Abstract

Objectives

Direct SOS-dependent regulation of qnrB genes by fluoroquinolones mediated by LexA was reported. The smaqnr gene, on the Serratia marcescens chromosome, and qnrD both contain a putative LexA box. The aim of this study was to evaluate whether smaqnr or qnrD genes are induced via SOS-dependent mechanisms, and to investigate whether other antimicrobial agents induce qnrB, qnrD and smaqnr expression.

Methods

RT–PCR was used to evaluate qnrB1, qnrD and smaqnr expression. Different concentrations of ciprofloxacin, levofloxacin, moxifloxacin and ceftazidime were evaluated as inducers. Additionally, the promoter regions of qnrB1, qnrD and smaqnr were fused transcriptionally to green fluorescent protein and used in reporter gene assays. Disc diffusion assays with different antimicrobial agents were used to detect induction. Measurements of transcriptional induction by ciprofloxacin were carried out using a plate reader.

Results

RT–PCR assays showed that qnrB1, qnrD and smaqnr were induced at different concentrations of ciprofloxacin, moxifloxacin, levofloxacin and ceftazidime, increasing transcription 1.5- to 16.3-fold compared with basal expression, and depending on the antimicrobial agent and promoter analysed. The reporter gene assays showed that the qnrB1, qnrD and smaqnr genes were induced by ciprofloxacin, as expected, but also by ceftazidime, ampicillin and trimethoprim in Escherichia coli wild-type strains, but not in the recA-deficient E. coli HB101. Induction was not evident for imipenem or gentamicin.

Conclusions

β-Lactams and trimethoprim, along with fluoroquinolones, induce transcription of qnrB, qnrD and smaqnr genes using SOS-dependent regulation. These results show the direct SOS-dependent regulation of a low-level fluoroquinolone resistance mechanism in response to other antimicrobials.

Introduction

The number of publications about plasmid-mediated quinolone resistance mechanisms, mainly those containing qnr genes, has increased in the last decade. These genes confer low-level resistance to quinolones, and protect the bacterial DNA gyrase and topoisomerase IV from quinolone inhibition.1,2 Since the first plasmid-encoded determinant, qnrA, was described, other plasmid-mediated qnr genes have been identified: qnrB, qnrS, qnrC and qnrD,3–7 included in different protein families whose amino acid sequences differ from each other by ≥30%.8 With the recently described ASqnr, SMqnr, VPqnr and VVqnr proteins, the Qnr proteins currently comprise a varied pool of pentapeptide repeat proteins implicated in quinolone resistance.9–11

A new pentapeptide repeat protein, named SmaQnr, has recently been reported from the chromosome of Serratia marcescens.12 This protein confers low-level quinolone resistance when expressed in Escherichia coli. The SmaQnr protein shares 80% amino acid identity with QnrB1. The upstream sequence of the smaqnr gene contains a putative LexA box, similar to the one found in qnrB1, whose expression is regulated by the SOS system.13,14 Ciprofloxacin and mitomycin C, both SOS activators, increase qnrB expression between 2- and 9-fold, depending on the antimicrobial and genetic background.13 This LexA box is absent in qnrA, qnrS and qnrC, but present in qnrD. QnrD and SmaQnr are the pentapeptide repeat proteins most closely related to QnrB.12

LexA is the main regulator of the SOS system and is activated in response to DNA damage. Single-stranded DNA (ssDNA) is produced and the coprotease activity of RecA is activated by binding to the ssDNA. The interaction between LexA and the filament complex, RecA–ssDNA, leads to the proteolytic cleavage of LexA, and eventually to derepression of the promoters to which LexA is bound.15 It has been demonstrated that some antimicrobials are able to activate the SOS response by causing bacterial stress.16–19

The aim of this study was to evaluate whether smaqnr and qnrD expression are induced by quinolones in an SOS-dependent manner and to investigate whether other antimicrobial agents, such as β-lactams or trimethoprim, induce smaqnr, qnrB and qnrD expression, promoting low levels of quinolone resistance.

Materials and methods

Bacterial strains and culture conditions

S. marcescens 257 reference strain (Institut Pasteur collection), E. coli J53 AzR (resistant to sodium azide) carrying a natural plasmid harbouring qnrB1 (from a clinical isolate)20 and E. coli J53 AzR carrying a natural plasmid harbouring qnrD (from plasmid p2007057, accession number FJ228229) were used for RT–PCR assays.

For reporter gene assays, three E. coli wild-type strains (MG1655, ATCC 25922 and RR1) and E. coli HB101 (recA deficient and isogenic to RR1) were used as bacterial recipients of plasmid constructions (Table 1).

Table 1.

Bacterial strains and plasmids used in this study

 Characteristics 
Bacterial strain 
E. coli ATCC 25922 American collection strain 
E. coli MG1655 F, lambda, rph-1 
E. coli MG1655NalR F, lambda, rph-1, NalR 
E. coli RR1 supE44 hsdS20(rBmB) ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1 
E. coli HB101 supE44 hsdS20(rBmB) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1 
E. coli J53 AzR sodium azide resistant 
S. marcescens 257 Institut Pasteur collection 
Plasmids 
 pCR-Blunt II-TOPO cloning vector 
 pMS201 low copy, GFP reporter vector (reppSC101 KmRgfp
 Characteristics 
Bacterial strain 
E. coli ATCC 25922 American collection strain 
E. coli MG1655 F, lambda, rph-1 
E. coli MG1655NalR F, lambda, rph-1, NalR 
E. coli RR1 supE44 hsdS20(rBmB) ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1 
E. coli HB101 supE44 hsdS20(rBmB) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1 
E. coli J53 AzR sodium azide resistant 
S. marcescens 257 Institut Pasteur collection 
Plasmids 
 pCR-Blunt II-TOPO cloning vector 
 pMS201 low copy, GFP reporter vector (reppSC101 KmRgfp

All bacteria were grown in LB broth at 37°C. Antibiotics were used as required at the following concentrations: 30 mg/L kanamycin and 100 mg/L ampicillin.

Plasmid constructions

Promoter regions were amplified by PCR using specific primers (Table S1, available as Supplementary data at JAC Online). About 200 bp upstream of the coding sequence of each gene was amplified. PCR fragments were cloned into the pCR-Blunt II-TOPO, following the manufacturer's recommendations (Invitrogen, Carlsbad, CA, USA). The recombinant plasmids were digested with XhoI and BamHI (Fermentas, Madrid, Spain) and the purified digested fragments were cloned to the promoterless vector pMS201 after digestion.21,22

Real-time quantitative RT–PCR

Expression of the smaqnr, qnrB1 and qnrD genes was analysed by real-time RT–PCR, and quantified relative to the rpoB gene of S. marcescens and the mdH gene of E. coli. The fluoroquinolones (ciprofloxacin, levofloxacin and moxifloxacin) were tested as possible inducers at concentrations of 1/2×, 1/4× and 1/8× MIC, and ceftazidime at 1/2× MIC. Mitomycin C was used as an inducer (positive control). Strains were grown (at 37°C) to exponential phase (OD600 = 0.3–0.4) and the inducer added for 45 min. A culture without drug was used as control. RNA extraction was performed using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Contaminating DNA was removed from RNA samples with TURBO DNA-free (Ambion, USA). cDNA synthesis was performed with the Transcriptor First Strand cDNA Synthesis Kit (Roche, Indianapolis, IN, USA) using random primers. Quantitative PCR was carried out in a LightCycler machine (Roche, Indianapolis, IN, USA) using the FastStart DNA Master SYBR-Green I Kit (Roche, Indianapolis, IN, USA) and specific primers, listed in Table S1, available as Supplementary data at JAC Online. Normalized expression levels of target gene transcripts were calculated relative to rpoB of S. marcescens (mdh of E. coli) using the 2−ΔΔCT method.23

Effect of antimicrobial agents on qnr gene expression

Disc diffusion (AB Biodisk, Solna, Sweden) demonstrated induction of the cloned promoters using several antimicrobial agents: fluoroquinolones (ciprofloxacin, 5 μg; and norfloxacin, 10 μg), β-lactams (piperacillin/tazobactam, 36 μg; ceftazidime, 30 μg; aztreonam, 30 μg; cefotetan, 30 μg; cefepime, 30 μg; cefuroxime, 30 μg; cefpirome, 30 μg; and ampicillin, 10 μg), trimethoprim (300 μg), imipenem (10 μg), rifampicin (30 μg), gentamicin (10 μg), chloramphenicol (30 μg) and colistin (10 μg). Susceptibility testing assays were carried out following CLSI guidelines.24 Plates were visualized under a blue-light lamp after 24 h of incubation at 37°C.

Fluorescence measurements

Single colonies of every bacterial strain of E. coli RR1 were inoculated and grown at 37°C for 16 h. Cultures were diluted 10 000-fold in fresh medium containing 30 mg/L kanamycin, with and without ciprofloxacin at different concentrations (1/2×, 1/4× and 1/8× MIC of ciprofloxacin). Aliquots of 150 μL were transferred to 96-well plates (Greiner 96 Flat Bottom Transparent Polystyrene) in triplicate and cultures grown in an Infinite 200 Pro plate reader (Tecan Trading AG, Switzerland), controlled by i-control software (Tecan Trading AG, Switzerland) at 37°C for 24 h, with 10 s of linear shaking every hour, before measurements were taken. The parameters used to measure the optical density of each well were: wavelength, 595 nm; and bandwidth, 10 nm. Fluorescence was monitored at: excitation wavelength, 485 nm; excitation bandwidth, 20 nm; emission wavelength, 535 nm; and emission bandwidth, 25 nm.

Results and discussion

The qnr genes are plasmid-borne quinolone resistance determinants found worldwide in Enterobacteriaceae. The number of members of this family has been increasing over the past decade, although little is known of their regulation or expression. Recently, more in-depth research about the regulation and biological function of these proteins has been published. To date, the data available related to qnr gene regulation show that expression of qnrA is related to cold-shock response in Shewanella algae.25 In the case of qnrS, an induction of expression by quinolones has been reported in a non-SOS-dependent pathway.26 A LexA-binding site was described in the sequence upstream of qnrB. This sequence is conserved in the promoter regions of the different variants of qnrB and its expression is under SOS control, being induced by ciprofloxacin and mitomycin C.13,14 Fluoroquinolones, as well as other antimicrobial agents, such as trimethoprim or ampicillin, are able to activate the SOS response in a LexA-RecA-dependent way.16,18,27

In silico analysis of promoter region

In silico analysis of the recently described gene family of S. marcescens, smaqnr, showed the presence of a LexA box upstream of the smaqnr gene.12 When in silico analysis was extended to the more recently described qnr genes (qnrD and qnrC), a LexA-binding site was found upstream of the qnrD sequence, but not in the qnrC gene. The canonical sequence of the LexA box is TACTGTATATATATACAGTA, with a high degree of conservation within the gammaproteobacteria.17 The essential sequence of this regulatory box is CTGT and ACAG flanking a TA4 central region, and the internal sequence is known to vary in different LexA boxes.28,29 The smaqnr and qnrD LexA-binding sites are found in both cases downstream of the −10 box sequence, in a similar position compared with qnrB1 (Figure 1). In the qnrB1 and smaqnr sequences, the LexA box is found three nucleotides downstream of the +1 start site, whereas the LexA box in qnrD, whose essential LexA sequence has one nucleotide change, is found immediately after the +1 start site. In contrast, the LexA box present in the recA gene (used as a control) is located between the −35 and −10 promoter sequences. The distance from the regulatory LexA box to the coding sequence also varied. The different positions of the LexA box could be partly responsible for the differences observed in terms of induction.

Figure 1.

Comparison of the promoter region with the LexA-binding site of recA, qnrB1, qnrD and smaqnr. The LexA-binding site is boxed, the −35 and −10 promoter sequences are shown underlined, the +1 start site is represented by a dot and the beginning of the coding sequence is in bold letters. Data obtained from the BPROM bioinformatics tool and Da Re et al.14

Figure 1.

Comparison of the promoter region with the LexA-binding site of recA, qnrB1, qnrD and smaqnr. The LexA-binding site is boxed, the −35 and −10 promoter sequences are shown underlined, the +1 start site is represented by a dot and the beginning of the coding sequence is in bold letters. Data obtained from the BPROM bioinformatics tool and Da Re et al.14

Analysis of qnrB, qnrD and smaqnr expression

The S. marcescens 257 strain was susceptible to ciprofloxacin, levofloxacin and moxifloxacin. This strain had no amino acid changes in the GyrA or ParC quinolone resistance determining region (QRDR) region (data not shown). RT–PCR assays showed that the addition of ciprofloxacin, levofloxacin or moxifloxacin induced smaqnr gene expression. The highest level of expression was obtained at 1/2× MIC of levofloxacin, which was 8.7 higher than that of the control strain without levofloxacin (Table 2). Ciprofloxacin induced the expression 3- to 6- fold in comparison with the control and was dependent on the concentration of antimicrobial agent used. These results agree with those published by Wang et al.,13 who showed a 2.1- to 9-fold increased expression in different variants of qnrB in the presence of ciprofloxacin. Moxifloxacin had the lowest effect, with a 2-fold increase at 1/2× MIC of moxifloxacin.

Table 2.

Relative qnr gene expression induced by ciprofloxacin, levofloxacin, moxifloxacin and ceftazidime

 Relative RNA transcript level in the presence ofa
 
 CIPb
 
LVXc
 
MXFd
 
CAZe
 
Gene 1/2× MIC 1/4× MIC 1/2× MIC 1/4× MIC 1/2× MIC 1/4× MIC 1/2× MIC 
qnrB1 5.3 3.9 14.5 7.1 16.3 1.5 
qnrD 9.1 2.8 1.1 1.7 0.8 0.8 1.5 
smaqnr 6.1 3.6 8.7 7.3 2.1 4.6 
 Relative RNA transcript level in the presence ofa
 
 CIPb
 
LVXc
 
MXFd
 
CAZe
 
Gene 1/2× MIC 1/4× MIC 1/2× MIC 1/4× MIC 1/2× MIC 1/4× MIC 1/2× MIC 
qnrB1 5.3 3.9 14.5 7.1 16.3 1.5 
qnrD 9.1 2.8 1.1 1.7 0.8 0.8 1.5 
smaqnr 6.1 3.6 8.7 7.3 2.1 4.6 

aAll measurements were repeated at least twice.

bCiprofloxacin (CIP) MIC for J53 qnrB was 0.125 mg/L, J53 qnrD was 0.25 mg/L and S. marcescens 257 was 0.06 mg/L.

cLevofloxacin (LVX) MIC for J53 qnrB was 0.5 mg/L, J53 qnrD was 0.5 mg/L and S. marcescens 257 was 0.125 mg/L.

dMoxifloxacin (MXF) MIC for J53 qnrB was 1 mg/L, J53 qnrD was 0.5 mg/L and S. marcescens 257 was 0.25 mg/L.

eCeftazidime (CAZ) MIC for J53 qnrB was 0.5 mg/L, J53 qnrD was 0.5 mg/L and S. marcescens 257 was 0.25 mg/L.

In comparison, the most potent inducer of qnrD was ciprofloxacin, which increased expression nine times at 1/2× MIC compared with basal expression. qnrD showed no variation in expression in the presence of moxifloxacin. Relative induction of smaqnr and qnrD appeared to be dependent on concentration, as was observed for qnrB1. This concentration-dependent behaviour, shown in Table 2, correlates with lower induction levels from assays performed at 1/8× MIC concentration (data not shown). The E. coli J53 control harbouring a natural qnrB1-plasmid showed that qnr gene expression was induced with every quinolone tested. Mitomycin C, a classic SOS inducer, increased, as expected, the relative expression of qnrB1, qnrD and smaqnr (data not shown).

In the case of ceftazidime, there was a moderate increase in the expression of qnrB1 and qnrD genes, contrasting with the >4-fold increased expression of smaqnr (Table 2). These results coincide with those of Thi et al.,18 where ceftazidime induction using disc diffusion had a lower effect on SOS activation than ciprofloxacin. The results observed in the RT–PCR experiments could be explained by the narrow range of ceftazidime concentration able to activate the bacterial SOS response.

These results show different levels of induction, which depend not only on the antimicrobial, but also on the promoter region of the gene. The observed differences in the LexA box sequence and position could be associated with the different levels of induction (Table 2 and Figure 1).

Effect of antibiotics on qnrB1, qnrD and smaqnr expression

To show induction by LexA-regulated promoters, reporter gene assays were carried out with a transcriptional fusion green fluorescent protein (GFP) plasmid. As expected, the qnrB1, qnrD and smaqnr genes were induced by fluoroquinolones (ciprofloxacin and norfloxacin) and, interestingly, also by β-lactams, such as ceftazidime, aztreonam, cefuroxime and cefpirome, where there was clear induction, or cefotetan, piperacillin/tazobactam, cefepime and ampicillin, with minor induction of GFP fluorescence (Figure 2a and Table 3). Fluorescence was observed in all cases in the E. coli wild-type strains, although not in the recA-deficient E. coli HB101, indicating that induction of the qnrB1, qnrD and smaqnr promoters is regulated by the SOS system, in a RecA-dependent pathway (Figure 2b).

Table 3.

Level of induction of E. coli RR1 harbouring precA, pqnrB1, psmaqnr and pqnrD GFP plasmid constructions

 E. coli RR1 induction
 
Antibiotic precA pqnrB1 psmaqnr pqnrD 
Ciprofloxacin ++++ +++ +++ ++ 
Norfloxacin ++++ +++ ++ ++ 
Trimethoprim ++++ +++ ++ 
Piperacillin/tazobactam 
Ceftazidime ++ 
Aztreonam ++ 
Cefotetan 
Cefepime − 
Cefuroxime ++ 
Cefpirome ++ 
Ampicillin 
Imipenem − − − − 
Colistin − − − − 
Rifampicin − − − − 
Gentamicin − − − − 
Chloramphenicol − − − − 
 E. coli RR1 induction
 
Antibiotic precA pqnrB1 psmaqnr pqnrD 
Ciprofloxacin ++++ +++ +++ ++ 
Norfloxacin ++++ +++ ++ ++ 
Trimethoprim ++++ +++ ++ 
Piperacillin/tazobactam 
Ceftazidime ++ 
Aztreonam ++ 
Cefotetan 
Cefepime − 
Cefuroxime ++ 
Cefpirome ++ 
Ampicillin 
Imipenem − − − − 
Colistin − − − − 
Rifampicin − − − − 
Gentamicin − − − − 
Chloramphenicol − − − − 

Fluorescence observed on the plates is indicated by plus symbols; four plus symbols correspond to the highest level of fluorescence and one plus symbol corresponds to the lowest level of fluorescence. A minus sign indicates no fluorescence.

Figure 2.

Effect of antibiotics on transcription of promoters. (a) GFP fusion on a solid surface. The background strain was E. coli MG1655. Mitomycin C was used as a positive control for induction. Imipenem is shown as a negative inducer of fluorescence. (b) Comparison of induction using ciprofloxacin between two different background strains: wild-type strain E. coli RR1 and recA-deficient strain E. coli HB101.

Figure 2.

Effect of antibiotics on transcription of promoters. (a) GFP fusion on a solid surface. The background strain was E. coli MG1655. Mitomycin C was used as a positive control for induction. Imipenem is shown as a negative inducer of fluorescence. (b) Comparison of induction using ciprofloxacin between two different background strains: wild-type strain E. coli RR1 and recA-deficient strain E. coli HB101.

β-Lactams have recently been reported as activating the SOS response, using the DpiBA two-component system of bacteria, where DpiB is the stimulus receptor and DpiA the effector. When overexpressed, DpiA can bind to DNA and interrupt DNA replication, leading to SOS activation.17,27 The need for an external recognition process and an internal signalling pathway for β-lactams to activate the SOS system could be related to the lower induction levels compared with fluoroquinolones, and also highlights the distinct natures of cell wall-mediated and DNA damage-mediated pathways to SOS activation. β-Lactams have also been described as inducing mutagenesis in E. coli18,30 and Pseudomonas aeruginosa.31

In any case, there was no evidence of induction with the carbapenems (imipenem or meropenem) or the non-β-lactam antimicrobial agents tested (rifampicin, gentamicin, chloramphenicol and colistin). These findings agree with previously reported results, which showed the ability of different antimicrobial agents to stimulate a bacterial SOS response.18,19,27

The variations in the width and intensity of the fluorescent zone depended both on the antimicrobial tested and also on the three wild-type background strains used (data not shown), indicating that not only the antimicrobial agent tested but also the genetic background used could be important factors in this regulatory phenomenon.

Induction level of promoters

To quantify induction on plates, measurements were taken from the broth microplates with different concentrations of ciprofloxacin. A control culture of each strain was performed without adding ciprofloxacin. As shown in Table 4, 1/4× MIC of ciprofloxacin induced GFP expression. The levels of increase in the different strains were almost constant over time (Table 4). The highest increase in fluorescence intensity was seen in psmaqnr, which achieved a 3.1-fold increase at 6 h, corresponding to the highest level of fluorescence on the plates (Figure 2a). The increase was less marked for strains harbouring pqnrB1 and precA, attaining increases of 2.4- to 2.8-fold and 1.7- to 2.4-fold higher, respectively. Only the E. coli RR1 pqnrD strain showed a level of induction of transcription lower than 1.5 during the 24 h of measurement, compared with the control culture.

Table 4.

Ciprofloxacin induces a LexA-mediated SOS response

 Relative increase in fluorescencea
 
 6 h 8 h 12 h 24 h 
precA 2.3 2.4 1.8 1.7 
pqnrB1 2.5 2.4 2.5 2.8 
pqnrD 1.3 1.2 1.2 1.3 
psmaqnr 3.1 2.4 2.2 2.5 
 Relative increase in fluorescencea
 
 6 h 8 h 12 h 24 h 
precA 2.3 2.4 1.8 1.7 
pqnrB1 2.5 2.4 2.5 2.8 
pqnrD 1.3 1.2 1.2 1.3 
psmaqnr 3.1 2.4 2.2 2.5 

GFP fluorescence is indicated in terms of cell density (OD600), with measurements taken in the presence of ciprofloxacin at 1/4× MIC values. The background strains used for these experiments were E. coli MG1655NalR precA and E. coli RR1 for qnr promoter constructions. Data show the relative increase in GFP expression compared with control conditions.

aIncrease in fluorescence compared with the same strain without ciprofloxacin treatment.

Fluorescence in terms of cell density, as observed on the microplates, was consistent with the results of the quantitative expression experiments and the results shown in Figure 2(a), with qnrD promoters showing the least fluorescence emission, compared with the qnrB1 and smaqnr promoters.

Predicted regulatory boxes upstream of qnr genes

The BPROM bioinformatics tool showed putative regulatory boxes in the promoter regions of the qnrB1, qnrD and smaqnr genes (Table S2, available as Supplementary data at JAC Online), including the LexA-binding site. In order to highlight their possible role in regulating qnr genes, the GFP constructions were electroporated into the corresponding knockout E. coli BW25113 strains containing insertions in the regulatory gene (phoB, fnr and tyrR in qnrB, qnrD and smaqnr, respectively).32 The different combinations were tested, using ciprofloxacin, and the results showed no differences of GFP induction in the mutant and wild-type strains (data not shown), indicating that these regulatory boxes do not interfere with the gene induction process in the presence of quinolones and that the main regulatory mechanism seems to be related to the RecA-LexA-dependent SOS response.

Conclusions

The results of the present study show direct SOS-dependent regulation of low-level fluoroquinolone resistance in response to other antimicrobials, such as β-lactams, although the consequences in terms of cross-resistance are currently unknown.

Funding

This work was supported by the Consejería de Innovación Ciencia y Empresa, Junta de Andalucía (P07-CTS-02908, CTS-7730 and CTS-5259), the Ministerio de Ciencia e Innovación, Instituto de Salud Carlos III–co-financed by European Development Regional Fund ‘A way to achieve Europe’ ERDF, Spanish Network for Research in Infectious Diseases (REIPI RD06/0008), by the Consejería de Salud, Junta de Andalucía (PI-0282–2010), by the Ministerio de Sanidad y Consumo, the Instituto de Salud Carlos III, Spain (projects PI11-00934, PI10/00105) and PAR project (ref. 241476) from the EU 7th Framework Programme. A. B. was funded by a pre-doctoral grant from the Instituto de Salud Carlos III (PFIS), Spain.

Transparency declarations

None to declare.

Supplementary data

Tables S1 and S2 are available as Supplementary data at JAC Online (http://jac.oxfordjournals.org/).

References

1
Cattoir
V
Nordmann
P
Plasmid-mediated quinolone resistance in gram-negative bacterial species: an update
Curr Med Chem
 , 
2009
, vol. 
16
 (pg. 
1028
-
46
)
2
Rodriguez-Martinez
JM
Cano
ME
Velasco
C
, et al.  . 
Plasmid-mediated quinolone resistance: an update
J Infect Chemother
 , 
2010
, vol. 
17
 (pg. 
49
-
82
)
3
Martinez-Martinez
L
Pascual
A
Jacoby
GA
Quinolone resistance from a transferable plasmid
Lancet
 , 
1998
, vol. 
351
 (pg. 
797
-
9
)
4
Jacoby
GA
Walsh
KE
Mills
DM
, et al.  . 
qnrB, another plasmid-mediated gene for quinolone resistance
Antimicrob Agents Chemother
 , 
2006
, vol. 
50
 (pg. 
1178
-
82
)
5
Cavaco
LM
Hasman
H
Xia
S
, et al.  . 
qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbificans strains of human origin
Antimicrob Agents Chemother
 , 
2009
, vol. 
53
 (pg. 
603
-
8
)
6
Wang
M
Guo
Q
Xu
X
, et al.  . 
New plasmid-mediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis
Antimicrob Agents Chemother
 , 
2009
, vol. 
53
 (pg. 
1892
-
7
)
7
Hata
M
Suzuki
M
Matsumoto
M
, et al.  . 
Cloning of a novel gene for quinolone resistance from a transferable plasmid in Shigella flexneri 2b
Antimicrob Agents Chemother
 , 
2005
, vol. 
49
 (pg. 
801
-
3
)
8
Park
KS
Lee
JH
Jeong da
U
, et al.  . 
Determination of pentapeptide repeat units in Qnr proteins by the structure-based alignment approach
Antimicrob Agents Chemother
 , 
2011
, vol. 
55
 (pg. 
4475
-
8
)
9
Poirel
L
Liard
A
Rodriguez-Martinez
JM
, et al.  . 
Vibrionaceae as a possible source of qnr-like quinolone resistance determinants
J Antimicrob Chemother
 , 
2005
, vol. 
56
 (pg. 
1118
-
21
)
10
Sun
HI
Jeong da
U
Lee
JH
, et al.  . 
A novel family (QnrAS) of plasmid-mediated quinolone resistance determinant
Int J Antimicrob Agents
 , 
2010
, vol. 
36
 (pg. 
578
-
9
)
11
Sanchez
MB
Hernandez
A
Rodriguez-Martinez
JM
, et al.  . 
Predictive analysis of transmissible quinolone resistance indicates Stenotrophomonas maltophilia as a potential source of a novel family of qnr determinants
BMC Microbiol
 , 
2008
, vol. 
8
 pg. 
148
 
12
Velasco
C
Rodriguez-Martinez
JM
Briales
A
, et al.  . 
Smaqnr, a new chromosome-encoded quinolone resistance determinant in Serratia marcescens
J Antimicrob Chemother
 , 
2010
, vol. 
65
 (pg. 
239
-
42
)
13
Wang
M
Jacoby
GA
Mills
DM
, et al.  . 
SOS regulation of qnrB expression
Antimicrob Agents Chemother
 , 
2009
, vol. 
53
 (pg. 
821
-
3
)
14
Da Re
S
Garnier
F
Guerin
E
, et al.  . 
The SOS response promotes qnrB quinolone-resistance determinant expression
EMBO Rep
 , 
2009
, vol. 
10
 (pg. 
929
-
33
)
15
Little
JW
Edmiston
SH
Pacelli
LZ
, et al.  . 
Cleavage of the Escherichia coli lexA protein by the recA protease
Proc Natl Acad Sci USA
 , 
1980
, vol. 
77
 (pg. 
3225
-
9
)
16
Kohanski
MA
Dwyer
DJ
Hayete
B
, et al.  . 
A common mechanism of cellular death induced by bactericidal antibiotics
Cell
 , 
2007
, vol. 
130
 (pg. 
797
-
810
)
17
Erill
I
Campoy
S
Barbe
J
Aeons of distress: an evolutionary perspective on the bacterial SOS response
FEMS Microbiol Rev
 , 
2007
, vol. 
31
 (pg. 
637
-
56
)
18
Thi
TD
Lopez
E
Rodriguez-Rojas
A
, et al.  . 
Effect of recA inactivation on mutagenesis of Escherichia coli exposed to sublethal concentrations of antimicrobials
J Antimicrob Chemother
 , 
2011
, vol. 
66
 (pg. 
531
-
8
)
19
Foti
JJ
Devadoss
B
Winkler
JA
, et al.  . 
Oxidation of the guanine nucleotide pool underlies cell death by bactericidal antibiotics
Science
 , 
2012
, vol. 
36
 (pg. 
315
-
9
)
20
Briales
A
Rodriguez-Martinez
JM
Velasco
C
, et al.  . 
Prevalence of plasmid-mediated quinolone resistance determinants qnr and aac(6′)-Ib-cr in Escherichia coli and Klebsiella pneumoniae producing extended-spectrum β-lactamases in Spain
Int J Antimicrob Agents
 , 
2012
, vol. 
39
 (pg. 
431
-
4
)
21
Kalir
S
McClure
J
Pabbaraju
K
, et al.  . 
Ordering genes in a flagella pathway by analysis of expression kinetics from living bacteria
Science
 , 
2001
, vol. 
292
 (pg. 
2080
-
3
)
22
Zwir
I
Huang
H
Groisman
EA
Analysis of differentially-regulated genes within a regulatory network by GPS genome navigation
Bioinformatics
 , 
2005
, vol. 
21
 (pg. 
4073
-
83
)
23
Livak
KJ
Schmittgen
TD
Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method
Methods
 , 
2001
, vol. 
25
 (pg. 
402
-
8
)
24
Clinical and Laboratory Standards Institute
Performance Standards for Antimicrobial Susceptibility Testing: Nineteenth Informational Supplement M100-S20
 , 
2010
Wayne, PA, USA
CLSI
25
Kim
HB
Park
CH
Gavin
M
, et al.  . 
Cold shock induces qnrA expression in Shewanella algae
Antimicrob Agents Chemother
 , 
2011
, vol. 
55
 (pg. 
414
-
6
)
26
Okumura
R
Liao
CH
Gavin
M
, et al.  . 
Quinolone induction of qnrVS1 in Vibrio splendidus and plasmid-carried qnrS1 in Escherichia coli, a mechanism independent of the SOS system
Antimicrob Agents Chemother
 , 
2011
, vol. 
55
 (pg. 
5942
-
5
)
27
Miller
C
Thomsen
LE
Gaggero
C
, et al.  . 
SOS response induction by β-lactams and bacterial defense against antibiotic lethality
Science
 , 
2004
, vol. 
305
 (pg. 
1629
-
31
)
28
Courcelle
J
Khodursky
A
Peter
B
, et al.  . 
Comparative gene expression profiles following UV exposure in wild-type and SOS-deficient Escherichia coli
Genetics
 , 
2001
, vol. 
158
 (pg. 
41
-
64
)
29
Walker
GC
Mutagenesis and inducible responses to deoxyribonucleic acid damage in Escherichia coli
Microbiol Rev
 , 
1984
, vol. 
48
 (pg. 
60
-
93
)
30
Perez-Capilla
T
Baquero
MR
Gomez-Gomez
JM
, et al.  . 
SOS-independent induction of dinB transcription by β-lactam-mediated inhibition of cell wall synthesis in Escherichia coli
J Bacteriol
 , 
2005
, vol. 
187
 (pg. 
1515
-
8
)
31
Blazquez
J
Gomez-Gomez
JM
Oliver
A
, et al.  . 
PBP3 inhibition elicits adaptive responses in Pseudomonas aeruginosa
Mol Microbiol
 , 
2006
, vol. 
62
 (pg. 
84
-
99
)
32
Baba
T
Ara
T
Hasegawa
M
, et al.  . 
Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection
Mol Syst Biol
 , 
2006
, vol. 
2
  
2006.0008
33
Hornsey
M
Ellington
MJ
Doumith
M
, et al.  . 
Tigecycline resistance in Serratia marcescens associated with up-regulation of the SdeXY-HasF efflux system also active against ciprofloxacin and cefpirome
J Antimicrob Chemother
 , 
2010
, vol. 
65
 (pg. 
479
-
82
)

Supplementary data