Abstract
This study screened hospital sewage for the presence of blaNDM.
Colonies grown from plates containing meropenem streaked with hospital sewage were screened for blaNDM by PCR. Species identification was performed by sequencing 16S rRNA genes. Clonal relatedness of isolates was determined by Enterobacterial repetitive intergenic consensus sequence-PCR, sequencing recA and PFGE. Mating was attempted to obtain self-transmissible plasmids carrying blaNDM. The genetic context of blaNDM was investigated by PCR mapping using pNDM-BJ01, a blaNDM-1-carrying plasmid from Acinetobacter lwoffii as the reference.
Two Acinetobacter johnsonii isolates, designated XBB1 and XBC1, from sewage were found carrying blaNDM-1, but were of different clonal origins. In both cases, blaNDM-1 was carried by a self-transmissible plasmid. PCR mapping and sequencing revealed that the blaNDM-1-carrying plasmid of XBB1, pXBB1, was the same as pNDM-BJ01, whereas that of XBC1, pXBC1, was a variant of pNDM-BJ01. A large region downstream of blaNDM-1, including groES/groEL, ISCR27 and ISAba125, was absent from pXBC1. On pXBB1, blaNDM-1 was carried by Tn125, an ISAba125-formed composite transposon, which was inserted into a sequence downstream of aphA6.
Sewage of a hospital in China was found to contain blaNDM-1, suggesting that hospital sewage is an important but often overlooked reservoir of antimicrobial resistance determinants. A variety of Acinetobacter species in different locations have been found to harbour blaNDM-1, so the introduction of blaNDM-1 into Acinetobacter is unlikely to be a single event. The identification of blaNDM-1-carrying plasmid pNDM-BJ01/pXBB1 and its variants suggests that a common plasmid has been transferred among different host species at different locations.
Introduction
Carbapenems have long served as reliable and potent agents against Gram-negative bacilli but carbapenem-resistant isolates have emerged worldwide. A common mechanism mediating resistance to carbapenems in Gram-negative bacilli is the production of carbapenem-hydrolysing β-lactamases (carbapenemases). Various types of carbapenemases have been reported, among which NDM enzymes were identified recently; they belong to the metallo-β-lactamase class with the ability to hydrolyse all β-lactams except monobactams.1 The encoding genes of NDM, blaNDM variants, have been identified in clinical isolates belonging to various species of the Enterobacteriaceae and non-fermenting bacteria in many countries, representing a serious emerging challenge for treatment and public health.
Hospital sewage usually contains antimicrobial-resistant bacteria in high densities,2 serving as an important reservoir of resistance genes and a ‘hot spot’ for the transfer of resistance genes.3 Hospital sewage is therefore an ideal place to look for antimicrobial-resistant determinants. Due to the important role of hospital sewage in the emergence and dissemination of antimicrobial resistance and the global concern about blaNDM, we conducted a study to investigate whether our hospital sewage contained blaNDM-carrying isolates.
Materials and methods
Screening for blaNDM-carrying isolates from hospital sewage
Hospital sewage was obtained from the influx of the wastewater treatment plant in West China Hospital, Chengdu, China, on October 2010. The sewage was diluted 1 : 10 and an aliquot (100 μL) was streaked onto a CHROMAgar Orientation (CHROMAgar, Paris, France) agar plate containing 2 mg/L meropenem (Dainippon Sumitomo, Tokyo, Japan) and then incubated at 35°C overnight. Colonies were screened for blaNDM by PCR as described previously.4 The complete coding sequence of blaNDM was amplified with an additional pair of self-designed primers (NDM-up, 5′-TCGCCCCATATTTTTGCTAC; NDM-dw, 5′-CTGGGTCGAGGTCAGGATAG) and the amplicons were sequenced.
Species identification and strain typing
Species identification of isolates was performed by partially sequencing 16S rRNA genes amplified with the universal primers 27F and 1492R.5 Similarity searches of the 16S rRNA gene sequences obtained were carried out against the GenBank, EzTaxon6 and LeBIBI (http://pbil.univ-lyon1.fr/bibi/) databases. Antimicrobial susceptibility tests were performed using the Vitek II automated system (bioMérieux, Durham, NC, USA) with the breakpoints defined by the CLSI.7
Clonal relatedness of isolates carrying blaNDM was determined by Enterobacterial repetitive intergenic consensus sequences-PCR (ERIC-PCR)8 and PFGE using ApaI (Fermentas, Burlington, ON, Canada) for restriction. PFGE was performed using a CHEF DRII system (Bio-Rad, Hercules, CA, USA) at 14°C, with a 6 V/cm current, a switch angle of 120° and run times of 19 h at switch time of 5–30 s. In addition, the recA gene, one of the seven loci used for multilocus sequence typing of Acinetobacter baumannii, was amplified and then partially sequenced as described previously.9
Mating experiments
Conjugative experiments were carried out in brain-heart infusion broth (Oxoid, Hampshire, UK) using Escherichia coli strain J53 (resistance to azide) as the recipient. Transconjugants were selected on plates containing 0.5 mg/L meropenem plus 150 mg/L sodium azide. The presence of blaNDM on plasmids was confirmed by PCR using lysates of transconjugants as the template.
Study on genetic contexts of blaNDM
The genetic context of blaNDM was initially investigated by inverse PCR using self-ligated HincII- or HindIII-restricted genomic DNA as templates. During the process of this work, the complete sequences of two blaNDM-1-carrying plasmids, pNDM-BJ01 (GenBank accession number JQ001791) and pNDM-BJ02 (JQ060896), from Acinetobacter lwoffii recovered in China,10 became available and therefore were used as the references for PCR mapping (primers are listed in Table 1). Genomic DNA of transconjugants was used as the template for PCR mapping. For amplicon sizes smaller than 5 kb, PCR mapping was performed using ExTaq premix (Takara, Dalian, China) under the following conditions: 94°C for 5 min; 30 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 5 min; and a final elongation step at 72°C for 7 min. For amplicon sizes larger than 5 kb, PCR mapping was carried out using the long-range PCR (Fermentas) under the following conditions: 94°C for 2 min; 10 cycles of 94°C for 10 s, 55°C for 30 s, 68°C for 12 min; then 25 cycles of 94°C for 15 s, 55°C for 30 s, 68°C for 12 min plus 10 s cycle elongation for each successive cycle; and a final elongation step at 68°C for 7 min.
Primers for PCR mapping
| Primer | Sequence 5′–3′ | Target | Locationa | Amplicon size (kb) |
|---|---|---|---|---|
| traC_pBJ01-F1 | AGCTGATAGCGTAGGCAAGG | traC | 4514–4533 | 6.9 |
| NDM-upR6 | TGGTGGGTTGGTGTCTGTAA | orf | 44 860–44 879 | |
| traA_pBJ01-F1 | CGATTCACGGCATAAAACTG | traA | 3297–3316 | 6.2 |
| NDM-R1 | ATTGGCATAAGTCGCAATCC | blaNDM | 9474–9493 | |
| NDM-F1 | GCAGCACACTTCCTATCTCG | blaNDM | 9244–9263 | 2.1 |
| dsbC-F1 | CCCCTATTCTCTCGGCTTTC | dsbC | 11 286–11 305 | |
| dsbC-R1 | CCATAGCGGGTGATCGTATT | dsbC | 11 158–11 167 | 10.2 |
| zeta-R1 | TAGCGGGCTTCAACACTTCT | zeta | 21 322–21 341 | |
| zeta-F1 | AATGGAAAAGGCGCTGTATG | zeta | 20 289–20 308 | 3.0 |
| virB5-F1 | CCTTTACTGCCAACACAGCA | virB5 | 23 292–23 311 | |
| virB5-R1 | GCGGGTCGAGTTAATTTTGT | virB5 | 22 881–22 900 | 5.7 |
| virD4-F1 | GTTTTTGCGGTATGCCTGTT | virD4 | 28 513–28 532 | |
| virD4-R1 | TTCGTGATTTGCGTCTGAAG | virD4 | 28 213–28 232 | 3.6 |
| virB11-F1 | ACCGCCTGTTTCTGTTCTTC | virB11 | 31 749–21 763 | |
| virB11-R1 | ACAGCCTTTGCTTTCTGCTC | virB11 | 31 030–31 049 | 8.7 |
| parB_pBJ01-R1 | CAAGCCGATAATGCCTGTCT | parB | 39 705–39 724 | |
| parA_pBJ01-F1 | CATTGGATGCTTGGGCTACT | parA | 39 038–39 057 | 5.9 |
| traC_pBJ01-R1 | CGCCTGCTGTAACTTCTCAA | traC | 44 950–44 969 |
| Primer | Sequence 5′–3′ | Target | Locationa | Amplicon size (kb) |
|---|---|---|---|---|
| traC_pBJ01-F1 | AGCTGATAGCGTAGGCAAGG | traC | 4514–4533 | 6.9 |
| NDM-upR6 | TGGTGGGTTGGTGTCTGTAA | orf | 44 860–44 879 | |
| traA_pBJ01-F1 | CGATTCACGGCATAAAACTG | traA | 3297–3316 | 6.2 |
| NDM-R1 | ATTGGCATAAGTCGCAATCC | blaNDM | 9474–9493 | |
| NDM-F1 | GCAGCACACTTCCTATCTCG | blaNDM | 9244–9263 | 2.1 |
| dsbC-F1 | CCCCTATTCTCTCGGCTTTC | dsbC | 11 286–11 305 | |
| dsbC-R1 | CCATAGCGGGTGATCGTATT | dsbC | 11 158–11 167 | 10.2 |
| zeta-R1 | TAGCGGGCTTCAACACTTCT | zeta | 21 322–21 341 | |
| zeta-F1 | AATGGAAAAGGCGCTGTATG | zeta | 20 289–20 308 | 3.0 |
| virB5-F1 | CCTTTACTGCCAACACAGCA | virB5 | 23 292–23 311 | |
| virB5-R1 | GCGGGTCGAGTTAATTTTGT | virB5 | 22 881–22 900 | 5.7 |
| virD4-F1 | GTTTTTGCGGTATGCCTGTT | virD4 | 28 513–28 532 | |
| virD4-R1 | TTCGTGATTTGCGTCTGAAG | virD4 | 28 213–28 232 | 3.6 |
| virB11-F1 | ACCGCCTGTTTCTGTTCTTC | virB11 | 31 749–21 763 | |
| virB11-R1 | ACAGCCTTTGCTTTCTGCTC | virB11 | 31 030–31 049 | 8.7 |
| parB_pBJ01-R1 | CAAGCCGATAATGCCTGTCT | parB | 39 705–39 724 | |
| parA_pBJ01-F1 | CATTGGATGCTTGGGCTACT | parA | 39 038–39 057 | 5.9 |
| traC_pBJ01-R1 | CGCCTGCTGTAACTTCTCAA | traC | 44 950–44 969 |
All primers were self-designed.
aLocation refers to the sequence of pNDM-BJ01 (GenBank accession number JQ001791).
Sequencing
Amplicons were purified using the Cycle Pure kit (OMEGA, Norcross, GA, USA) and then sequenced using an ABI 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA) at the Beijing Genomics Institute (Beijing, China). Similarity searches of sequences obtained were carried out using BLAST programs (http://www.ncbi.nlm.nih.gov/BLAST/).
Nucleotide sequences accession number
Partial recA sequences of strains XBC1 and XBB1 have been deposited in GenBank as JX082195 and JX082196, respectively. Sequence of the genetic context of blaNDM-1 in strain XBC1 has been deposited in GenBank as JX441323.
Results and discussion
Among the 70 colonies that grew on the plate containing meropenem, two carried blaNDM, which was blaNDM-1 as identified by sequencing the complete coding sequences. To our knowledge, this is the first time that blaNDM-1 has been detected in hospital sewage.
The two blaNDM-carrying isolates were designated XBB1 and XBC1 here. Both isolates were identified as Acinetobacter johnsonii (Acinetobacter genospecies 7) by partially sequencing 16S rRNA genes. A. johnsonii is a species usually found in the aquatic environment11 and rarely causes clinical infections12 and human colonization.13 Several hundred Acinetobacter clinical isolates recovered within 1 year before collecting the sewage sample were screened for blaNDM by PCR but none was positive (data not shown). However, it still remains unclear whether the two blaNDM-carrying isolates had an environmental origin or came from clinical settings.
Of note, blaNDM-1 was almost always found in Acinetobacter species in China in contrast to the Enterobacteriaceae being the main host of blaNDM-1 in many other countries. A variety of Acinetobacter species at different locations have been found to harbour blaNDM-1 including A. baumannii, Acinetobacter pittii, Acinetobacter junnii, Acinetobacter haemolyticus and A. lwoffii,10,14 suggesting that the introduction of blaNDM-1 into the Acinetobacter genus is unlikely to have been a single event.
Both isolates displayed the multidrug-resistance phenotype. They were resistant to ampicillin, ampicillin/sulbactam, ceftriaxone, ceftazidime, cefepime, aztreonam and gentamicin, intermediate to amikacin and tobramycin, and susceptible to imipenem (MIC, 4 mg/L) and levofloxacin (MIC, 2 mg/L).
The two isolates had different ERIC-PCR patterns and PFGE profiles with the similarity being less than 80% (data not shown). Partially sequencing the recA gene revealed that recA sequences of the two isolates were only 91% (349/382) identical, suggesting that the two isolates were of different strains.
In both XBB1 and XBC1, blaNDM-1 was carried by a self-transmissible plasmid, which was able to be transferred to E. coli by mating, suggesting a broad host range of the plasmid. PCR mapping and sequencing revealed that the blaNDM-1-carrying plasmid of XBB1, designated pXBB1 here, was exactly the same as pNDM-BJ01. In pXBB1 and pNDM-BJ01, blaNDM-1—together with ble (mediating bleomycin resistance), trpF (encoding the phosphoribosylanthranilate isomerase), dsbC (encoding tat twin-arginine translocation pathway signal sequence domain protein), cutA1 (encoding periplasmic divalent cation tolerance protein), groES/groEL (encoding chaperonin) and ISCR27—was bracketed by two copies of ISAba125, which formed a composite transposon termed Tn125.15 Tn125 has previously been found inserted into the chromosome of A. baumannii at different locations.15,16 In Acinetobacter species other than A. baumannii, Tn125 was found on plasmids, i.e. pNDM-BJ01 of A. lwoffii10 and pABC7926 of A. haemolyticus.14 On both plasmids, Tn125 was inserted into a sequence downstream of aphA6 (specifying aminoglycoside 3′-phosphotransferase), evidenced by the presence of the characteristic 3 bp direct target repeats (Figure 1). The sequence in which Tn125 was inserted on the three Acinetobacter plasmids was 95% identical to the sequence downstream of aphA6 of Tn5393d.17 Repeated identification of Tn125 in different Acinetobacter species recovered in several countries and the insertion of Tn125 at various locations suggest that the ISAba125-formed composite transposon is likely to serve as a major vehicle mediating the mobilization of blaNDM-1.15 Of note, the ISAba125-formed composite transposon is not the sole mechanism mediating the mobilization of blaNDM-1, as blaNDM-1 was found carried by an IS903-formed composite transposon on pNDM-Dok01 of E. coli.18
Genetic contexts of blaNDM-1 on pXBB1 and pXBC1. Tn125 is indicated as a line with the 3 bp direct target repeats (GTT) being shown. The large region missing from pXBC1 compared with pXBB1 is illustrated by two broken lines. The 8 bp direct target repeats (CTTGGGCG) generated by the insertion of ISAba16 at the spacer between tnpR and zeta, a putative ζ toxin gene, is indicated. orf is a putative gene encoding a protein without known function.
Genetic contexts of blaNDM-1 on pXBB1 and pXBC1. Tn125 is indicated as a line with the 3 bp direct target repeats (GTT) being shown. The large region missing from pXBC1 compared with pXBB1 is illustrated by two broken lines. The 8 bp direct target repeats (CTTGGGCG) generated by the insertion of ISAba16 at the spacer between tnpR and zeta, a putative ζ toxin gene, is indicated. orf is a putative gene encoding a protein without known function.
The plasmid carrying blaNDM-1 of XBC1, designated pXBC1 here, was the same as pXBB1 and pNDM-BJ01 except for two variations. One variation was that a large region containing 310 bp of the 408 bp cutA1 gene, groES, groEL, ISCR27, the second copy of ISAba125 and a 235 bp spacer sequence downstream of ISAba125 was missing from pXBC1 (Figure 1). The mechanism responsible for this large region being absent remained unknown but is unlikely to be a result of the action of ISCR27 because a large sequence at the right side of this insertion sequence has also been deleted. ISAba125 was also absent downstream of blaNDM-1 on plasmid pNDM-BJ02 of A. lwoffii but on pNDM-BJ02 cutA1, groES, groEL and ISCR27 remained intact.10 Therefore, pXBC1 represents a new type of the genetic context of blaNDM-1. The other variation was that ISAba16, an insertion sequence of the IS66 family and originally found in A. baumannii,19 was found inserted at the spacer between a putative resolvase-encoding tnpR gene and a putative ζ toxin gene, generating characteristic 8 bp direct target repeats (Figure 1).
Similarly to pNDM-BJ01 and pNDM-BJ02, pXBB1 and pXBC1 are virulence plasmids carrying a ∼14 kb P-type type IV secretion system, which usually encodes a rigid pilus.10 Although seen in different host species, pXBB1 is identical to pNDM-BJ01, and pXBC1 and pNDM-BJ02 are variants of pNDM-BJ01/pXBB1, suggesting that a common plasmid has been transferred among different host species at different locations in China.
Conclusions
Sewage of a hospital in western China was found containing A. johnsonii strains carrying blaNDM-1, which could be a threat to the public health. Hospital sewage is an important but often overlooked reservoir of antimicrobial resistance determinants and warrants more attention. blaNDM-1 was found on plasmids that could be transferred to E. coli by mating. The two plasmids carrying blaNDM-1 that were detected in this study were either identical to or a variant of pNDM-BJ01 of A. lwoffii found in Beijing, China. blaNDM-1 was carried by Tn125, a composite transposon formed by two copies of ISAba125, which has been found inserted at different locations on the chromosome of A. baumannii or in the sequence downstream of aphA6 on plasmids of non-baumannii Acinetobacter species.
Funding
This work was partially supported by a grant from the National Natural Science Foundation of China (project no. 81222025).
Transparency declarations
Z. Z. is a member of the global advisor committee on CRBSI of 3M. X. Z.: none to declare.
Acknowledgements
Part of this work was presented at the Twenty-second European Congress of Clinical Microbiology and Infectious Diseases, London, UK, 2012 (Abstract 1179).
We thank Xiaohui Wang for technical support.
