Abstract

Objectives

To develop a rapid and reliable tool to detect by multiplex PCR assays the most frequently widespread β-lactamase genes encoding the OXA-1-like broad-spectrum β-lactamases, extended-spectrum β-lactamases (ESBLs), plasmid-mediated AmpC β-lactamases and class A, B and D carbapenemases.

Methods

Following the design of a specific group of primers and optimization using control strains, a set of six multiplex PCRs and one simplex PCR was created. An evaluation of the set was performed using a collection of 31 Enterobacteriaceae strains isolated from clinical specimens showing a resistance phenotype towards broad-spectrum cephalosporins and/or cephamycins and/or carbapenems. Direct sequencing from PCR products was subsequently carried out to identify β-lactamase genes.

Results

Under optimized conditions, all positive controls confirmed the specificity of group-specific PCR primers. Except for the detection of carbapenemase genes, multiplex and simplex PCR assays were carried out using the same PCR conditions, allowing assays to be performed in a single run. Out of 31 isolates selected, 22 strains produced an ESBL, mostly CTX-M-15 but also CTX-M-1 and CTX-M-9, SHV-12, SHV-5, SHV-2, TEM-21, TEM-52 and a VEB-type ESBL, 6 strains produced a plasmid-mediated AmpC β-lactamase (five DHA-1 and one CMY-2) and 3 strains produced both an ESBL (two SHV-12, one CTX-M-15) and a plasmid-mediated AmpC β-lactamase (DHA-1).

Conclusions

We report here the development of a useful method composed of a set of six multiplex PCRs and one simplex PCR for the rapid screening of the most frequently encountered β-lactamases. This method allowed direct sequencing from the PCR products.

Introduction

Resistance to β-lactam antibiotics is an increasing problem and β-lactamase production is the most common mechanism of drug resistance, especially in Gram-negative bacilli. β-Lactamases are remarkably diversified due to their continuous mutation.

Among them, extended-spectrum β-lactamases (ESBLs) are of great concern. ESBLs have been reported worldwide, most frequently in Enterobacteriaceae, but they have also been found in Pseudomonas spp. and Acinetobacter baumannii.1,2 During the 1990s, TEM-type ESBLs and SHV-type ESBLs were dominant. During the past decade, rapid and massive spread of CTX-M-type ESBLs has been described. These enzymes are now the most prevalent ESBLs in Enterobacteriaceae in Europe and in other areas of the world.3 Other ESBLs, less prevalent, have also been described as minor ESBLs; some of them, such as GES-type, PER-type and VEB-type β-lactamases, have now been isolated on several continents. Moreover, some GES variants also hydrolyse carbapenems.4

Although the plasmid-mediated AmpC β-lactamases are less common than ESBLs, they have been found in several areas of the world. Among them, the β-lactamase CMY-2 has the broadest geographical spread.5

Other β-lactamases conferring resistance to carbapenems, such as metallo-β-lactamases (MBLs) and KPC carbapenemases, but also some class D β-lactamases (e.g. OXA-48 in Enterobacteriaceae), have emerged more recently.6,7

Because many clinical isolates now harbour more than one β-lactamase, and due to the high diversity of these versatile enzymes, multiplex PCR methods are becoming widely used for their detection in epidemiological surveys.8–10

The purpose of the present work was to design reliable PCR assays with a maximum of consensus thermal cycling conditions for the rapid detection of frequently encountered β-lactamases by multiplexing. Six multiplex PCRs and one simplex PCR were designed, allowing direct sequencing from PCR products.

Materials and methods

Bacterial isolates

For optimization of the multiplex PCR assays, well characterized β-lactamase-producing strains were used as controls [Table S1, available as Supplementary data at JAC Online (http://jac.oxfordjournals.org/)]. Thirty-one non-repetitive Enterobacteriaceae strains isolated in 2006 from patients hospitalized in seven Parisian university hospitals were selected by disc diffusion due to their reduced susceptibility to broad-spectrum cephalosporins (e.g. cefotaxime, ceftazidime) and/or to cephamycins (e.g. cefoxitin) and/or to carbapenems (e.g. imipenem). Biochemical identification to species level was performed using the API 20E Identification System for Enterobacteriaceae (bioMérieux SA, Marcy-l'Étoile, France). They included strains of Proteus mirabilis (n = 2), Citrobacter freundii (n = 2), Enterobacter cloacae (n = 3), Escherichia coli (n = 9) and Klebsiella pneumoniae (n = 15). ESBL production was confirmed using the double-disc approximation test. AmpC β-lactamase production was evaluated by using cloxacillin (500 mg/L) as an inhibitor of AmpC enzymes. Imipenem discs supplemented with EDTA (Bio-Rad, Marnes-la-Coquette, France) were used for strains suspected of producing MBLs.

Design of group-specific primers for multiplex PCR assays

Six multiplex PCRs were designed in this study: a blaTEM/blaSHV/blaOXA-1-like multiplex PCR; a blaCTX-M multiplex PCR including phylogenetic groups 1, 2 and 9; a plasmid-mediated AmpC β-lactamase gene multiplex PCR including six groups based on percentage of similarity (as previously described by Pérez-Pérez and Hanson8); a blaVEB/blaGES/blaPER multiplex PCR; and two carbapenemase gene multiplex PCRs, one including blaVIM, blaIMP and blaKPC genes and the other blaGES and blaOXA-48-like genes. One simplex PCR was also designed for blaCTX-M-8/-25. For all of these genotypes, sequences were downloaded from the GenBank database and aligned within groups using the ClustalX software (version 2.0). Group-specific primers were designed to amplify internal fragments of several sizes (Table 1).

Table 1

Group-specific primers used for the assays

PCR name β-Lactamase(s) targeted Primer name Sequence (5′–3′) Length (bases) Annealing positiona Amplicon size (bp) Primer concentration (pmol/µL) 
Multiplex I TEM, SHV and OXA-1-like TEM variants including TEM-1 and TEM-2 MultiTSO-T_for CATTTCCGTGTCGCCCTTATTC 22 13–34 800 0.4 
MultiTSO-T_rev CGTTCATCCATAGTTGCCTGAC 22 812–791 0.4 
SHV variants including SHV-1 MultiTSO-S_for AGCCGCTTGAGCAAATTAAAC 21 71–91 713 0.4 
MultiTSO-S_rev ATCCCGCAGATAAATCACCAC 21 783–763 0.4 
OXA-1, OXA-4 and OXA-30 MultiTSO-O_for GGCACCAGATTCAACTTTCAAG 22 201–222 564 0.4 
MultiTSO-O_rev GACCCCAAGTTTCCTGTAAGTG 22 764–743 0.4 
Multiplex II CTX-M group 1, group 2 and group 9 variants of CTX-M group 1 including CTX-M-1, CTX-M-3 and CTX-M-15 MultiCTXMGp1_for TTAGGAARTGTGCCGCTGYAb 20 61–80 688 0.4 
MultiCTXMGp1-2_rev CGATATCGTTGGTGGTRCCATb 21 748–728 0.2 
variants of CTX-M group 2 including CTX-M-2 MultiCTXMGp2_for CGTTAACGGCACGATGAC 18 345–362 404 0.2 
MultiCTXMGp1-2_rev CGATATCGTTGGTGGTRCCATb 21 748–728 0.2 
variants of CTX-M group 9 including CTX-M-9 and CTX-M-14 MultiCTXMGp9_for TCAAGCCTGCCGATCTGGT 19 299–317 561 0.4 
MultiCTXMGp9_rev TGATTCTCGCCGCTGAAG 18 859–842 0.4 
CTX-M group 8/25 CTX-M-8, CTX-M-25, CTX-M-26 and CTX-M-39 to CTX-M-41 CTX-Mg8/25_for AACRCRCAGACGCTCTACb 18 172–189 326 0.4 
CTX-Mg8/25_rev TCGAGCCGGAASGTGTYATb 19 497–479 0.4 
Multiplex III ACC, FOX, MOX, DHA, CIT and EBC ACC-1 and ACC-2 MultiCaseACC_for CACCTCCAGCGACTTGTTAC 20 744–763 346 0.2 
MultiCaseACC_rev GTTAGCCAGCATCACGATCC 20 1089–1070 0.2 
FOX-1 to FOX-5 MultiCaseFOX_for CTACAGTGCGGGTGGTTT 18 396–413 162 0.5 
MultiCaseFOX_rev CTATTTGCGGCCAGGTGA 18 557–540 0.5 
MOX-1, MOX-2, CMY-1, CMY-8 to CMY-11 and CMY-19 MultiCaseMOX_for GCAACAACGACAATCCATCCT 21 3–23 895 0.2 
MultiCaseMOX_rev GGGATAGGCGTAACTCTCCCAA 22 900–879 0.2 
DHA-1 and DHA-2 MultiCaseDHA_for TGATGGCACAGCAGGATATTC 21 113–133 997 0.5 
MultiCaseDHA_rev GCTTTGACTCTTTCGGTATTCG 22 1109–1088 0.5 
LAT-1 to LAT-3, BIL-1, CMY-2 to CMY-7, CMY-12 to CMY-18 and CMY-21 to CMY-23 MultiCaseCIT_for CGAAGAGGCAATGACCAGAC 20 570–589 538 0.2 
MultiCaseCIT_rev ACGGACAGGGTTAGGATAGYb 20 1107–1088 0.2 
ACT-1 and MIR-1 MultiCaseEBC_for CGGTAAAGCCGATGTTGCG 19 189–207 683 0.2 
MultiCaseEBC_rev AGCCTAACCCCTGATACA 18 871–854 0.2 
Multiplex IV VEB, PER and GES GES-1 to GES-9 and GES-11 MultiGES_for AGTCGGCTAGACCGGAAAG 19 463–481 399 0.3 
MultiGES_rev TTTGTCCGTGCTCAGGAT 18 861–844 0.3 
PER-1 and PER-3 MultiPER_for GCTCCGATAATGAAAGCGT 19 325–343 520 0.3 
MultiPER_rev TTCGGCTTGACTCGGCTGA 19 844–826 0.3 
VEB-1 to VEB-6 MultiVEB_for CATTTCCCGATGCAAAGCGT 20 187–206 648 0.3 
MultiVEB_rev CGAAGTTTCTTTGGACTCTG 20 834–815 0.3 
Multiplex V GES and OXA-48-like GES-1 to GES-9 and GES-11 MultiGES_for AGTCGGCTAGACCGGAAAG 19 463–481 399 0.4 
MultiGES_rev TTTGTCCGTGCTCAGGAT 18 861–844 0.4 
OXA-48-like MultiOXA-48_for GCTTGATCGCCCTCGATT 18 230–247 281 0.4 
MultiOXA-48_rev GATTTGCTCCGTGGCCGAAA 20 490-510 0.4 
Multiplex VI IMP, VIM and KPC IMP variants except IMP-9, IMP-16, IMP-18, IMP-22 and IMP-25 MultiIMP_for TTGACACTCCATTTACDGb 18 194–211 139 0.5 
MultiIMP_rev GATYGAGAATTAAGCCACYCTb 21 332–313 0.5 
VIM variants including VIM-1 and VIM-2 MultiVIM_forc GATGGTGTTTGGTCGCATA 19 151–169 390 0.5 
MultiVIM_revc CGAATGCGCAGCACCAG 17 540–524 0.5 
KPC-1 to KPC-5 MultiKPC_for CATTCAAGGGCTTTCTTGCTGC 22 209–230 538 0.2 
MultiKPC_rev ACGACGGCATAGTCATTTGC 20 746–727 0.2 
PCR name β-Lactamase(s) targeted Primer name Sequence (5′–3′) Length (bases) Annealing positiona Amplicon size (bp) Primer concentration (pmol/µL) 
Multiplex I TEM, SHV and OXA-1-like TEM variants including TEM-1 and TEM-2 MultiTSO-T_for CATTTCCGTGTCGCCCTTATTC 22 13–34 800 0.4 
MultiTSO-T_rev CGTTCATCCATAGTTGCCTGAC 22 812–791 0.4 
SHV variants including SHV-1 MultiTSO-S_for AGCCGCTTGAGCAAATTAAAC 21 71–91 713 0.4 
MultiTSO-S_rev ATCCCGCAGATAAATCACCAC 21 783–763 0.4 
OXA-1, OXA-4 and OXA-30 MultiTSO-O_for GGCACCAGATTCAACTTTCAAG 22 201–222 564 0.4 
MultiTSO-O_rev GACCCCAAGTTTCCTGTAAGTG 22 764–743 0.4 
Multiplex II CTX-M group 1, group 2 and group 9 variants of CTX-M group 1 including CTX-M-1, CTX-M-3 and CTX-M-15 MultiCTXMGp1_for TTAGGAARTGTGCCGCTGYAb 20 61–80 688 0.4 
MultiCTXMGp1-2_rev CGATATCGTTGGTGGTRCCATb 21 748–728 0.2 
variants of CTX-M group 2 including CTX-M-2 MultiCTXMGp2_for CGTTAACGGCACGATGAC 18 345–362 404 0.2 
MultiCTXMGp1-2_rev CGATATCGTTGGTGGTRCCATb 21 748–728 0.2 
variants of CTX-M group 9 including CTX-M-9 and CTX-M-14 MultiCTXMGp9_for TCAAGCCTGCCGATCTGGT 19 299–317 561 0.4 
MultiCTXMGp9_rev TGATTCTCGCCGCTGAAG 18 859–842 0.4 
CTX-M group 8/25 CTX-M-8, CTX-M-25, CTX-M-26 and CTX-M-39 to CTX-M-41 CTX-Mg8/25_for AACRCRCAGACGCTCTACb 18 172–189 326 0.4 
CTX-Mg8/25_rev TCGAGCCGGAASGTGTYATb 19 497–479 0.4 
Multiplex III ACC, FOX, MOX, DHA, CIT and EBC ACC-1 and ACC-2 MultiCaseACC_for CACCTCCAGCGACTTGTTAC 20 744–763 346 0.2 
MultiCaseACC_rev GTTAGCCAGCATCACGATCC 20 1089–1070 0.2 
FOX-1 to FOX-5 MultiCaseFOX_for CTACAGTGCGGGTGGTTT 18 396–413 162 0.5 
MultiCaseFOX_rev CTATTTGCGGCCAGGTGA 18 557–540 0.5 
MOX-1, MOX-2, CMY-1, CMY-8 to CMY-11 and CMY-19 MultiCaseMOX_for GCAACAACGACAATCCATCCT 21 3–23 895 0.2 
MultiCaseMOX_rev GGGATAGGCGTAACTCTCCCAA 22 900–879 0.2 
DHA-1 and DHA-2 MultiCaseDHA_for TGATGGCACAGCAGGATATTC 21 113–133 997 0.5 
MultiCaseDHA_rev GCTTTGACTCTTTCGGTATTCG 22 1109–1088 0.5 
LAT-1 to LAT-3, BIL-1, CMY-2 to CMY-7, CMY-12 to CMY-18 and CMY-21 to CMY-23 MultiCaseCIT_for CGAAGAGGCAATGACCAGAC 20 570–589 538 0.2 
MultiCaseCIT_rev ACGGACAGGGTTAGGATAGYb 20 1107–1088 0.2 
ACT-1 and MIR-1 MultiCaseEBC_for CGGTAAAGCCGATGTTGCG 19 189–207 683 0.2 
MultiCaseEBC_rev AGCCTAACCCCTGATACA 18 871–854 0.2 
Multiplex IV VEB, PER and GES GES-1 to GES-9 and GES-11 MultiGES_for AGTCGGCTAGACCGGAAAG 19 463–481 399 0.3 
MultiGES_rev TTTGTCCGTGCTCAGGAT 18 861–844 0.3 
PER-1 and PER-3 MultiPER_for GCTCCGATAATGAAAGCGT 19 325–343 520 0.3 
MultiPER_rev TTCGGCTTGACTCGGCTGA 19 844–826 0.3 
VEB-1 to VEB-6 MultiVEB_for CATTTCCCGATGCAAAGCGT 20 187–206 648 0.3 
MultiVEB_rev CGAAGTTTCTTTGGACTCTG 20 834–815 0.3 
Multiplex V GES and OXA-48-like GES-1 to GES-9 and GES-11 MultiGES_for AGTCGGCTAGACCGGAAAG 19 463–481 399 0.4 
MultiGES_rev TTTGTCCGTGCTCAGGAT 18 861–844 0.4 
OXA-48-like MultiOXA-48_for GCTTGATCGCCCTCGATT 18 230–247 281 0.4 
MultiOXA-48_rev GATTTGCTCCGTGGCCGAAA 20 490-510 0.4 
Multiplex VI IMP, VIM and KPC IMP variants except IMP-9, IMP-16, IMP-18, IMP-22 and IMP-25 MultiIMP_for TTGACACTCCATTTACDGb 18 194–211 139 0.5 
MultiIMP_rev GATYGAGAATTAAGCCACYCTb 21 332–313 0.5 
VIM variants including VIM-1 and VIM-2 MultiVIM_forc GATGGTGTTTGGTCGCATA 19 151–169 390 0.5 
MultiVIM_revc CGAATGCGCAGCACCAG 17 540–524 0.5 
KPC-1 to KPC-5 MultiKPC_for CATTCAAGGGCTTTCTTGCTGC 22 209–230 538 0.2 
MultiKPC_rev ACGACGGCATAGTCATTTGC 20 746–727 0.2 

aAnnealing position within the corresponding open reading frame (from the base A of start codon ATG).

bY = T or C; R = A or G; S = G or C; D = A or G or T.

cThis primer pair was previously described by Ellington et al.10

Multiplex PCR technique

Rapid DNA preparation was performed from one heated colony in a total volume of 100 µL of distilled water (95°C for 10 min) followed by a centrifugation step of the cell suspension. Total DNA (2 µL) was subjected to each multiplex PCR in a 50 µL reaction mixture containing 1× PCR buffer (10 mM Tris–HCl, pH 8.3/50 mM KCl/1.5 mM MgCl2), 200 µM concentration of each deoxynucleotide triphosphate, a variable concentration of specific-group primers (Table 1) and 1 U of Taq polymerase (Sigma Aldrich, St Quentin Fallavier, France). Amplification was carried out as follows: initial denaturation at 94°C for 10 min; 30 cycles of 94°C for 40 s, 60°C for 40 s and 72°C for 1 min; and a final elongation step at 72°C for 7 min. For the carbapenemase gene multiplex PCR assays, the annealing temperature was optimal at 55°C for amplification of blaVIM, blaIMP and blaKPC genes, and optimal at 57°C for amplification of blaGES and blaOXA-48 genes. Amplicons were visualized after running at 100 V for 1 h on a 2% agarose gel containing ethidium bromide. A 100 bp DNA ladder (New England Biolabs, Ipswich, MA, USA) was used as a size marker.

Sequencing analysis of multiplex PCR products

To identify the β-lactamase genes detected in the multiplex PCR assays, DNA sequence analyses of the amplicons were performed. Amplified PCR products were purified using the ExoSap purification kit (ExoSap-it, GE Healthcare, Piscataway, NJ, USA) and bidirectional sequencing was performed. Each sequence was then compared with already known β-lactamase gene sequences by multiple-sequence alignment using the BLAST program.

Nucleotide sequence accession numbers

The GenBank nucleotide sequence accession numbers for the sequences studied in this study are detailed in Table S2 [available as Supplementary data at JAC Online (http://jac.oxfordjournals.org/)].

Results and discussion

Analysis of the set of multiplex PCRs and simplex PCR

After optimizing the amplification conditions for each assay, amplicons of the expected sizes were obtained from all control strains used separately or mixed (Table S1) confirming the group specificity of the primers (Figure 1). For example, every template of the SHV family resulted in a 713 bp amplicon (Figure 1a).

Figure 1

Multiplex PCR assays. (a) Multiplex PCR assay for the blaTEM/blaSHV/blaOXA-like genes, amplification from control strains. Multiplex PCR products were separated in a 2% agarose gel. Lanes: 1, E. coli TN13; 2, E. cloacae 4861; 3, K. oxytoca 1376; 4, K. pneumoniae 169; 5, K. pneumoniae SLKM; 6, K. pneumoniae FLO; 7, Salmonella spp. RGN238; 8, K. pneumoniae SLK54; 9, K. pneumoniae BHR; 10, K. pneumoniae KOL; 11, K. oxytoca 1376 + Salmonella spp. RGN238; 12, K. pneumoniae KOL + Salmonella spp. RGN238; 13, negative control; M, molecular size marker (in bp). (b) Multiplex PCR assay for the blaCTX-M genes including phylogenetic group 1, group 2 and group 9, amplification from control strains. Multiplex PCR products were separated in a 2% agarose gel. Lanes: 1, E. coli TN16; 2, E. coli TN03; 3, K. pneumoniae BHR; 4, K. pneumoniae LT; 5, E. coli TN19; 6, E. coli TN13; 7, E. coli TN07; 8, E. coli TN05; 9, K. pneumoniae H610; 10, E. coli C7; 11, E. coli TN05 + E. coli TN03; 12, E. coli TN05 + E. coli TN19; 13, E. coli TN05 + E. coli TN03 + E. coli TN19; 14, negative control; M, molecular size marker (in bp). (c) Multiplex PCR assay for the plasmid-mediated AmpC β-lactamase genes, amplification from control strains. Multiplex PCR products were separated in a 2% agarose gel. Lanes: 1, K. pneumoniae 1734; 2, K. pneumoniae 760; 3, E. coli C600 pMG231; 4, E. coli BS; 5, K. pneumoniae 169; 6, P. mirabilis 34955; 7, K. pneumoniae KOL; 8, K. pneumoniae SLK54; 9, K. pneumoniae SLK54 + K. pneumoniae 1734 + K. pneumoniae 760 + E. coli C600 pMG231 + P. mirabilis 34955 + K. pneumoniae KOL; 10, negative control; M, molecular size marker (in bp). (d) Multiplex PCR assay for the blaVIM/blaIMP /blaKPC genes, amplification from control strains. Multiplex PCR products were separated in a 2% agarose gel. Lanes: 1, E. cloacae 4861; 2, K. pneumoniae BHR; 3, K. pneumoniae FLO; 4, P. aeruginosa 73257; 5, A. baumannii 2318; 6, K. pneumoniae FLO + A. baumannii 2318; 7, E. cloacae 4861 + K. pneumoniae FLO; 8, negative control; M, molecular size marker (in bp). (e) Multiplex PCR assay for the blaVEB/blaGES/blaPER genes, amplification from control strains. Multiplex PCR products were separated in a 2% agarose gel. Lanes: 1, K. pneumoniae ORI-1; 2, E. coli 14R519(pHT9); 3, Providencia stuartii Ps5; 4, E. coli 394; 5, negative control; 6, K. pneumoniae ORI-1 + P. stuartii Ps5 + E. coli 394; M, molecular size marker (in bp). (f) Multiplex PCR assay for the blaGES/blaOXA-48-like genes, amplification from control strains. Multiplex PCR products were separated in a 2% agarose gel. Lanes: 1, K. pneumoniae ORI-1 + K. pneumoniae 11978; 2, K. pneumoniae ORI-1; 3, K. pneumoniae 11978; 4, negative control; M, molecular size marker (in bp).

Figure 1

Multiplex PCR assays. (a) Multiplex PCR assay for the blaTEM/blaSHV/blaOXA-like genes, amplification from control strains. Multiplex PCR products were separated in a 2% agarose gel. Lanes: 1, E. coli TN13; 2, E. cloacae 4861; 3, K. oxytoca 1376; 4, K. pneumoniae 169; 5, K. pneumoniae SLKM; 6, K. pneumoniae FLO; 7, Salmonella spp. RGN238; 8, K. pneumoniae SLK54; 9, K. pneumoniae BHR; 10, K. pneumoniae KOL; 11, K. oxytoca 1376 + Salmonella spp. RGN238; 12, K. pneumoniae KOL + Salmonella spp. RGN238; 13, negative control; M, molecular size marker (in bp). (b) Multiplex PCR assay for the blaCTX-M genes including phylogenetic group 1, group 2 and group 9, amplification from control strains. Multiplex PCR products were separated in a 2% agarose gel. Lanes: 1, E. coli TN16; 2, E. coli TN03; 3, K. pneumoniae BHR; 4, K. pneumoniae LT; 5, E. coli TN19; 6, E. coli TN13; 7, E. coli TN07; 8, E. coli TN05; 9, K. pneumoniae H610; 10, E. coli C7; 11, E. coli TN05 + E. coli TN03; 12, E. coli TN05 + E. coli TN19; 13, E. coli TN05 + E. coli TN03 + E. coli TN19; 14, negative control; M, molecular size marker (in bp). (c) Multiplex PCR assay for the plasmid-mediated AmpC β-lactamase genes, amplification from control strains. Multiplex PCR products were separated in a 2% agarose gel. Lanes: 1, K. pneumoniae 1734; 2, K. pneumoniae 760; 3, E. coli C600 pMG231; 4, E. coli BS; 5, K. pneumoniae 169; 6, P. mirabilis 34955; 7, K. pneumoniae KOL; 8, K. pneumoniae SLK54; 9, K. pneumoniae SLK54 + K. pneumoniae 1734 + K. pneumoniae 760 + E. coli C600 pMG231 + P. mirabilis 34955 + K. pneumoniae KOL; 10, negative control; M, molecular size marker (in bp). (d) Multiplex PCR assay for the blaVIM/blaIMP /blaKPC genes, amplification from control strains. Multiplex PCR products were separated in a 2% agarose gel. Lanes: 1, E. cloacae 4861; 2, K. pneumoniae BHR; 3, K. pneumoniae FLO; 4, P. aeruginosa 73257; 5, A. baumannii 2318; 6, K. pneumoniae FLO + A. baumannii 2318; 7, E. cloacae 4861 + K. pneumoniae FLO; 8, negative control; M, molecular size marker (in bp). (e) Multiplex PCR assay for the blaVEB/blaGES/blaPER genes, amplification from control strains. Multiplex PCR products were separated in a 2% agarose gel. Lanes: 1, K. pneumoniae ORI-1; 2, E. coli 14R519(pHT9); 3, Providencia stuartii Ps5; 4, E. coli 394; 5, negative control; 6, K. pneumoniae ORI-1 + P. stuartii Ps5 + E. coli 394; M, molecular size marker (in bp). (f) Multiplex PCR assay for the blaGES/blaOXA-48-like genes, amplification from control strains. Multiplex PCR products were separated in a 2% agarose gel. Lanes: 1, K. pneumoniae ORI-1 + K. pneumoniae 11978; 2, K. pneumoniae ORI-1; 3, K. pneumoniae 11978; 4, negative control; M, molecular size marker (in bp).

The evaluation of chromosomal cross-hybridization was then performed with probable interfering species according to the set studied. An amplicon was observed with the species Kluyvera ascorbata and Kluyvera georgiana, respectively, when specific primers of blaCTX-M group 2 and groups 8/25 were used (Table S1). In the same way, amplicons of the ACC, EBC and DHA groups were observed, respectively, when the DNAs from Hafnia alvei, Enterobacter asburiae or Morganella morganii were used as template. No amplification product was observed from any other tested strains harbouring an AmpC gene, in contrast to the method of Pérez-Pérez and Hanson,8 where an AmpC gene from C. freundii and E. cloacae was amplified.

Eventually, chromosomal class A genes from K. pneumoniae belonging to the phylogenetic group KpI were amplified with the group-specific primers of the SHV family.

Evaluation of direct sequencing from PCR products

Direct sequencing from amplicons was shown to be possible. Most amplicons contained major substitutions allowing the identification of a high number of β-lactamases. To a lesser extent, the identification of clusters of β-lactamases (each cluster containing a unique well-known enzyme) can be performed by this technique.

In the blaTEM/blaSHV/blaOXA-1-like multiplex PCR, OXA-1-like β-lactamases cannot be distinguished by direct sequencing. However, due to the method, most of the TEM-type ESBL variants can be differentiated. In the same way, discrimination between ESBLs and TEM-type broad-spectrum β-lactamases became feasible, such as the distinction between SHV ESBL derivatives and SHV broad-spectrum β-lactamase variants. Another example can be found with the blaCTX-M multiplex PCR; the main β-lactamases belonging to phylogenetic group 1 can be discriminated. Thus, CTX-M-3 can be distinguished from CTX-M-1, and both can be differentiated from the CTX-M-15 β-lactamase. However, the common β-lactamases CTX-M-15 and CTX-M-28 cannot be separated.

For them and for other β-lactamases for whom direct sequencing is not sufficiently discriminating, further analysis may be necessary to identify the corresponding bla gene.

Evaluation of the six multiplex PCRs and the simplex PCR with clinical strains

In order to confirm the specificity of the set, simplex and multiplex PCR assays were performed on the 31 clinical strains selected according to their susceptibility profiles. All PCR products were submitted to direct sequencing.

ESBLs were detected in 22 isolates (71%), plasmid-mediated AmpC β-lactamases were observed in 6 isolates (19%) and 3 isolates (10%) produced both an ESBL and a plasmid-mediated AmpC β-lactamase. Isolates often carried two, occasionally three, different types of broad-spectrum β-lactamase (SHV-1, SHV-11, OXA-1 or TEM-1).

Major ESBL-producing isolates were CTX-M type, including 15 from phylogenetic group 1 (14 CTX-M-15 and 1 CTX-M-1) and 2 belonging to phylogenetic group 9 (CTX-M-9). TEM-type ESBLs (two TEM-21 and one TEM-52), SHV-type ESBLs (two SHV-12, one SHV-2 and one SHV-5) and one VEB-type ESBL were also detected. For the latter, no discrimination was possible by direct sequencing between the VEB-4, VEB-5 and VEB-6 β-lactamases.

DHA-1 enzymes were the most frequently observed plasmid-mediated AmpC β-lactamases (found in eight isolates); only one AmpC β-lactamase belonged to the CMY-2 group. Among the three isolates producing both an ESBL and a plasmid-mediated AmpC β-lactamase, two strains were found to co-produce DHA-1 and SHV-12, and the third strain was found to co-produce DHA-1 and CTX-M-15. None of the carbapenemase genes targeted was found in this study. Reduced susceptibility to imipenem found in one K. pneumoniae isolate was probably due to a decrease in permeability of the outer membrane. A complete description of the β-lactamases characterized in the 31 enterobacterial isolates is available in Table S3 [available as Supplementary data at JAC Online (http://jac.oxfordjournals.org/)].

Conclusions

In summary, we report here the development of six multiplex PCRs and one simplex PCR that are able to detect prevalent β-lactamases. This PCR method is a fast, low-cost and reliable tool for the screening of frequently encountered β-lactamases. It will assist in monitoring their emergence and their spread, and it could be used in epidemiological surveys. To conclude, our study showed the high prevalence of CTX-M-type ESBLs belonging to phylogenetic group 1 among our panel of ESBL-producing Enterobacteriaceae strains, and the absence of detection of carbapenemases.

Funding

This work was supported by a subvention from the Association Nationale de la Recherche et de la Technologie, France (convention industrielle de formation par la recherche no. 1058/2006) and by financial support from Bio-Rad Laboratories Inc.

Transparency declarations

None to declare.

Supplementary data

Tables S1, S2 and S3 are available as Supplementary data at JAC Online (http://jac.oxfordjournals.org/).

Acknowledgements

For very kindly providing some control strains used in the development of this work, we are grateful to E. Tzelepi, R. Bonnet, P. Nordmann and their teams as well as Bio-Rad Laboratories Inc. We are also grateful to Mickaël Anselmi for technical assistance.

References

1
Bradford
PA
Extended-spectrum β-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat
Clin Microbiol Rev
 , 
2001
, vol. 
14
 (pg. 
933
-
51
)
2
Paterson
DL
Bonomo
RA
Extended-spectrum β-lactamases: a clinical update
Clin Microbiol Rev
 , 
2005
, vol. 
18
 (pg. 
657
-
86
)
3
Coque
TM
Baquero
F
Canton
R
Increasing prevalence of ESBL-producing Enterobacteriaceae in Europe
Euro Surveill
 , 
2008
, vol. 
13
  
pii=19044
4
Naas
T
Poirel
L
Nordmann
P
Minor extended-spectrum β-lactamases
Clin Microbiol Infect
 , 
2008
, vol. 
14
 
Suppl 1
(pg. 
42
-
52
)
5
Jacoby
GA
AmpC β-lactamases
Clin Microbiol Rev
 , 
2009
, vol. 
22
 (pg. 
161
-
82
)
6
Cuzon
G
Naas
T
Bogaerts
P
, et al.  . 
Plasmid-encoded carbapenem-hydrolyzing β-lactamase OXA-48 in an imipenem-susceptible Klebsiella pneumoniae strain from Belgium
Antimicrob Agents Chemother
 , 
2008
, vol. 
52
 (pg. 
3463
-
4
)
7
Samuelsen
O
Naseer
U
Tofteland
S
, et al.  . 
Emergence of clonally related Klebsiella pneumoniae isolates of sequence type 258 producing plasmid-mediated KPC carbapenemase in Norway and Sweden
J Antimicrob Chemother
 , 
2009
, vol. 
63
 (pg. 
654
-
8
)
8
Pérez-Pérez
FJ
Hanson
ND
Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR
J Clin Microbiol
 , 
2002
, vol. 
40
 (pg. 
2153
-
62
)
9
Woodford
N
Fagan
EJ
Ellington
MJ
Multiplex PCR for rapid detection of genes encoding CTX-M extended-spectrum β-lactamases
J Antimicrob Chemother
 , 
2006
, vol. 
57
 (pg. 
154
-
5
)
10
Ellington
MJ
Kistler
J
Livermore
DM
, et al.  . 
Multiplex PCR for rapid detection of genes encoding acquired metallo-β-lactamases
J Antimicrob Chemother
 , 
2007
, vol. 
59
 (pg. 
321
-
2
)