Abstract

BACKGROUND

Although several studies have suggested that CXCL12 and its receptor, CXCR4, may play a role in embryo implantation, there are limited reports of expression of CXCR4 and CXCL12 in human endometrium. The aim of this study was to investigate CXCL12 and CXCR4 expression in human endometrium and to see if CXCL12 could affect matrix metalloproteinase (MMP) production by endometrial stromal and epithelial cells.

METHODS

Quantitative real-time RT–PCR (qRT–PCR) was used to detect the expression of CXCL12 and CXCR4 mRNA in endometrial biopsy samples obtained from fertile women (n = 30). Immunohistochemical analysis was carried out to determine where in the endometrium CXCL12 and CXCR4 were expressed. Primary cell culture followed by qRT–PCR and zymography was used to investigate whether CXCL12 affected MMP-2 and -9 production by endometrial stromal and epithelial cells.

RESULTS

Both CXCL12 and CXCR4 were detected in the endometrium. There was no difference in CXCL12 expression at different times in the cycle, but expression of CXCR4 mRNA was significantly higher in the early proliferative (P < 0.01) compared with late proliferative and secretory phases of the cycle. CXCL12 expression was strongest in the epithelial compartment, and weaker in blood vessel walls. CXCR4 immunostaining was strong in the epithelium and blood vessel walls and weaker in the stroma. CXCL12 (10 and 100 ng/ml) had no effect on mRNA expression or activity of MMP-2 or MMP-9 in either stromal or epithelial cells.

CONCLUSIONS

The results show that the expression of CXCL12 in human endometrium does not alter during the menstrual cycle, while the endometrial expression of its receptor, CXCR4, is highest in the early proliferative phase. In contrast to its effects in other cells, CXCL12 had no effect on MMP-2 or MMP-9 production by endometrial stromal or epithelial cells.

Introduction

The role of the endometrium in reproduction is to accept the implanting embryo and to form the maternal side of the placenta. Abnormalities in endometrial function result in reproductive failure and, in particular, infertility and recurrent pregnancy loss. The endometrium consists of an epithelial compartment and a stromal compartment. The epithelial compartment can be divided into luminal and glandular epithelium. The luminal epithelium lies closest to the uterine cavity and has first contact with the embryo, while the glandular epithelium invaginates into the underlying stroma. The stromal compartment contains a unique population of leucocytes, the largest number of which are CD56+ uterine natural killer (uNK) cells. The numbers of uNK cells in the endometrium increase dramatically during the secretory phase of the cycle and stay high in the first trimester of pregnancy (Bulmer et al., 1991).

Chemokines are small peptides produced by numerous cell types, which interact with G-protein-coupled receptors on the responding cell. They were first described as interacting with receptors on leucocytes and having a role in the recruitment and trafficking of leucocytes particularly to sites of inflammation. However, more recently the expression of chemokine receptors on other cell types has been described and studies have shown that chemokines can affect other cell activity, including cell proliferation, angiogenesis and regulation of metalloproteinase and integrin expression (Mulayim et al., 2003). Expression of a number of chemokines and their receptors has been described in human endometrium (Dominguez et al., 2003; Mulayim et al., 2003; Dimitriadis et al., 2005) and they are postulated to play a role in embryo implantation and/or recruitment of leukocytes (Salamonsen et al., 2007; Carlino et al., 2008). In particular it has been shown that CD56+ NK cells express high levels of CCR1, 2 and 5, CXCR3 and 4 and CX3CR1 (van den Heuvel et al., 2005), suggesting that ligands for these receptors may be important in increasing the numbers of CD56+ cells in the endometrium during the secretory phase of the menstrual cycle and during early pregnancy.

Several recent studies have suggested the importance of CXCR4 and its ligand, CXCL12 (also known as SDF-1), in placental function. CXCL12 and CXCR4 may play a crucial role in CD56+CD16 cell trafficking as CXCL12 increases the motility of CD56+CD16 cells, but not CD56+CD16+ cells, in vitro (Hanna et al., 2003; Wu et al., 2005). CXCL12 and CXCR4 are also expressed by first-trimester trophoblast cells, including those that invade the maternal decidual blood vessels (Wu et al., 2004). CXCL12 may also be produced by decidualized stromal cells (Park et al., 2010), although another study was unable to show its production by cultured decidualized stromal cells (Zhou et al., 2008). CXCL12/CXCR4 signalling in trophoblast cell cultures has been shown to stimulate anti-apoptotic pathways and promote cell survival (Jaleel et al., 2004; Wu et al., 2004) and to increase invasiveness and matrix metalloproteinase (MMP)-2 and MMP-9 production by trophoblast cells (Zhou et al., 2008).

Although expression of CXCL12 by monkey and bovine endometrium has been reported (Ace and Okulicz, 2004; Mansouri-Attia et al., 2009), there are very few reports on the expression of CXCR4 and CXCL12 by the human endometrium. We therefore used quantitative real-time PCR (qRT–PCR) to determine the expression of CXCL12 and CXCR4 throughout the cycle in endometrium from normal fertile women. We also used immunohistochemistry to determine which cell compartments within the endometrium express CXCL12 and CXCR4. CXCL12 is reported to affect MMP production in a number of different cell types (Klier et al., 2001; Kucia et al., 2004; Chinni et al., 2006) and MMPs are known to be important in embryo implantation (Salamonsen 1999; Cohen et al., 2006). We therefore investigated the effect of CXCL12 on MMP-2 and MMP-9 mRNA expression and secreted activity by cultured stromal and epithelial cells.

Materials and Methods

Human subjects

Endometrial biopsies were obtained from normal fertile women attending the Jessop Wing, Sheffield Teaching Hospitals for surgery for non-endometrial pathology. All samples were collected with written informed patients’ consent and ethical committee approval was obtained for this study. All of the women were aged between 20 and 40, had menstrual cycles of between 25 and 35 days, normal uterine anatomy and no steroid treatment for at least 2 months prior to the study and were all of proven fertility. Samples (n = 30) for qRT–PCR analysis to determine expression of CXCL12 and CXCR4 throughout the menstrual cycle (n = 6 early proliferative; n = 7 late proliferative; n = 7 early secretory; n = 4 mid-secretory; n = 6 late secretory) were collected into RNA later (Applied Biosystems, UK) and stored at −80°C prior to mRNA extraction. These samples were dated according to the stage of the last menstrual period. Histological dating by an experienced histopathologist was also obtained for 26 of the 30 samples and in all cases this agreed with the date obtained from the last menstrual cycle. A further 12 samples (n = 6 proliferative; n = 6 secretory) were obtained for immunohistochemical analysis to determine which cell types express CXCL12 and CXCR4. These samples were snap frozen in liquid nitrogen. These samples were dated according to the date of the last menstrual period and morphological appearance. An additional 11 samples were obtained at different times throughout the cycle for cell culture experiments; these samples were collected into Hanks solution and taken directly to the laboratory.

Cell culture

Human endometrial epithelial and stromal cells were prepared from endometrial tissue as previously described (Tuckerman et al., 2000; Cork et al., 2002). The tissue was chopped finely and incubated at 37°C for 45 min in 5 ml Dulbecco's modified Eagle's medium (DMEM) containing 0.2% collagenase (type 1a; Sigma, UK) (DMEMC). During and at the end of the incubation, the tissue was pipetted gently to disperse the cells. The epithelial cells were separated from the stromal cells by centrifugation at 100g for 5 min. The pellet which contained epithelial cells, mainly present as glands, was incubated at 37°C for a further 45 min in 5 ml of DMEMC. The cells were again dispersed by gentle pipetting and the epithelial cells were pelleted by centrifugation at 100g. The supernatants from both incubations, which contained the stromal cells, were pooled and centrifuged at 300g to pellet the cells.

Both cell types were resuspended in 2 ml of DMEM containing fetal calf serum (10%), glutamine (4 mmol/l) and penicillin and streptomycin (100 μg/ml) (complete DMEM media) (CDMEM) and layered onto 8 ml of CDMEM in a 1 cm wide tube. After 30 min the top 8 ml from the epithelial tube was discarded and the lower 2 ml was used for epithelial cell cultures. For stromal cells the top 8 ml was taken and the bottom 2 ml was discarded. Both cell types were plated in either 24-well plates (for zymography) or 25 cm3 flasks (for mRNA analysis) at a density of 2 × 105 cells per ml. The cells were grown to near confluency (usually 48–72 h) in an atmosphere of 5% CO2 and 95% air at 37°C. The media were then removed and replaced with media containing either no further supplements (control) or CXCL12 (R&D systems Ltd., Abingdon, Oxon, UK) at 1, 10 and 100 ng/ml. The cells were grown for a further 48 h, after which the supernatants from the 24-well plates were removed and kept at −20°C for MMP analysis by zymography. The supernatants from the flasks were removed and mRNA was extracted from the cells as described below. Previous immunocytochemical analysis of vimentin (a stromal cell marker), cytokeratin (epithelial cell marker) and CD-45 (leucocyte marker) of cells prepared and grown in this way has shown that the epithelial and stromal cells are essentially pure and free of leucocyte contamination after 48 h in culture (Tuckerman et al., 2000).

mRNA extraction

mRNA from endometrial biopsies was extracted using TRI-REAGENTTM (Sigma-Aldrich) according to the manufacturer's protocol. Samples were finely chopped and homogenized with 1 ml TRI-REAGENT per 100 mg tissue. The homogenized tissue was centrifuged at 12 000g for 10 min at 4°C to remove insoluble material. The supernatant was removed to a fresh tube and allowed to stand at room temperature (RT) for 5 min. Chloroform (0.2 ml/ml TRI-REAGENT) was added and the sample was shaken and then left to stand at RT for 15 min, followed by centrifugation at 12 000g for 5 min at 4°C. RNA was precipitated from the upper phase by addition of isopropanol (0.5-ml/ml TRI-REAGENT) and thorough mixing. The mixture was allowed to stand for 10 min at RT and was centrifuged at 12 000g at 4°C, which led to the formation of an RNA pellet. The supernatant was removed and 75% ethanol (1 ml/ml TRI-REAGENT) was added. The tubes were vortex mixed and centrifuged at 7500g for 5 min at 4°C. The supernatant was removed and the pellet left to air dry. The pellet was resuspended in nuclease-free water and stored at −80°C.

mRNA from primary endometrial epithelial and stromal cells was extracted using Genelute™ Mammalian Total RNA miniprep kits. After incubation, the cells were removed from the 25 cm2 flasks using trypsin/EDTA and cells from each flask were pelletted by centrifugation at 100g. The mRNA from each pellet of cells was extracted according to the manufacturer's instructions. The purified RNA was stored at −80°C.

Quantitative mRNA analysis

The yield, concentration and purity of the RNA was assessed by spectroscopy and adjusted to a concentration of 50 ng/µl. Total RNA was reverse transcribed to cDNA using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Ten microlitres of RNA (500 ng) was added to 10 µl of cDNA master mix containing 2 µl 10X reverse transcriptase buffer, 0.8 µl dNTP mix (100 mM), 2 µl 10X RT random primers, 1 µl reverse transcriptase and 4.2 µl of nuclease-free water. Reverse transcription was carried out in a thermocycler set at 25°C for 10 min, 37°C for 120 min and 80°C for 5 s. Negative (−RT) controls were prepared in the same way but with 1 µl nuclease-free water instead of reverse transcriptase.

CXCR4 mRNA expression in endometrial biopsies and cultured stromal and epithelial cells was measured using Taqman real-time PCR assays using YWHAZ as the reference gene (Vandesompele et al., 2002). The use of YWHAZ as a reference gene was chosen after assessing the stability of eight different established housekeeping genes across different endometrial cell types. Taqman assays for CXCR4 (Hs00237052) and YWHAZ (Hs00237047) were obtained from Applied Biosystems UK and 10 µl amplification reactions were carried out using a Taqman fast universal master mix with 1 µl of the cDNA synthesis reaction. Thermal cycling conditions were 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min.

CXCL12 mRNA expression in endometrial biopsies and MMP-2 and MMP-9 mRNA expression in cells was measured using SYBR Green real-time PCR using YWHAZ as the reference gene. Primer sequences and efficiencies are shown in Table I. Each reaction contained 12.5 µl absolute QPCR SYBR Green mix, 1 µl forward and reverse primer (0.5 pmol) and 2 µl cDNA in a 25 µl reaction. A PCR negative control containing nuclease-free water instead of cDNA and a −RT control containing −RT reaction instead of cDNA were included. Amplification was carried out in an iCycler iQ (Bio-Rad). Thermal cycling conditions were 95°C for 15 min followed by 40 cycles of 95°C for 15 s, 60°C for 1 min and 95°C for 30 s, followed by a standard melt curve analysis, which showed a single peak in all cases and confirmed the specificity of the product. Levels of expression of all transcripts were calculated using the Delta Ct method. The threshold cycle value for the reference gene mRNA was subtracted from that of the target gene and mRNA levels of the target gene were expressed as 2−(ΔCt). cDNA prepared from mRNA extracted from each biopsy or cell sample was analysed in triplicate.

Table I

Primer sequences and efficiencies.

Gene Forward sequence Reverse sequence Product size (base pairs) Primer efficiency (%) 
CXCL12 TCAGCCTGAGCTACAGATGC CTTTAGCTTCGGGTCAATGC 121 106 
MMP-2 TGCTGGAGACAAATTCTGGA ACTTCACGCTCTTCAGACTTTGG 200 89 
MMP-9 TGCCCGGACCAAGGATACAG TCAGGGCGAGGACCATAGAG 182 95 
YWHAZ ACTTTTTGGTACATTGTGGCTTCA CCGCCAGGACAAACCAGTAT 94 92 
Gene Forward sequence Reverse sequence Product size (base pairs) Primer efficiency (%) 
CXCL12 TCAGCCTGAGCTACAGATGC CTTTAGCTTCGGGTCAATGC 121 106 
MMP-2 TGCTGGAGACAAATTCTGGA ACTTCACGCTCTTCAGACTTTGG 200 89 
MMP-9 TGCCCGGACCAAGGATACAG TCAGGGCGAGGACCATAGAG 182 95 
YWHAZ ACTTTTTGGTACATTGTGGCTTCA CCGCCAGGACAAACCAGTAT 94 92 

Cryostat sectioning

Ten micrometre sections were cut from the frozen endometrial biopsy samples embedded in Cryo-M-Bed [Bright Instrument Co Ltd, Huntingdon, UK]. After cutting, the sections were fixed in 3.7% (w/v) paraformaldehye in phosphate-buffered saline (PBS) for 15 min at RT. The sections were then washed in PBS and fixed in methanol at −20°C for 4 min, then acetone at −20°C for 2 min. The sections were washed in PBS and stored in sucrose solution (50:50 mixture of 0.5 M sucrose, 0.14 M MgCl2 in PBS and glycerol) at −20°C.

Immunohistochemistry for CXCL12 and CXCR4

The CXCL12 primary antibody was mouse anti-human (R&D Systems, Abingdon, UK; clone number 79018) (2 μg/ml). The CXCR4 primary antibody was also mouse anti-human (AbCam, Cambridge, UK; ab58176) (3 µg/ml). The binding of antibodies to antigen was visualized using an Elite Vectastain Universal ABC kit (Vector, UK) and DAB substrate according to the manufacturers’ instructions or a fluorescein conjugated rabbit anti-mouse immunoglobulin (Dako Ltd., Ely Cambridgeshire).

Sections were washed twice for 5 min in PBS to remove sucrose solution and then quenched in 3% hydrogen peroxide in methanol for 10 min. After washing in PBS, slides were incubated with blocking solution [15 μl horse serum plus 5 drops avidin from an avidin-binding blocking kit (Vector UK) per ml of PBS] for 30 min at RT. The sections were then incubated with primary antibody in PBS containing 15 μl of horse serum plus five drops of biotin/ml PBS, overnight at 4°C. For visualization of binding using the vectastain kit, the sections were then washed as before and incubated with biotinylated secondary antibody, diluted in PBS containing15 μl horse serum/ml, for 30 min at RT. Sections were washed and then incubated with avidin-biotinylated enzyme complex for 30 min at RT. After repeating the wash twice, sections were stained for 8 min with diamino-benzidine-tetrachloride substrate to visualize antibody binding, washed in distilled water for 5 min and counterstained for 10 min with haematoxylin (20% in tap water). Sections were dehydrated through alcohol, cleared in xylene and mounted in DePeX. All incubations were carried out in a humid chamber. For visualization using the flourescein-conjugated antibody, after incubation with primary antibody and washing in PBS, sections were incubated with fluorescein-conjugated rabbit anti-mouse immunoglobulin (1:20 dilution in PBS) for 1 h at RT in the dark. The slides were washed as before and counter stained with propidium iodide and mounted in Citifluor. For a negative control, the primary antibody was replaced with mouse IgG (2 µg/ml). Immunostaining was carried out on three separate occasions in sections from the same biopsy. Sections from all 12 biopsies were stained at the same time. Staining intensity was determined by the amount of brown colour in the different cellular compartments. Comparisons were only made in slides stained at the same time and the patterns described were consistent in all staining runs.

Zymography

MMP-2 and MMP-9 activity in the stromal and epithelial cell culture supernatants were determined by gelatin zymography. Supernatants (5 µl) were added to non-reducing buffer and run on 7.5% polyacrylamide gel containing 0.1% gelatin. A lane containing molecular weight markers (Sigma) was also included. Separation was carried out for ∼2 h at 100 V. Gels were incubated in three changes of 2.5% (v/v) Triton X-100 for 30 min each and then incubated overnight at 37°C in 0.25 mol/l Tris buffer containing 1 mol/l NaCl and 0.025 mol/l CaCl2 . The gels were then stained with 0.5% (w/v) Coomassie blue R 250 in 10% (v/v) acetic acid, 30% (v/v) methanol and destained in 10% (v/v) acetic acid, 45% (v/v) methanol. The bands produced were identified by comparison with those produced from DX3 cells, which acted as a positive control. Band size was determined by densitometry. CXCL12 was added to cells prepared from five different biopsies and the supernatants from each experiment were analysed on three separate occasions.

Statistics

The biopsies were divided into early proliferative (n = 6), late proliferative (n = 7), early secretory (n = 7), mid-secretory (n = 4) and late secretory (n = 6) phases of the cycle. Non-parametric Mann–Whitney tests were used to determine statistical differences between expression of CXCL12 and CXCR4 mRNA at different times in the menstrual cycle. A Kruskall–Wallis (non-parametric ANOVA) test was used to determine the effects of CXCL12 on MMP-2 and MMP-9 mRNA and activity in cultured epithelial and stromal cells.

Results

Expression of CXCL12 and CXCR4 mRNA in the endometrium throughout the menstrual cycle

CXCL12 mRNA was measureable in 27 of the 30 biopsies, although levels were considerably lower than those of the reference gene. There was no difference in CXCL12 mRNA expression in biopsies obtained at different times in the menstrual cycle (Fig. 1). Expression of CXCR4 was measureable in all 30 biopsies and levels in most biopsies were greater than the reference gene. In contrast to CXCL12, expression of CXCR4 showed changes during the menstrual cycle. Expression was significantly higher in endometrium obtained during the early proliferative phase compared with that obtained in the late proliferative (P < 0.001), early secretory (P < 0.001), mid-secretory (P < 0.01) and late secretory (P < 0.001) phases (Fig. 2).

Figure 1

Quantitative analysis of CXCL12 mRNA expression in human endometrium measured by real-time PCR. Levels are expressed relative to the YWHAZ reference gene. Levels are grouped according to the stage in the menstrual cycle. EP, early proliferative (Days 1–9) (n = 5); LP, late proliferative (Days 10–14) (n = 5); ES, early secretory (Days 15–18) (n = 7); MS, mid-secretory (Days 19–23) (n = 4); LS, late secretory (Days 24–28) (n = 6). Bars represent median values. No significant difference in levels of CXCL12 was found in samples collected at different stages of the cycle.

Figure 1

Quantitative analysis of CXCL12 mRNA expression in human endometrium measured by real-time PCR. Levels are expressed relative to the YWHAZ reference gene. Levels are grouped according to the stage in the menstrual cycle. EP, early proliferative (Days 1–9) (n = 5); LP, late proliferative (Days 10–14) (n = 5); ES, early secretory (Days 15–18) (n = 7); MS, mid-secretory (Days 19–23) (n = 4); LS, late secretory (Days 24–28) (n = 6). Bars represent median values. No significant difference in levels of CXCL12 was found in samples collected at different stages of the cycle.

Figure 2

Quantitative analysis of CXCR4 mRNA expression in human endometrium measured by real-time PCR. Levels are expressed relative to the YWHAZ reference gene. Levels are grouped according to the stage in the menstrual cycle. EP, early proliferative (Days 1–9) (n = 6); LP, late proliferative (Days 10–14) (n = 7); ES, early secretory (Days 15–18) (n = 7); MS, mid-secretory (Days 19–23) (n = 4); LS, late secretory (Days 24–28) (n = 6). Bars represent median values. Expression in the early proliferative phase was significantly higher than that in the late proliferative, early secretory and late secretory phases at P < 0.001 (***). Expression in the early proliferative phase was significantly higher than that in the mid-secretory phase at P < 0.01 (**).

Figure 2

Quantitative analysis of CXCR4 mRNA expression in human endometrium measured by real-time PCR. Levels are expressed relative to the YWHAZ reference gene. Levels are grouped according to the stage in the menstrual cycle. EP, early proliferative (Days 1–9) (n = 6); LP, late proliferative (Days 10–14) (n = 7); ES, early secretory (Days 15–18) (n = 7); MS, mid-secretory (Days 19–23) (n = 4); LS, late secretory (Days 24–28) (n = 6). Bars represent median values. Expression in the early proliferative phase was significantly higher than that in the late proliferative, early secretory and late secretory phases at P < 0.001 (***). Expression in the early proliferative phase was significantly higher than that in the mid-secretory phase at P < 0.01 (**).

Immunostaining for CXCL12 and CXCR4 in endometrial tissue

Figure 3 shows the staining for CXCL12 and CXCR4 in endometrial biopsy samples obtained from normal fertile women during the menstrual cycle. CXCL12 staining intensity was greatest in the endometrial epithelial compartment (Fig. 3a–d) and appeared to be stronger in the luminal epithelium compared with the glandular epithelium (Fig. 3f). No staining was seen in the stromal compartment, or in subpopulations of stromal cells, but some weak staining was seen in cells in the blood vessel walls (Fig. 3a and c). There appeared to be no difference in staining intensity in either endometrial compartment or in the cells in the blood vessel walls in endometrium obtained at different times in the cycle. CXCR4 immunostaining was seen in endometrial epithelium, stroma and in the cells of the blood vessel walls (Fig. 3g–i). Staining was more intense in the epithelium and in the cells in the blood vessel walls than in the stroma. Staining intensity appeared to be slightly more intense in the epithelium from endometrium obtained during the proliferative phase of the cycle, but overall there appeared to be no obvious differences in staining patterns in any compartment at any time in the cycle.

Figure 3

Expression of CXCL12 and CXCR4 in human endometrium. (a) CXCL12 in proliferative endometrium, (b) CXCL12 in early secretory endometrium, (c) CXCL12 in mid-secretory endometrium, (d) CXCL12 in late secretory endometrium, (e) negative control where primary antibody was replaced with mouse IgG, (f) immunofluorescence for CXCL12 during the secretory phase, (g) CXCR4 in proliferative endometrium, (h) CXCR4 in secretory phase endometrium, (i) CXCR4 in secretory phase endometrium (magnification ×200).

Figure 3

Expression of CXCL12 and CXCR4 in human endometrium. (a) CXCL12 in proliferative endometrium, (b) CXCL12 in early secretory endometrium, (c) CXCL12 in mid-secretory endometrium, (d) CXCL12 in late secretory endometrium, (e) negative control where primary antibody was replaced with mouse IgG, (f) immunofluorescence for CXCL12 during the secretory phase, (g) CXCR4 in proliferative endometrium, (h) CXCR4 in secretory phase endometrium, (i) CXCR4 in secretory phase endometrium (magnification ×200).

Effects of CXCL12 on MMP-2 and MMP-9 mRNA and activity in endometrial stromal and epithelial cells

Real-time PCR showed that cultured epithelial and stromal cells expressed mRNA for the CXCR4 receptor (data not shown) and therefore should have the ability to respond to CXCL12. Assessment of MMP activity by zymography produced two bands of activity at 92 and 72 kDa. Comparison with the known bands produced by D3X cells suggested that these correspond to the pro-forms of each MMP (Fig. 4c and f). MMP mRNA levels and activity were greater for MMP-2 than for MMP-9 in both stromal and epithelial cells. Levels of MMP-2 as assessed by both zymography and mRNA analysis were approximately twice as high in stromal cells than in epithelial cells. CXCL12 had no effect on MMP-2 or MMP-9 mRNA levels or activity in either stromal or epithelial cells (Figs 4 and 5).

Figure 4

Effect of CXCL12 on MMP-2 and MMP-9 activity in supernatants from endometrial cells. MMP-2 (a and b) and MMP-9 (d and e) activity in supernatants from endometrial epithelial (a and d) and stromal (b and e) cells in five different experiments. (c) An example of an activity gel from epithelial cells and (f) an example of an activity gel from stromal cells. No significant differences in MMP activity was seen in the presence of CXCL12 in either cell type.

Figure 4

Effect of CXCL12 on MMP-2 and MMP-9 activity in supernatants from endometrial cells. MMP-2 (a and b) and MMP-9 (d and e) activity in supernatants from endometrial epithelial (a and d) and stromal (b and e) cells in five different experiments. (c) An example of an activity gel from epithelial cells and (f) an example of an activity gel from stromal cells. No significant differences in MMP activity was seen in the presence of CXCL12 in either cell type.

Figure 5

Effect of CXCL12 on MMP mRNA in endometrial cells. MMP-2 mRNA (a) and MMP-9 mRNA and (b) in endometrial epithelial cells; MMP-2 mRNA (c) and MMP-9 mRNA (d) in endometrial stromal cells. Bars represent median values. No significant difference in MMP mRNA expression was seen in the presence of CXCL12.

Figure 5

Effect of CXCL12 on MMP mRNA in endometrial cells. MMP-2 mRNA (a) and MMP-9 mRNA and (b) in endometrial epithelial cells; MMP-2 mRNA (c) and MMP-9 mRNA (d) in endometrial stromal cells. Bars represent median values. No significant difference in MMP mRNA expression was seen in the presence of CXCL12.

Discussion

In this study, we report the expression of CXCL12 and CXCR4 in the human endometrium throughout the menstrual cycle. We used a combined qRT–PCR and immunohistochemistry methodology to detect both mRNA and protein. Real-time PCR was used to determine differences in levels of mRNA throughout the cycle. Although this is an established quantitative method, this technique cannot differentiate expression by the different cell types in the endometrium. We therefore used immunohistochemistry to determine the types of endometrial cells in which each protein is expressed. The study would have been strengthened if both real-time PCR and immunohistochemistry had been carried out on endometrial tissue obtained from the same women. This would require collection of a larger biopsy sample, which was not always possible and dividing and processing the tissue differently immediately after collection in the operating theatre, which at times is logistically difficult.

CXCL12 mRNA was detected in biopsies from all women; however, no changes were seen in tissue collected at different times in the menstrual cycle. Immunostaining showed strong protein expression in the epithelial compartment, weak expression in the blood vessel walls and no expression in the stromal compartment. In contrast to our study, a previous study has reported an inability to detect CXCL12 expression in human endometrial samples at any time in the menstrual cycle using immunohistochemistry (Kitaya et al., 2004). In that study wax-embedded sections of endometrial tissue were used instead of frozen sections and although the antibody source was the same (R&D Systems), the antibody clone in the earlier study (clone 79014) was different to that used in our study (clone 79018). The manufacturer's information suggests that clone 79014 was not suitable for immunohistochemistry, whereas clone 79018 is suitable. Thus, the differences in results are likely to be due to the use of different antibodies. A further study was also unable to detect CXCL12 mRNA from endometrial biopsy samples obtained during menstrual, mid-secretory and premenstrual phases using a commercial common chemokine gene array (Jones et al., 2004). However, other chemokines such as RANTES and MCP-1, whose expression in the endometrium has been shown in other studies (Arici et al., 1999; Akoum et al., 2002; Caballero-Campo et al., 2002), were also not detected in this study.

The current study also showed expression of CXCR4 in endometrial epithelial, stromal and blood vessel wall cells. This agrees with a previous report which showed expression of CXCR4 in endometrial stromal and epithelial cells in vivo by immunohistochemistry and qRT–PCR (Dominguez et al., 2003). In our study mRNA expression was considerably higher in endometrium obtained during the early proliferative phase of the cycle compared with that in biopsies collected at other times. This is in contrast to the study of Dominguez et al., 2003, which showed a small increase in mRNA levels in the mid-secretory phase, at the time of implantation. However, in their study tissue was collected from only 15 women (as compared with 30 women in our study). Increased expression of CXCR4 during the proliferative phase of the menstrual cycle, a time of increased angiogenesis in the endometrium, might suggest that CXCL12 plays a role in the angiogenic process. We were unable to determine which type of blood vessel wall cells were expressing either CXCL12 or CXCR4, however the expression of these factors in blood vessels might suggest a role for CXCL12 in angiogenesis. Expression in the blood vessel walls might also suggest a role in the recruitment of uNK cells from the blood into endometrial tissue. However, we were also unable to determine whether the CXCR4 positively stained cells in the stroma were stromal cells or leukocytes. In particular, it would be of interest to carry out co-localization analysis with anti-CD56+ to determine if the stromal cells were uNK cells.

Expression of CXCR4 by cultured human endometrial epithelial and decidual stromal cells has also been reported (Dominguez et al., 2003; Hess et al., 2007). In these studies CXCR4 expression in both cell types was up-regulated by the presence of either blastocysts (epithelial cells) or trophoblast (decidual stromal cells), suggesting that CXCL12/CXCR4 may play a role in the embryo/embryonic cell interactions associated with implantation.

Increased CXCL12 expression in the luminal epithelium compared with glandular epithelium was seen in our study. The luminal epithelium is the point of attachment of the embryo to the endometrium during implantation and CXCL12 may play a role in this process. However, a previous report has suggested that CXCR4 is not expressed by the blastocyst (Dominguez et al., 2003). Alternatively, the luminal epithelium is exposed to foreign particles present in the uterine cavity, especially sperm and semen. CXCL12 may therefore play a role in innate immunity, which protects the endometrium and placenta from infection.

The fact that CXCR4 is expressed by stromal and epithelial cells suggests that CXCL12 may affect the growth and function of these cells as well as that of leucocytes. CXCL12 has been shown to affect other important physiological and pathological functions including angiogenesis, MMP production and cell proliferation in many cell types (Chen et al., 2006; Kryczek et al., 2007). In this study, we confirmed expression of CXCR4 in our cell culture model and then investigated whether CXCL12 could affect the production of MMP-2 and MMP-9 mRNA and secreted activity in separated stromal and epithelial cells. Similar patterns of MMP-2 and MMP-9 production by each cell type were shown by mRNA and zymography, and showed production of more MMP-2 than MMP-9 by both cell types. It also showed a ∼2-fold increase in production of MMP-2 by stromal cells compared with epithelial cells. This pattern of MMP-2 and MMP-9 production is similar to that measured by ELISA in cultured epithelial and stromal cell supernatants as previously reported (Cork et al., 2002). Despite expression of CXCR4, CXCL12 at 10 and 100 ng/ml had no effect on MMP-2 and MMP-9 production by either stromal or epithelial cells. These concentrations of CXCL12 are relatively high, but are similar to levels shown to affect cellular function in other cells (Jaleel et al., 2004; Chinni et al., 2006). Previous studies have shown that steroid withdrawal, including placing endometrial cells in culture without hormones causes up-regulation of MMP expression (Marbaix et al., 1992) and this may be the reason for a lack of effect of CXCL12 on MMP expression in these experiments. In this study, the cells were incubated in media containing fetal calf serum, which also contains MMPs and this may also mask effects of CXCL12 on MMP production. However, we have previously shown that IL1 and TNF-α, which are known stimulators of MMPs, are able to increase MMP-2 and MMP-9 secreted protein (assayed by ELISA) and activity (shown by zymography) in epithelial and stromal cells cultured in this way (unpublished observation).

It has recently been shown that CXCL12 also binds to CXCR7 and that CXCR7 does not mediate typical chemokine receptor responses such as leukocyte trafficking, but may act as a decoy receptor or may be involved in CXCL12-mediated cell growth and survival (Sun et al., 2010). CXCR7 is expressed in human placenta (Tripathi et al., 2009) and further studies on its expression in human endometrium may help our understanding of the role of CXCL12 in reproductive biology.

In summary, this study has shown expression of CXCL12 and CXCR4 in the human endometrium, with no change in CXCL12 throughout the menstrual cycle and increased expression of CXCR4 during the early proliferative phase. CXCR4, the receptor for CXCL12 is expressed by endometrial stromal and epithelial cells suggesting that CXCL12 may affect endometrial cell function directly. However, CXCL12 had no effect on MMP production by cultured stromal and epithelial cells.

Authors' roles

S.M.L.: principal investigator, supervised and provided advice on the work, wrote the paper. R.W.: carried out the RT–PCR analysis of CXCL12 and CXCR4 in human biopsy tissue and effects of CXCL12 on MMP mRNA in endometrial cells. M.El-S.: carried out immunohistochemical analysis of CXCL12 and CXCR4 in human biopsy tissue and effects of CXCL12 on MMP activity in endometrial cells. A.J.H.: supervised and provided advice on the work and contributed to writing the paper. T.C.L.: provided human tissue and contributed to writing the paper.

Funding

The work was funded by the Biomedical Research Centre at Sheffield Hallam University and a PhD scholarship from the Libyan Government.

Acknowledgements

We would like to thank Dr Alka Prakash and Staff Nurses Barbara Anstie and Katherine Wood for collecting endometrial biopsy specimens.

References

Ace
CI
Okulicz
WC
Microarray profiling of progesterone related endometrial genes during the rhesus monkey secretory phase
Reprod Biol Endocrinol
 , 
2004
, vol. 
2
 (pg. 
54
-
62
)
Akoum
A
Lemay
A
Maheux
R
Estradiol and IL1-beta exert a synergistic stimulatory effect on the expression of the RANTES expressed and secreted in endometriotic cells
J Clin Endocrinol Metab
 , 
2002
, vol. 
87
 (pg. 
5785
-
5792
)
Arici
A
Senturk
LM
Seli
E
Bahtiyar
MO
Kim
G
Regulation of MCP-1 expression in human endometrial stromal cells by oestrogen and progesterone
Biol Reprod
 , 
1999
, vol. 
61
 (pg. 
85
-
90
)
Bulmer
JN
Morrison
L
Longfellow
M
Ritson
A
Pace
D
Granulated lymphocytes in human endometrium: histochemical and immunohistochemical studies
Hum Reprod
 , 
1991
, vol. 
6
 (pg. 
791
-
798
)
Caballero-Campo
P
Dominguez
F
Coloma
J
Messeguer
M
Remohi
J
Pellicer
A
Simon
C
Hormonal and embryonic regulation of chemokines IL-8 MCP-1 and RANTES in human endometrium during the window of implantation
Mol Hum Reprod
 , 
2002
, vol. 
8
 (pg. 
375
-
384
)
Carlino
C
Stabile
H
Morrone
S
Bulla
R
Soriani
A
Agostinis
C
Bossi
F
Mocci
C
Sarazani
F
Tedesco
F
, et al.  . 
Recruitment of circulating NK cells through decidual tissue; a possible mechanism controlling NK cell accumulation in the uterus during pregnancy
Blood
 , 
2008
, vol. 
15
 (pg. 
3108
-
3115
)
Chen
GS
Yu
HS
Lan
CCE
Chow
KC
Lin
TY
Kok
LF
Lu
MP
Liu
CH
Wu
MT
CXC chemokine receptor CXCR4 expression enhances tumorigenesis and angiogenesis of basal cell carcinoma
Br J Dermat
 , 
2006
, vol. 
154
 (pg. 
910
-
918
)
Chinni
SR
Sivalogan
S
Dong
Z
Trindade
JC
Deng
XY
Bonfil
RD
Cher
ML
CXCL12/CXCR4 signalling activates Akt-1 and MMP-9 expression in prostate cancer cells; the role of bone microenvironment associated CXCL12
Prostate
 , 
2006
, vol. 
66
 (pg. 
32
-
48
)
Cohen
M
Meisser
A
Bischof
P
Metalloproteinases and human placental invasiveness
Placenta
 , 
2006
, vol. 
27
 (pg. 
783
-
793
)
Cork
BA
Tuckerman
EM
Li
TC
Laird
SM
Expression of IL11 receptor by the human endometrium in vivo and effects of IL11, IL6 and LIF on the production of MMPs and cytokines by human endometrial cells in vitro
Mol Hum Reprod
 , 
2002
, vol. 
8
 (pg. 
841
-
848
)
Dimitriadis
E
White
CA
Jones
RL
Salamonsen
LA
Cytokines, chemokines and growth factors in endometrium related to implantation
Hum Reprod Update
 , 
2005
, vol. 
11
 (pg. 
613
-
630
)
Dominguez
F
Galan
A
Martin
JJ
Remohi
J
Pellicer
A
Simon
C
Hormonal and embryonic regulation of chemokine receptors CXCR1, CXCR4, CCR5, CCR2B in the human endometrium and blastocyst
Mol Hum Reprod
 , 
2003
, vol. 
9
 (pg. 
189
-
198
)
Hanna
J
Wald
O
Goldman-Wohl
D
Prus
D
Markel
G
Gazit
R
Katz
G
Haimov-Kochman
R
Fujii
N
Yagel
S
, et al.  . 
CXCL12 expression by invasive trophoblast induces specific migration of CD16- human NK cells
Blood
 , 
2003
, vol. 
102
 (pg. 
1569
-
1577
)
Hess
AP
Hamilton
AE
Talbi
S
Dosiou
C
Nyegaard
M
Nayak
N
Genbecev-Krtolica
O
Mavrogianis
P
Ferrer
K
Kruessel
J
, et al.  . 
Decidual stromal cell response to paracrine signals from the trophoblast: amplification of immune and angiogenic modulators
Biol Reprod
 , 
2007
, vol. 
76
 (pg. 
102
-
117
)
Jaleel
MA
Tsai
AC
Sarkar
S
Freedman
PV
Rubin
LP
Stromal cell derived factor 1 (SDF-1) signalling regulates human placental trophoblast cell survival
Mol Hum Reprod
 , 
2004
, vol. 
10
 (pg. 
901
-
909
)
Jones
RL
Hannan
NJ
Kaitutu
TJ
Zhang
J
Salamonsen
LA
Identification of chemokines important for leukocyte recruitment to the human endometrium at the times of embryo implantation and menstruation
J Clin Endocrinol Metab
 , 
2004
, vol. 
89
 (pg. 
6155
-
6167
)
Kitaya
K
Nakayama
T
Daikoku
N
Fushiki
S
Honjo
H
Spatial and temporal expression of ligands for CXCR3 and CXCR4 in human endometrium
J Clin Endocrinol Metab
 , 
2004
, vol. 
89
 (pg. 
2470
-
2476
)
Klier
CM
Nelson
EL
Cohen
CD
Horuk
R
Schlondorff
D
Nelson
PJ
Chemokine-induced secretion of gelatinase B in primary human monocytes
Biol Chem
 , 
2001
, vol. 
382
 (pg. 
1405
-
1410
)
Kryczek
I
Wei
A
Keller
K
Liu
R
Zou
WP
Stroma-derived factor (SDF-1/CXCL12) and human tumour cell pathogenesis
Am J Physiol-Cell Physiol
 , 
2007
, vol. 
292
 (pg. 
C987
-
C995
)
Kucia
M
Jankowski
K
Reca
R
Wysoczynski
M
Bandura
L
Allendorf
DJ
Ratajczak
J
Ratajczak
MZ
CXCR4-SDF-1 signalling, locomotion, chemotaxis and adhesion
J Mol Histol
 , 
2004
, vol. 
35
 (pg. 
233
-
245
)
Mansouri-Attia
N
Aubert
J
Reinaud
P
Giraud-Delville
C
Taghouti
G
Galio
L
Everts
RE
Degrelle
S
Richard
C
Hue
I
, et al.  . 
Gene expression profiles of bovine caruncular and intercaruncilar endometrium at implantation
Physiol Genomics
 , 
2009
, vol. 
39
 (pg. 
14
-
27
)
Marbaix
E
Donnez
J
Courtoy
PJ
Eeckout
Y
Progesterone regulates the activity of collagenase and related gelatinase-A and gelatinase-B in human endometrial explants
PNAS USA
 , 
1992
, vol. 
89
 (pg. 
11789
-
11793
)
Mulayim
N
Palter
SF
Kayisli
UA
Senturk
L
Arici
A
Chemokine receptor expression in human endometrium
Biol Reprod
 , 
2003
, vol. 
68
 (pg. 
1491
-
1495
)
Park
DW
Le
HJ
Park
CW
Hong
SR
Kwak-Kim
J
Yang
KM
Peripheral blood NK cells reflect changes in decidual NK cells in women with recurrent miscarriages
Am J Reprod Immunol
 , 
2010
, vol. 
63
 (pg. 
173
-
180
)
Salamonsen
LA
Role of proteases in implantation
Rev Reprod
 , 
1999
, vol. 
4
 (pg. 
11
-
22
)
Salamonsen
LA
Hannan
NJ
Dimitriadis
E
Cytokines and chemokines during human embryo implantation: roles in implantation and early placentation
Sem Reprod Med
 , 
2007
, vol. 
25
 (pg. 
437
-
444
)
Sun
X
Cheung
G
Hao
M
Zheng
J
Zhou
X
Zhang
J
Taichman
RS
Pienta
KJ
Wang
J
CXCL12/CXCR4/CXCR7 chemokine axis and cancer progression
Cancer Metastasis Rev
 , 
2010
, vol. 
29
 (pg. 
709
-
722
)
Tripathi
V
Verma
R
Dinda
A
Malhotra
N
Kaur
J
Luthra
K
Differential expression of RDC1/CXCR7 in the human placenta
J Clin Immunol
 , 
2009
, vol. 
29
 (pg. 
379
-
386
)
Tuckerman
EM
Okon
MA
Li
TC
Laird
SM
Do androgens have a direct effect on endometrial function: an in vitro study?
Fertil Steril
 , 
2000
, vol. 
74
 (pg. 
771
-
779
)
Van den Heuvel
M
Peralta
C
Bashar
S
Taylor
S
Hornock
J
Croy
BA
Trafficking of peripheral blood CD56bright cells to the decidualizing uterus—new tricks for old dogmas?
J Reprod Immunol
 , 
2005
, vol. 
67
 (pg. 
21
-
34
)
Vandesompele
J
De Preter
K
Pattyn
F
Poppe
B
Van Roy
N
De Paepe
A
Speleman
F
Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes
Genome Biol
 , 
2002
, vol. 
3
 (pg. 
1
-
12
)
Wu
X
Li
DJ
Yuan
MM
Zhu
Y
Wang
MY
The expression of CXCR4/CXCL12 in first trimester human trophoblast cells
Biol Reprod
 , 
2004
, vol. 
70
 (pg. 
1877
-
1885
)
Wu
X
Jin
LP
Yuan
MM
Zhu
Y
Wang
MY
Li
DJ
Human first trimester trophoblast cells recruit CD56bright CD16—NK cells into decidua by way of expressing and secreting CXCL12/SDF1
J Immunol
 , 
2005
, vol. 
175
 (pg. 
61
-
68
)
Zhou
WH
Du
MR
Dong
L
Yu
J
Li
DJ
Chemokine CXCL12 promotes the cross-talk between trophoblasts and decidual stromal cells in human first trimester pregnancy
Hum Reprod
 , 
2008
, vol. 
23
 (pg. 
2669
-
2679
)