytopoiesis
Proc Natl Acad Sci USA
 , 
2006
, vol. 
103
 (pg. 
5078
-
5083
)
Gaunt
SJ
Strachan
L
Temporal colinearity in expression of anterior Hox genes in developing chick embryos
Dev Dyn
 , 
1996
, vol. 
207
 (pg. 
270
-
280
)
Gibson
UE
Heid
CA
Williams
PM
A novel method for real time quantitative RT–PCR
Genome Res
 , 
1996
, vol. 
6
 (pg. 
995
-
1001
)
Gilliam
DM
Kotch
LE
Dudek
BC
Riley
EP
Ethanol teratogenesis in mice selected for differences in alcohol sensitivity
Alcohol
 , 
1988
, vol. 
5
 (pg. 
513
-
519
)
Gohlke
JM
Griffith
WC
Faustman
EM
A systems-based computational model for dose-response comparisons of two mode of action hypotheses for ethanol-induced neurodevelopmental toxicity
Toxicol Sci
 , 
2005
, vol. 
86
 (pg. 
470
-
484
)
Griffiths-Jones
S
The microRNA Registry
Nucleic Acids Res
 , 
2004
, vol. 
32
 (pg. 
D109
-
D111
)
Gutierrez
CM
Ribeiro
CN
de Lima
GA
Yanaguita
MY
Peres
LC
An experimental study on the effects of ethanol and folic acid deficiency, alone or in combination, on pregnant Swiss mice
Pathology
 , 
2007
, vol. 
39
 (pg. 
495
-
503
)
Hannigan
JH
What research with animals is telling us about alcohol-related neurodevelopmental disorder
Pharmacol Biochem Behav
 , 
1996
, vol. 
55
 (pg. 
489
-
499
)
Hard
ML
Abdolell
M
Robinson
BH
Koren
G
Gene-expression analysis after alcohol exposure in the developing mouse
J Lab Clin Med
 , 
2005
, vol. 
145
 (pg. 
47
-
54
)
Harfe
BD
McManus
MT
Mansfield
JH
Hornstein
E
Tabin
CJ
The RNaseIII enzyme Dicer is required for morphogenesis but not patterning of the vertebrate limb
Proc Natl Acad Sci USA
 , 
2005
, vol. 
102
 (pg. 
10898
-
10903
)
He
H
Jazdzewski
K
Li
W
Liyanarachchi
S
Nagy
R
Volinia
S
Calin
GA
Liu
CG
Franssila
K
Suster
S
, et al.  . 
The role of microRNA genes in papillary thyroid carcinoma
Proc Natl Acad Sci USA
 , 
2005
, vol. 
a 102
 (pg. 
19075
-
19080
)
He
L
Thomson
JM
Hemann
MT
Hernando-Monge
E
Mu
D
Goodson
S
Powers
S
Cordon-Cardo
C
Lowe
SW
Hannon
GJ
, et al.  . 
A microRNA polycistron as a potential human oncogene
Nature
 , 
2005
, vol. 
b 435
 (pg. 
828
-
833
)
Heid
CA
Stevens
J
Livak
KJ
Williams
PM
Real time quantitative PCR
Genome Res
 , 
1996
, vol. 
6
 (pg. 
986
-
994
)
Hunt
P
Gulisano
M
Cook
M
Sham
MH
Faiella
A
Wilkinson
D
Boncinelli
E
Krumlauf
R
A distinct Hox code for the branchial region of the vertebrate head
Nature
 , 
1991
, vol. 
353
 (pg. 
861
-
864
)
Jin
P
Zarnescu
DC
Ceman
S
Nakamoto
M
Mowrey
J
Jongens
TA
Nelson
DL
Moses
K
Warren
ST
Biochemical and genetic interaction between the fragile X mental retardation protein and the microRNA pathway
Nat Neurosci
 , 
2004
, vol. 
7
 (pg. 
113
-
117
)
Kanellopoulou
C
Muljo
SA
Kung
AL
Ganesan
S
Drapkin
R
Jenuwein
T
Livingston
DM
Rajewsky
K
Dicer-deficient mouse embryonic stem cells are defective in differentiation and centromeric silencing
Genes Dev
 , 
2005
, vol. 
19
 (pg. 
489
-
501
)
Karp
X
Ambros
V
Developmental biology. Encountering microRNAs in cell fate signaling
Science
 , 
2005
, vol. 
310
 (pg. 
1288
-
1289
)
Kluiver
J
Haralambieva
E
de Jong
D
Blokzijl
T
Jacobs
S
Kroesen
BJ
Poppema
S
van den Berg
A
Lack of BIC and microRNA miR-155 expression in primary cases of Burkitt lymphoma
Genes Chromosomes Cancer
 , 
2006
, vol. 
45
 (pg. 
147
-
153
)
Krumlauf
R
Hox genes in vertebrate development
Cell
 , 
1994
, vol. 
78
 (pg. 
191
-
201
)
Lagos-Quintana
M
Rauhut
R
Yalcin
A
Meyer
J
Lendeckel
W
Tuschl
T
Identification of tissue-specific microRNAs from mouse
Curr Biol
 , 
2002
, vol. 
12
 (pg. 
735
-
739
)
Lagos-Quintana
M
Rauhut
R
Meyer
J
Borkhardt
A
Tuschl
T
New microRNAs from mouse and human
Rna
 , 
2003
, vol. 
9
 (pg. 
175
-
179
)
Langston
AW
Thompson
JR
Gudas
LJ
Retinoic acid-responsive enhancers located 3′ of the Hox A and Hox B homeobox gene clusters. Functional analysis
J Biol Chem
 , 
1997
, vol. 
272
 (pg. 
2167
-
2175
)
Lee
RC
Ambros
V
An extensive class of small RNAs in Caenorhabditis elegans
Science
 , 
2001
, vol. 
294
 (pg. 
862
-
864
)
Li
L
Zhang
Z
Han
J
Xu
Y
Effects of vitamin B12 on ethanol-induced mouse embryonic abnormality in vitro
Wei Sheng Yan Jiu
 , 
2007
, vol. 
36
 (pg. 
178
-
181
)
Livy
DJ
Parnell
SE
West
JR
Blood ethanol concentration profiles: a comparison between rats and mice
Alcohol
 , 
2003
, vol. 
29
 (pg. 
165
-
171
)
Ma
L
Teruya-Feldstein
J
Weinberg
RA
Tumour invasion and metastasis initiated by microRNA-10b in breast cancer
Nature
 , 
2007
, vol. 
449
 (pg. 
682
-
688
)
Manning
MA
Eugene Hoyme
H
Fetal alcohol spectrum disorders: a practical clinical approach to diagnosis
Neurosci Biobehav Rev
 , 
2007
, vol. 
31
 (pg. 
230
-
238
)
Mansfield
JH
Harfe
BD
Nissen
R
Obenauer
J
Srineel
J
Chaudhuri
A
Farzan-Kashani
R
Zuker
M
Pasquinelli
AE
Ruvkun
G
, et al.  . 
MicroRNA-responsive ‘sensor’ transgenes uncover Hox-like and other developmentally regulated patterns of vertebrate microRNA expression
Nat Genet
 , 
2004
, vol. 
36
 (pg. 
1079
-
1083
)
Mark
M
Lufkin
T
Vonesch
JL
Ruberte
E
Olivo
JC
Dolle
P
Gorry
P
Lumsden
A
Chambon
P
Two rhombomeres are altered in Hoxa-1 mutant mice
Development
 , 
1993
, vol. 
119
 (pg. 
319
-
338
)
Marsit
CJ
Eddy
K
Kelsey
KT
MicroRNA responses to cellular stress
Cancer Res
 , 
2006
, vol. 
66
 (pg. 
10843
-
10848
)
Mason
JB
Choi
SW
Effects of alcohol on folate metabolism: implications for carcinogenesis
Alcohol
 , 
2005
, vol. 
35
 (pg. 
235
-
241
)
Mollard
R
Dziadek
M
Homeobox genes from clusters A and B demonstrate characteristics of temporal colinearity and differential restrictions in spatial expression domains in the branching mouse lung
Int J Dev Biol
 , 
1997
, vol. 
41
 (pg. 
655
-
666
)
Morris
R
Developments of a water-maze procedure for studying spatial learning in the rat
J Neurosci Methods
 , 
1984
, vol. 
11
 (pg. 
47
-
60
)
Murphy
P
Hill
RE
Expression of the mouse labial-like homeobox-containing genes, Hox 2.9 and Hox 1.6, during segmentation of the hindbrain
Development
 , 
1991
, vol. 
111
 (pg. 
61
-
74
)
New
DA
Whole-embryo culture and the study of mammalian embryos during organogenesis
Biol Rev Camb Philos Soc
 , 
1978
, vol. 
53
 (pg. 
81
-
122
)
Opitz
B
Mothes
HK
Clausing
P
Effects of prenatal ethanol exposure and early experience on radial maze performance and conditioned taste aversion in mice
Neurotoxicol Teratol
 , 
1997
, vol. 
19
 (pg. 
185
-
190
)
Perera
RJ
Ray
A
MicroRNAs in the search for understanding human diseases
BioDrugs
 , 
2007
, vol. 
21
 (pg. 
97
-
104
)
Pohorecky
LA
Stress and alcohol interaction: an update of human research
Alcohol Clin Exp Res
 , 
1991
, vol. 
15
 (pg. 
438
-
459
)
Reamon-Buettner
SM
Borlak
J
A new paradigm in toxicology and teratology: altering gene activity in the absence of DNA sequence variation
Reprod Toxicol
 , 
2007
, vol. 
24
 (pg. 
20
-
30
)
Sathyan
P
Golden
HB
Miranda
RC
Competing interactions between micro-RNAs determine neural progenitor survival and proliferation after ethanol exposure: evidence from an ex vivo model of the fetal cerebral cortical neuroepithelium
J Neurosci
 , 
2007
, vol. 
27
 (pg. 
8546
-
8557
)
Sayal
K
Heron
J
Golding
J
Emond
A
Prenatal alcohol exposure and gender differences in childhood mental health problems: a longitudinal population-based study
Pediatrics
 , 
2007
, vol. 
119
 (pg. 
e426
-
e434
)
Schalinske
KL
Nieman
KM
Disruption of methyl group metabolism by ethanol
Nutr Rev
 , 
2005
, vol. 
63
 (pg. 
387
-
391
)
Scholl
TO
Johnson
WG
Folic acid: influence on the outcome of pregnancy
Am J Clin Nutr
 , 
2000
, vol. 
71
 (pg. 
1295S
-
1303S
)
Shankar
K
Hidestrand
M
Liu
X
Xiao
R
Skinner
CM
Simmen
FA
Badger
TM
Ronis
MJ
Physiologic and genomic analyses of nutrition-ethanol interactions during gestation: Implications for fetal ethanol toxicity
Exp Biol Med (Maywood)
 , 
2006
, vol. 
231
 (pg. 
1379
-
1397
)
Thompson
JR
Chen
SW
Ho
L
Langston
AW
Gudas
LJ
An evolutionary conserved element is essential for somite and adjacent mesenchymal expression of the Hoxa1 gene
Dev Dyn
 , 
1998
, vol. 
211
 (pg. 
97
-
108
)
Thomson
JM
Parker
J
Perou
CM
Hammond
SM
A custom microarray platform for analysis of microRNA gene expression
Nat Methods
 , 
2004
, vol. 
1
 (pg. 
47
-
53
)
Tusher
VG
Tibshirani
R
Chu
G
Significance analysis of microarrays applied to the ionizing radiation response
Proc Natl Acad Sci USA
 , 
2001
, vol. 
98
 (pg. 
5116
-
5121
)
Van Maele-Fabry
G
Picard
JJ
Evaluation of the embryotoxic potential of ten chemicals in the whole mouse embryo culture
Teratology
 , 
1987
, vol. 
36
 (pg. 
95
-
106
)
Welch
C
Chen
Y
Stallings
RL
MicroRNA-34a functions as a potential tumor suppressor by inducing apoptosis in neuroblastoma cells
Oncogene
 , 
2007
, vol. 
26
 (pg. 
5017
-
5022
)
Woltering
JM
Durston
AJ
The zebrafish hoxDb cluster has been reduced to a single microRNA
Nat Genet
 , 
2006
, vol. 
38
 (pg. 
601
-
602
)
Wysolmerski
JJ
Philbrick
WM
Dunbar
ME
Lanske
B
Kronenberg
H
Broadus
AE
Rescue of the parathyroid hormone-related protein knockout mouse demonstrates that parathyroid hormone-related protein is essential for mammary gland development
Development
 , 
1998
, vol. 
125
 (pg. 
1285
-
1294
)
Xu
P
Guo
M
Hay
BA
MicroRNAs and the regulation of cell death
Trends Genet
 , 
2004
, vol. 
20
 (pg. 
617
-
624
)
Xu
Y
Li
L
Zhang
Z
Li
Y
Effects of folinic acid and Vitamin B12 on ethanol-induced developmental toxicity in mouse
Toxicol Lett
 , 
2006
, vol. 
167
 (pg. 
167
-
172
)
Xu
Y
Tang
Y
Li
Y
Effect of folic acid on prenatal alcohol-induced modification of brain proteome in mice
Br J Nutr
 , 
2008
, vol. 
99
 (pg. 
455
-
461
)
Yanaguita
MY
Gutierrez
CM
Ribeiro
CN
Lima
GA
Machado
HR
Peres
LC
Pregnancy outcome in ethanol-treated mice with folic acid supplementation in saccharose
Childs Nerv Syst
 , 
2008
, vol. 
24
 (pg. 
99
-
104
)
Yu
Z
Jian
Z
Shen
SH
Purisima
E
Wang
E
Global analysis of microRNA target gene expression reveals that miRNA targets are lower expressed in mature mouse and Drosophila tissues than in the embryos
Nucleic Acids Res
 , 
2007
, vol. 
35
 (pg. 
152
-
164
)
Zhang
M
Kim
HJ
Marshall
H
Gendron-Maguire
M
Lucas
DA
Baron
A
Gudas
LJ
Gridley
T
Krumlauf
R
Grippo
JF
Ectopic Hoxa-1 induces rhombomere transformation in mouse hindbrain
Development
 , 
1994
, vol. 
120
 (pg. 
2431
-
2442
)
Zhao
Y
Samal
E
Srivastava
D
Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis
Nature
 , 
2005
, vol. 
436
 (pg. 
214
-
220
)