Comparative analysis of in vitro dynamics and mechanisms of ceftolozane/tazobactam and imipenem/relebactam resistance development in Pseudomonas aeruginosa XDR high-risk clones

Abstract

Objectives

To analyse the dynamics and mechanisms of stepwise resistance development to ceftolozane/tazobactam and imipenem/relebactam in XDR Pseudomonas aeruginosa clinical strains.

Methods

XDR clinical isolates belonging to ST111 (main resistance mechanisms: oprD⁻, dacB⁻, CARB-2), ST175 (oprD⁻, ampR-G154R) and ST235 (oprD⁻, OXA-2) high-risk clones were incubated for 24 h in Müeller-Hinton Broth with 0.125–64 mg/L of ceftolozane + tazobactam 4 mg/L or imipenem + relebactam 4 mg/L. Tubes from the highest antibiotic concentration showing growth were reinoculated into fresh medium containing concentrations up to 64 mg/L for 7 consecutive days. Two colonies per strain from each of the triplicate experiments were characterized by determining the susceptibility profiles, whole genome sequencing (WGS), and in vitro fitness through competitive growth assays.

Results

Resistance development occurred more slowly and reached a lower level for imipenem/relebactam than for ceftolozane/tazobactam in all tested XDR strains. Moreover, resistance development to imipenem/relebactam remained low even for ST175 isolates that had developed ceftolozane/tazobactam resistance during therapy. Lineages evolved in the presence of ceftolozane/tazobactam showed high-level resistance, imipenem/relebactam hypersusceptibility and low fitness cost, whereas lineages evolved in the presence of imipenem/relebactam showed moderate (borderline) resistance, no cross-resistance to ceftolozane/tazobactam and high fitness cost. WGS evidenced that ceftolozane/tazobactam resistance was mainly caused by mutations in the catalytic centres of intrinsic (AmpC) or acquired (OXA) β-lactamases, whereas lineages evolved in imipenem/relebactam frequently showed structural mutations in MexB or in ParS, along with some strain-specific mutations.

Conclusions

Imipenem/relebactam could be a useful alternative for the treatment of XDR P. aeruginosa infections, potentially reducing resistance development during therapy.

Introduction

The increasing prevalence of hospital-acquired infections produced by MDR or XDR Pseudomonas aeruginosa strains is associated with significant morbidity and mortality.^1,2 This growing threat results from the extraordinary capacity of this pathogen for developing resistance through chromosomal mutations and from the increasing prevalence of transferable resistance determinants, particularly those encoding carbapenemases or extended-spectrum β-lactamases (ESBLs).²P. aeruginosa has a non-clonal epidemic population structure, composed of a limited number of widespread clones that are selected from a background of a large quantity of rare and unrelated genotypes that are recombining at high frequency.³ Indeed, several surveys have provided evidence of the existence of MDR/XDR global clones, denominated high-risk clones, disseminated in hospitals worldwide; ST235, ST111 and ST175 are among those most widespread.^3,4 A recent multicentre study on XDR P. aeruginosa from Spanish hospitals revealed that mutation-driven resistance (mainly those leading to AmpC hyperproduction and OprD inactivation) is by far the most frequent mechanism of β-lactam resistance (∼80%), whereas acquired β-lactamases represented 20%.⁵ These data correlated with the high activity of ceftolozane/tazobactam, to which close to 70% of the isolates resistant to all other β-lactams were susceptible.⁵

The introduction of novel β-lactam/β-lactamase inhibitor combinations such as ceftolozane/tazobactam is mitigating, to some extent, the problem of MDR/XDR P. aeruginosa. Early in vitro evolution experiments with reference wild-type strains (PAO1) evidenced that resistance development required the simultaneous acquisition of mutations leading to the overexpression and the structural modification of AmpC and only occurred in a mutator (mutS deficient) background.⁶ However, resistance development is not uncommonly reported after the introduction of agents into clinical practice, and typically occurs during the treatment of infections by MDR/XDR strains that already show resistance to classical β-lactams through mechanisms such as AmpC overexpression.⁷ The involved mechanism typically includes mutations leading to modification of the AmpC catalytic centre, which confer cross-resistance to ceftazidime/avibactam, but also increased carbapenem susceptibility.⁷ Additional mechanisms leading to ceftolozane/tazobactam and/or ceftazidime/avibactam resistance development in vivo include the modification of the catalytic centre of narrow-spectrum OXAs (such as OXA-2 or OXA-10) leading to extended-spectrum enzymes^8,9 or the selection of mutations leading to the modification of the substrate specificity of efflux pumps such as MexCD-OprJ.¹⁰

Altogether these data indicate that novel treatments are needed to complete the armamentarium required for combating infections by MDR/XDR P. aeruginosa. One such recently developed novel option for the treatment of MDR/XDR Gram-negative pathogens is the combination of the carbapenem imipenem with relebactam, a novel inhibitor of β-lactamases from classes A and C. A recent Spanish nationwide study revealed that the prevalence of imipenem/relebactam resistance was < 3%, and that it was basically restricted to isolates producing horizontally acquired carbapenemases.¹¹ Likewise, imipenem/relebactam was found to be active against a large collection of isogenic mutants producing diverse combinations of the main mutation-driven resistance mechanisms in P. aeruginosa, including AmpC derepression, porin loss or efflux pump overexpression. Moreover, it remained active against isogenic XDR P. aeruginosa mutants that had developed ceftolozane/tazobactam and ceftazidime/avibactam resistance during treatment due to the selection of mutations in AmpC.¹¹ Furthermore, in recent work we comparatively analysed the dynamics and mechanisms of in vitro development of resistance to imipenem and imipenem/relebactam¹² under stepwise exposure to growing drug concentrations, using wild-type and hypermutable (mutator) strains. Relebactam reduced imipenem resistance development for both strains, although resistance emerged much faster for the mutator strain. WGS indicated that imipenem resistance was associated with mutations in the porin OprD and regulators of ampC, while the mutations in imipenem/relebactam low-level resistant mutants were located in oprD and regulators of MexAB-OprM. High-level imipenem/relebactam resistance was only documented in the mutator strain and was associated with both an additional specific (T680A) mutation located in the catalytic pocket of ponA (PBP1a) and with reduced virulence in the C. elegans model.¹² Therefore, the objective of the present work was to comparatively analyse the dynamics and mechanisms of in vitro development of resistance to ceftolozane/tazobactam and imipenem/relebactam, under stepwise exposure to growing drug concentrations using XDR clinical strains belonging to major high-risk clones ST111, ST175 and ST235. Moreover, the dynamics and mechanisms of imipenem/relebactam resistance development were also investigated in isogenic strains that had developed ceftolozane/tazobactam resistance during therapy.

Materials and methods

Clinical strains

Three previously characterized XDR clinical strains belonging the high-risk clones ST111 (isolate NAV01-012),¹³ ST175 (isolate 101-E5),⁷ and ST235 (isolate 109-F7)¹⁴ were used. These isolates had shown resistance to all classical antipseudomonal β-lactams tested (ceftazidime, cefepime, piperacillin/tazobactam, imipenem and meropenem) but susceptibility to ceftolozane/tazobactam and imipenem/relebactam.^7,11,14 An ST175 isolate (103-H8) that had developed resistance to ceftolozane/tazobactam during treatment was also included.⁷

In vitro resistance development assay

At time 0 days, 10 mL Müller-Hinton tubes containing 0.5×, 1×, 2×, 4×, 8×, 16×, 32×, and 64× MIC concentrations of ceftolozane +4 mg/L tazobactam or imipenem +4 mg/L relebactam were inoculated with each of the four XDR clinical strains (10⁶ cfu/mL concentration) in triplicate experiments. The tubes were then incubated for 24 h at 180 rpm. Tubes from the highest antibiotic concentration showing visible growth were: (i) re-inoculated (1:1000 dilution) in tubes with fresh medium containing the same concentration of antibiotic and all the above concentrations up to 64× MIC; and (ii) two isolated colonies were purified from each of these tubes and stored frozen for further study. The same procedure was repeated for a total of 7 consecutive days.

Susceptibility testing

The MICs of ticarcillin (8–512 mg/L), piperacillin/tazobactam (4/4–256/4 mg/L), ceftazidime (1–64 mg/L), ceftazidime/avibactam (0.5/4–32/4 mg/L), cefepime (1–64 mg/L), aztreonam (2–128 mg/L), imipenem (0.5–64 mg/L), meropenem (0.5–64 mg/L), ciprofloxacin (0.12–16 mg/L), tobramycin (0.25–32 mg/L), amikacin (2–128 mg/L) and colistin (0.5–16 mg/L) were determined by broth microdilution using customized Sensititre plates (Ref. FRCNRP, ThermoFisher Scientific) in duplicate experiments. MICs of ceftolozane/tazobactam (0.5–256 mg/L) and imipenem/relebactam (0.125–64 mg/L) were further analysed through broth microdilution. MICs were interpreted using EUCAST 2021 breakpoints (www.eucast.org).

Whole genome sequencing

Total DNA was isolated using a commercial capture system (High Pure PCR Template Preparation Kit, Roche Diagnostics) and indexed paired-end libraries were generated by using a commercial library preparation kit (Illumina Nextera DNA Library Preparation Kit). All samples were then sequenced with a MiSeq desktop sequencer cartridge (MiSeq Reagent Kit v3, Illumina). The reads for each isolate were mapped against the genome of the P. aeruginosa reference strain PAO1 (RefSeq accession number NC_002516.2) using Bowtie 2 software, version 2.2.6 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml).¹⁵ Pileups and raw files of the mapped reads were obtained by using SAMtools, version 0.1.16 (https://sourceforge.net/projects/samtools/files/samtools/),¹⁶ and PicardTools, version 1.140 (https://github.com/broadinstitute/picard). Read alignments surrounding all putative indels were realigned using the Genome Analysis Toolkit (GATK), version 3.4-46 (https://www.broadinstitute.org/gatk/).¹⁷ The list of SNPs was compiled from the raw files that met the following criteria: a quality score of >50, a root mean square (RMS) mapping quality of >25 and a coverage depth of >3. Indels were extracted from the total pileup files by use of the following criteria: a quality score of >250, an RMS mapping quality of >25 and a coverage depth of >3. SNPs and indels for each isolate were annotated by using SnpEff software version 4.3 (http://snpeff.sourceforge.net/index.html),¹⁸ with default options. Additionally, the reads for each mutant, and their parental strains, were mapped against a reference strain for each sequence type, including NGCM2.S1 for ST235 (RefSeq accession number NC_017549.1), RW109 for ST111 (assembly accession number GCF_000284555.1) and PAmb179 for ST175,¹⁹ following the previous criteria, and obtaining potential SNPs and indels for each isolate in specific regions of these reference strains that are not present in PAO1 strain. SNP and indel compilations from the parental strains were used to filter the initial SNPs/indels present in the strain prior to the initiation of the antibiotic exposure experiments. Finally, large chromosomal deletions were analysed with Seqmonk version 1.47.2 (https://www.bioinformatics.babraham.ac.uk/projects/seqmonk/).

Resistance gene expression

The expression of the genes encoding the chromosomal β-lactamase AmpC (ampC) and MexAB-OprM (mexB) and MexXY (mexY) efflux pumps was determined from late log-phase LB broth cultures at 37°C and 180 rpm by real-time RT–PCR with a Bio-Rad instrument (CFX Connect Real-Time System), as previously described.²⁰ Previously described primers and conditions were used for the quantification of the expression of PA1797.²¹ Likewise, primers OXA-2-RNA-F (TTTTCGATGGGACGGCGTTAA) and OXA-2-RNA-R (ATAGAGCTTCCTGAGAAATGCA) were used for the quantification of the expression of bla_OXA-2 (Barceló et al., manuscript in preparation).

In vitro competition experiments

In vitro competition experiments between each of the resistant mutants and wild-type PAO1 were performed as described previously.^22,23 Exponentially growing cells were mixed in a 1:1 ratio and diluted in 0.9% saline solution. Approximately 10³ cells from each of the mixtures were inoculated into three 10 mL MH broth flasks and grown at 37°C and 180 rpm for 16 to 18 h, corresponding to approximately 20 generations. Serial 10-fold dilutions were plated in duplicate onto MH agar supplemented with 5 mg/L gentamicin and/or 50 mg/L ceftazidime to enumerate the corresponding mutants and MH agar to enumerate the total cfu. Wild-type PAO1 numbers were obtained by subtracting the resistant mutants cfu from total cfu. The competition index (CI) was defined as the median mutant-to-wild-type ratio for three experiments.

In vitro growth rates

Growth curves of wild-type PAO1, ST111, ST175 and ST235 parent strains and derivatives evolved in the presence of ceftolozane/tazobactam or imipenem/relebactam were determined according to previously described methods.²⁴ Briefly, growth curves were initiated with an initial inoculum of OD₆₀₀ = 0.05, (∼5 × 10⁷ cfu/mL) in MHB and OD₆₀₀ absorbance was determined at 0, 0.5, 1, 2, 3, 4, 5, 6, 7 and 8 h.

Caenorhabditis elegans killing assay

The assay for studying bacterial killing of C. elegans was performed as described previously.²⁵ Briefly, a fresh culture of each bacterial strain to be tested was layered onto a 55 mm diameter plate containing 5 mL of potato dextrose agar. After spreading the bacterial culture, plates were incubated at 37°C for 24 h to form bacterial lawns. Five worms per plate were then poured on top of the bacterial lawns. The plates were incubated at 24°C and scored to detect the presence of living worms at 0, 24, 48, 72 and 168 h. The nematodes were examined at × 20 and × 40 magnification and a worm was considered dead if it did not move spontaneously. At least three independent experiments were performed and mean ± SD values were recorded. The Escherichia coli strain OP50, used to feed the nematodes, was used as a non-pathogenic control.

Statistical analysis

Qualitative and quantitative variables were compared using the Chi²-test, Mann–Whitney U-test or Student’s t-test, as appropriate. In all cases, a P value <0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism 5 software.

Results

Dynamics of in vitro resistance development to ceftolozane/tazobactam and imipenem/relebactam in XDR high-risk clones

Comparative analysis of stepwise resistance development to ceftolozane/tazobactam and imipenem/relebactam in the three XDR isolates belonging to ST175, ST111 and ST235 clones is shown in Figure 1. The β-lactam resistance genotype of the three parent isolates included OprD inactivation as main carbapenem resistance mechanism, whereas the underlying penicillin/cephalosporin resistance mechanisms were more variable: AmpC overexpression due to an ampR mutation in ST175, production of the carbenicillinase CARB-2 and AmpC overexpression due to a dacB mutation in ST111 and production of OXA-2 in the ST235 isolate. In all cases, emergence of resistance to imipenem/relebactam occurred more slowly and reached a lower level than for ceftolozane/tazobactam. ST175 reached the maximum concentration tested (64 mg/L) of ceftolozane/tazobactam by day 6 and 32 mg/L of imipenem/relebactam by day 7. Differences were higher for ST235 (ceftolozane/tazobactam 64 mg/L at day 5 and imipenem/relebactam 8 mg/L at day 7) and ST111 (ceftolozane/tazobactam 32 mg/L at day 7 and imipenem/relebactam 4 mg/L at day 7). Additionally, an AmpC E247K mutant of the ST175 strain selected in vivo during treatment and showing ceftolozane/tazobactam resistance was evolved for 7 days in the presence of growing concentrations of ceftolozane/tazobactam or imipenem/relebactam. As expected, high-level ceftolozane/tazobactam resistance emerged faster than for the susceptible parent, but, in contrast, imipenem/relebactam resistance development was slightly reduced (Figure 1).

Figure 1.

Dynamics of stepwise resistance development to ceftolozane/tazobactam and imipenem/relebactam in broth cultures from ST175 (a), ST175 AmpC E247K (b), ST235 (c) and ST111 (d) P. aeruginosa high-risk clones. Median values and ranges for three experiments are shown.

Mechanisms of in vitro resistance development to ceftolozane/tazobactam and imipenem/relebactam in XDR high-risk clones

Phenotypic and genomic characterization of the evolved resistant mutants is shown in Table 1 (ST175), Table 2 (ST111) and Table 3 (ST235). The expression of ampC, mexB and mexY in parent strains and mutant derivatives is shown in Table 4. Mutants evolved in the presence of ceftolozane/tazobactam always showed high-level resistance (MICs 64–512 mg/L), cross-resistance to ceftazidime/avibactam and increased susceptibility to carbapenems (and imipenem/relebactam). For ST175 and ST111, showing basal AmpC overexpression, the main selected mechanisms were AmpC Ω-loop mutations, frequently together with additional mutations in ampC regulators such as ampD or dacB, leading to further increased ampC expression (Table 4). However, ceftolozane/tazobactam resistance development in the OXA-2-producing ST235 clone always included extended-spectrum mutations of the OXA enzyme either including previously described mutations W159R (OXA-144) or G162D (OXA-415). Increased bla_OXA-2 transcription was not evidenced in any of the evolved lineages (range of expression respect to parent ST235 = 0.76–1.1). Additionally, two of the three ST235 lineages showed large genomic deletions including among other genes: hmgA (pyomelanine production), galU (β-lactam resistance and colistin hypersusceptibility) and mexXY (aminoglycoside hypersusceptibility). Curiously, ampC expression was significantly reduced in these mutants (Table 4).

Table 1.

Results of the characterization of the ST175 high-risk clone mutants obtained after 7 days of exposure to imipenem/relebactam (I/R) or ceftolozane/tazobactam (C/T), including susceptibility profiles and mutations detected through whole genome sequencing

Straina			TIC	TZP	AZM	CAZ	C/T	CZA	FEP	IPM	I/R	MEM	CST	CIP	AMK	TOB	Genotype
			(R > 16)	(R > 16)	(R > 16)	(R > 8)	(R > 4)	(R > 8)	(R > 8)	(R > 4)	(R > 2)	(R > 8)	(R > 2)	(R > 0.5)	(R > 16)	(R > 2)
PAO1			16	4	4	1–2	≤0.5	1	1–2	0.5–1	0.125–0.25	0.5–1	2	≤0.12	≤2	0.5	–
ST175-1 (101-E5)			128	64–128	16	16	2	4	16	8	1	8	2	>16	4	32	oprD (Q142*), ampR (G154R), mexZ (G195D), gyrA (T83I, D87N), parC (S87W)
C/T	1	m1	512	32	32–64	>64	128	32	32	1	0.25	2	2	>16	4	32	clpP (T96I), PA2563 (nt1485InsGAGC), ampC (E247K, V366I), PA4528 (nt1Δ3)
		m2	512	32	64	>64	128	32	32	1	0.25	2	2	>16	4	32	clpP (T96I), PA2583.1 (nt50InsAGAG), PA2956 (nt133InsCACTTA), ampC (E247K, V366I)
	2	m1	128	8–16	16	64	128	32	16	1	0.5	2	2	>16	4	32	PA1964 (nt16InsAGC, nt9InsAAAA), clpA (Q71*), dacB (nt1168Δ1), ampC (G183D, D217N)
		m2	128	8–16	16	64	128	32	16	1	0.5	2–4	2	>16	4	32	clpA (Q71*), dacB (nt1168Δ1), ampC (G183D, D217N)
	3	m1	256	8–16	32	>64	128	>32	16	0.5–1	0.5	2–4	2	>16	4	32	dacB (nt654Δ1), ampC (D217N, nt702Δ21)
		m2	256	16	32	>64	128	>32	16	0.5–1	0.5	2–4	1	>16	4	32	dacB (nt654Δ1), ampC (D217N, nt702Δ21)
I/R	1	m1	512	>256	128	>64	16	>32	64	64	4–8	32	2–4	>16	32	>32	gltA (nt1018InsCCAGTT), PA1767 (nt119InsTCGGTT), wapR (N73S)
		m2	512	>256	64	>64	8	32	64	64	4–8	32	4	>16	16	>32	PA1767 (nt119InsTCGGTT), parS (L137Q)
	2	m1	256	>256	32–64	>64	8	16–32	32	32–64	4	16–32	2	>16	8	>32	PA1766 (nt345InsGTG), purB (S341P)
		m2	256	>256	64	64	4	32	16–32	32–64	4	16	2	>16	8	>32	PA0098 (nt255InsCCCGCC), PA1766 (nt345InsGTG), purB (S341P)
	3	m1	256	256	64	64	4	32	16–32	16	4–8	32	2	>16	4	32	PA1766 (nt279InsGCCGTC), purB (V211M), nalD (T11N)
		m2	256	256	64	64	4	32	16	32	8	32	2	>16	4	>32	PA1766 (nt279InsGCCGTC), purB (V211M), nalD (T11N)

TIC, ticarcillin; TZP, piperacillin/tazobactam; AZM, azithromycin; CAZ, ceftazidime; C/T, ceftolozane/tazobactam; CZA, ceftolozane; FEP, cefepime; IPM, imipenem; I/R, imipenem/relebactam; MEM, meropenem; CST, colistin; CIP, ciprofloxacin; AMK, amikacin; TOB, tobramycin.

a

Data for two colonies (m1 and m2) from each of three experiments per treatment, imipenem/relebactam (I/R) or ceftolozane/tazobactam (C/T), are shown. MICs were determined in duplicate and both values obtained are shown when not identical. Relevant resistance genotype of the parental strain is indicated, and all acquired mutations detected in each of the mutants are listed.

Table 2.

Results of the characterization of the ST111 high risk clone mutants obtained after 7 days of exposure to imipenem/relebactam (I/R) and ceftolozane/tazobactam (C/T), including susceptibility profiles and mutations detected through whole genome sequencing

Straina			TIC	TZP	AZM	CAZ	C/T	CZA	FEP	IPM	I/R	MEM	CST	CIP	AMK	TOB	Genotype
			(R > 16)	(R > 16)	(R > 16)	(R > 8)	(R > 4)	(R > 8)	(R > 8)	(R > 4)	(R > 2)	(R > 8)	(R > 2)	(R > 0.5)	(R > 16)	(R > 2)
PAO1			16	4	4	1–2	<0.5	1	1–2	0.5–1	0.125–0.25	0.5–1	2	<0.12	<2	0.5	–
ST111 (NAV01-012)			>512	128	8	16	1–2	4	8	8	0.5	8	1	16	8	16	oprD (nt991InsAC), parS (L137P), mexY (G530S), dacB (nt664InsGGCCT), gyrA (T83I)
C/T	1	m1	>512	64	4	32–64	64	16	4–8	0.5	0.25–0.5	2–4	1–2	8	8	32	PA2500 (A75V), PA3086 (F67Q), PA3093 (nt287Δ7), ampC (ΔG229-E247), PA4390 (V333G), PA4673 (nt1096InsCTGAGCCGA)
		m2	>512	32–64	4	32–64	64	8–16	4	0.5	0.25–0.5	2	1–2	8	8	32	PA3086 (F67Q), PA3093 (nt287Δ7), ampC (ΔG229-E247), PA4390 (V333G)
	2	m1	>512	128	32–64	>64	128	16–32	16–32	1	0.25–0.5	4	1–2	8	16	>32	nuoL (W596*), pcm (nt4Δ1), ampC (E247K), PA4390 (V333G), PA51.1 (P10T)
		m2	>512	128	32–64	>64	128	16–32	16–32	1–2	0.25–0.5	4	1–2	4–8	16	>32	nuoL (W596*), pcm (nt4Δ1), ampC (E247K), PA4390 (V333G), PA51.1 (P10T)
	3	m1	>512	128	32–64	>64	128	8–16	16	1	0.25–0.5	4–8	1	4	8–16	>32	dacC (T265I), ampC (E247K)
		m2	>512	128	32–64	>64	128	16–32	16	1–2	0.5	8	1	4	16	32	PA2229 (nt549InsAT),ampC (E247K), rpoC (R1330C), ampD (V10G)
I/R	1	m1	>512	>256	32	64	4	8–16	32	32	2–4	16	1	4	16–32	>32	mexB (R620C), fimL (nt595CAGC), PA4390 (Q69*), PA4452 (nt161Δ2)
		m2	>512	256	32	64	4	16	32	32	2–4	16	1	4	16	>32	mexB (R620C), fimL (nt595CAGC), PA3849 (nt942InsCAC), PA4390 (Q69*), PA4452 (nt161Δ2)
	2	m1	>512	256	16	16–32	1–2	8	16	32	2	8–16	2	4–8	2–4	16	ptsP (V124G), vfr (A89T), PA4390 (nt65Δ21)
		m2	>512	128–256	16	16	2	4	8–16	16–32	2	16	1–2	8	8–16	32	vfr (A89T), rpoN (M1?), PA3825 (nt1529Δ5) PA4689 (nt2272InsTAA)
	3	m1	>512	32–64	8	32	2	16	8	16	2	4	2	8	8	16–32	pilJ (Q115*), mexB (A290T)
		m2	>512	256	16	32	2	8–16	16	16	2	8–16	1–2	4	16	32	pilJ (Q115*), mexB (A290T), PA0574.1 (nt10Δ2)

a

Data for two colonies (m1 and m2) from each of three experiments per treatment, imipenem/relebactam (I/R) or ceftolozane/tazobactam (C/T), are shown. MICs were determined in duplicate and both values obtained are shown when not identical. Relevant resistance genotype of the parental strain is indicated, and all acquired mutations detected in each of the mutants are listed.

Table 3.

Results of the characterization of the ST235 high risk clone mutants obtained after 7 days of exposure to imipenem/relebactam (I/R) and ceftolozane/tazobactam (C/T), including susceptibility profiles and mutations detected through whole genome sequencing

Straina			TIC	TZP	AZM	CAZ	C/T	CZA	FEP	IPM	I/R	MEM	CST	CIP	AMK	TOB	Genotype
			(R > 16)	(R > 16)	(R > 16)	(R > 8)	(R > 4)	(R > 8)	(R > 8)	(R > 4)	(R > 2)	(R > 8)	(R > 2)	(R > 0.5)	(R > 16)	(R > 2)
PAO1			16	4	4	1–2	≤0.5	1	1–2	0.5–1	0.125–0.25	0.5–1	2	≤0.12	≤2	0.5	–
ST235 (109-F7)			128	64	32	>64	2	4	32	16	1	>64	4	8	64	>32	oprD (nt1205InsC), gyrA(T83I), mexZ (V48A), pmrB (V344M), parC (S87L), blaOXA-2
C/T	1	m1	128	64–128	16	>64	256	>32	16	8	1	8	2	>16	32	>32	PA0659 (nt446InsCCCGCG), PA3368.1 (nt68InsA), OXA-2 (W159R)
		m2	128	64	16	>64	256	>32	16	8	1	8	2	>16	32	>32	fimV (G682S), PA3368.1 (nt68InsA), PA5528 (nt459InsAGT), OXA-2 (W159R)
	2	m1	256	32	16	>64	256	>32	16–32	4–8	0.5	8–16	0.5–1	8	4	4	OXA-2 (G162D), Δ350K (PA1923-PA2230)
		m2	256	16–32	16	>64	256	>32	16	4–8	0.5	16	0.5–1	8	4	4	OXA-2 (G162D), Δ350K (PA1923-PA2230)
	3	m1	64–128	16	16	>64	256	>32	16	4–8	0.5	8	1	8–16	≤2	2–4	OXA-2 (W159R), Δ117K (PA1934-PA2042) + Δ11K (PA2097-PA2108)
		m2	64–128	8	8	>64	256	>32	16	4–8	0.5	8	0.5–1	8	≤2	2–4	OXA-2 (W159R), Δ117K (PA1934-PA2042) + Δ11K (PA2097-PA2108)
I/R	1	m1	512	32–64	16	16	2	8	16	8	2–4	32	4	8–16	32	32	–
		m2	512	32–64	16–32	16	2	4–8	8–16	8	2–4	32	4	8–16	16–32	32	–
	2	m1	526	64	8	16	2	4	16	16	8	32	2	>32	32	>32	mexB (T932M), parS (R383H), pyrD (K216T)
		m2	256–512	32–64	8	16	2	4	16	16–32	8–16	16	1	>32	32	>32	mexB (T932M), parS (R383H), pyrD (K216T)
	3	m1	512	128–256	32	32–64	4	16–32	32	16	4–8	32–64	2	>16	64	>32	parS (V152A)
		m2	512	128–256	32	32–64	4	16–32	32	16	4–8	64	2	>16	64	>32	parS (V152A)

a

Data for two colonies (m1 and m2) from each of three experiments per treatment, imipenem/relebactam (I/R) or ceftolozane/tazobactam (C/T), are shown. MICs were determined in duplicate and both values obtained are shown when not identical. Relevant resistance genotype of the parental strain is indicated, and all acquired mutations detected in each of the mutants are listed.

Table 4.

Expression of ampC and efflux pump genes mexB and mexY in ST175, ST111 and ST235 mutants obtained after 7 days of exposure to imipenem/relebactam (I/R) and ceftolozane/tazobactam (C/T)

Straina			Genotype	ampCb	mexBb	mexYb
ST175-1 (101-E5)			oprD (Q142*), ampR (G154R), mexZ (G195D), gyrA (T83I, D87N), parC (S87W)	286 ± 66	2.3 ± 0.4	14 ± 2
I/R	1	m1	gltA (nt1018InsCCAGTT), PA1767 (nt119InsTCGGTT), wapR (N73S)	4408 ± 1682*	2.2 ± 0.1	10 ± 2
		m2	PA1767 (nt119InsTCGGTT), parS (L137Q)	1514 ± 19*	2.7 ± 0.1	11 ± 0.3
	2	m1	PA1766 (nt345InsGTG), purB (S341P)	1310 ± 542*	2.5 ± 0.1	8 ± 1
		m2	PA0098 (nt255InsCCCGCC), PA1766 (nt345InsGTG), purB (S341P)	1058 ± 419*	3.1 ± 0.1	6 ± 1
	3	m1	PA1766 (nt279InsGCCGTC), purB (V211M), nalD (T11N)	1959 ± 211*	7.6 ± 1.4*	7 ± 0.6
		m2	PA1766 (nt279InsGCCGTC), purB (V211M), nalD (T11N)	ND	ND	ND
C/T	1	m1	clpP (T96I), PA2563 (nt1485InsGAGC), ampC (E247K, V366I), PA4528 (nt1Δ3)	528 ± 103	1.5 ± 0.2	5 ± 0.5
		m2	clpP (T96I), PA2583.1 (nt50InsAGAG), PA2956 (nt133InsCACTTA), ampC (E247K, V366I)	482 ± 94	1.8 ± 0.1	6 ± 1
	2	m1	PA1964 (nt16InsAGC, nt9InsAAAA), clpA (Q71), dacB (nt1168Δ1), ampC (G183D, D217N)	5182 ± 1328*	1.7 ± 0.3	6 ± 1
		m2	clpA (Q71), dacB (nt1168Δ1), ampC (G183D, D217N)	1693 ± 1006*	1.5 ± 0.3	7 ± 0.1
	3	m1	dacB (nt654Δ1), ampC (D217N, nt702Δ21)	1339 ± 19*	3 ± 0.5	6 ± 3
		m2	dacB (nt654Δ1), ampC (D217N, nt702Δ21)	ND	ND	ND
ST111 (NAV01-012)			oprD (nt991InsAC), parS (L137P), mexY (G530S), dacB (nt664InsGGCCT), gyrA (T83I), blaOXA-2	265 ± 48	2 ± 1	7 ± 0.1
I/R	1	m1	mexB (R620C), fimL (nt595CAGC), PA4390 (Q69), PA4452 (nt161Δ2)	201 ± 6	1 ± 0.4	8 ± 1
		m2	mexB (R620C), fimL (nt595CAGC), PA3849 (nt942InsCAC), PA4390 (Q69), PA4452 (nt161Δ2)	205 ± 40	1 ± 0.5	12 ± 6
	2	m1	ptsP (V124G), vfr (A89T), PA4390 (nt65Δ21)	215 ± 9	1 ± 0.6	8 ± 0.5
		m2	vfr (A89T), rpoN (M1?), PA3825 (nt1529Δ5), PA4689 (nt2272InsTAA)	178 ± 11	2 ± 0.2	10 ± 3
	3	m1	pilJ (Q115), mexB (A290T)	402 ± 41	1 ± 0.3	7 ± 1
		m2	pilJ (Q115), mexB (A290T), PA0574.1 (nt10Δ2)	174 ± 16	1 ± 0.3	8 ± 0.4
C/T	1	m1	PA2500 (A75V), PA3086 (F67Q), PA3093 (nt287Δ7), ampC (ΔG229-E247), PA4390 (V333G), PA4673 (nt1096InsCTGAGCCGA)	6445 ± 2650*	1 ± 0.7	5 ± 0.5
		m2	PA3086 (F67Q), PA3093 (nt287Δ7), ampC (ΔG229-E247), PA4390 (V333G)	4254 ± 2294*	1 ± 0.1	3 ± 2
	2	m1	nuoL (W596), pcm (nt4Δ1), ampC (E247K), PA4390 (V333G), PA5160.1 (P10T)	1062 ± 193*	1 ± 0.5	9 ± 1
		m2	nuoL (W596), pcm (nt4Δ1), ampC (E247K), PA4390 (V333G), PA5160.1 (P10T)	ND	ND	ND
	3	m1	dacC (T265I), ampC (E247K)	2690 ± 49*	2 ± 0.6	5 ± 0.5
		m2	PA2229 (nt549InsAT),ampC (E247K), rpoC (R1330C), ampD (V10G)	3890 ± 112*	3 ± 1.6	6 ± 0.3
ST235 (109-F7)			oprD (nt1205InsC), gyrA(T83I), mexZ (V48A), pmrB (V344 M), parC (S87L)	40 ± 20	2 ± 0.3	11 ± 0.4
I/R	1	m1	–	46 ± 19	3 ± 0.1	9 ± 1
		m2	–	ND	ND	ND
	2	m1	mexB (T932M), parS (R383H), pyrD (K216T)	45 ± 8	6 ± 0.3*	13 ± 0.1
		m2	mexB (T932M), parS (R383H), pyrD (K216T)	ND	ND	ND
	3	m1	parS (V152A)	29 ± 26	8 ± 5*	17 ± 4
		m2	parS (V152A)	ND	ND	ND
C/T	1	m1	PA0659 (nt446InsCCCGCG), PA3368.1 (nt68InsA), OXA-2 (W159R)	35 ± 30	1 ± 0.3	8 ± 0.1
		m2	fimV (G682S), PA3368.1 (nt68InsA), PA5528 (nt459InsAGT), OXA-2 (W159R)	31 ± 18	1 ± 0.5	6 ± 1
	2	m1	OXA-2 (G162D), Δ350K (PA1923-PA2230)	4 ± 1	2 ± 0.2	–
		m2	OXA-2 (G162D), Δ350K(PA1923-PA2230)	ND	ND	–
	3	m1	OXA-2 (W159R), Δ117K (PA1934-PA2042) + Δ11K (PA2097-PA2108)	3 ± 1	3 ± 0.4	–
		m2	OXA-2 (W159R), Δ117K (PA1934-PA2042) + Δ11K (PA2097-PA2108)	ND	ND	–

a

Data for two colonies (m1 and m2) from each of three experiments per treatment, imipenem/relebactam (I/R) or ceftolozane/tazobactam (C/T), are shown.

b

Relative ampC, mexB, and mexY expression levels (mean ± SD of three independent duplicate experiments) compared with that of wild-type PAO1. Expression levels >2-fold higher compared to the corresponding parent strain are indicated with an asterisk. ND, not determined; a dash indicates that expression was not detected.

On the other hand, mutants evolved in the presence of imipenem/relebactam showed moderate resistance levels (MICs 2–16 mg/L) and modest impact on the MICs of ceftolozane/tazobactam and non-β-lactam antibiotics. The mutations acquired during imipenem/relebactam exposure were more variable and strain dependent. Mutations in AmpC or other β-lactamase genes were not detected in any of the evolved lineages. In contrast, the most frequently mutated genes were mexB (1 of 3 ST235 lineages and 2 of 3 ST111 lineages) and parS (1 of 3 ST175 lineages and 2 of 3 ST235 lineages). It is noteworthy that the parent ST111 strain already presented a parS mutation (Table 2). Strain-specific mutations included PA1766 (putative α-l-glutamate ligase) and PA1767 (putative transglutaminase) inactivated in all ST175 lineages evolved in the presence of imipenem/relebactam. Likewise, purB (adenylosuccinate lyase) mutations were detected in two ST175 lineages and PA4390 (hypothetical protein) in two of the ST111 lineages.

Results for the AmpC E247K mutant of the ST175 clone evolved in the presence of ceftolozane/tazobactam or imipenem/relebactam are shown in Table 5. All lineages evolved in the presence of ceftolozane/tazobactam showed highly increased MICs (256–512 mg/L) without further significant modification of the MIC of any of the other antipseudomonal agents tested, except for a slight decrease in colistin MICs. Genomic analysis revealed in all cases additional mutations in ampC regulators and additional AmpC structural mutations. On the other hand, the lineages evolved in the presence of imipenem/relebactam showed moderately increased MICs (4–16 mg/L). In contrast to the ST175 lineages, major MIC differences between imipenem and imipenem/relebactam were not detected. Additionally, slightly increased MICs of meropenem and other β-lactams were documented. The genomic analysis revealed a completely different profile for the ST175 AmpC E247K evolved lineages as compared with the above data for ST175 lineages. Different mexB mutations were detected in the three lineages, and mutations in the mexR regulator of MexAB-OprM in two of them. Likewise, mutations in the PhoPQ two-component regulator were detected in two of the lineages.

Table 5.

Results of the characterization of the ST175 AmpC E247K high risk clone mutants obtained after 7 days of exposure to imipenem/relebactam (I/R) and ceftolozane/tazobactam (C/T), including susceptibility profiles and mutations detected through whole genome sequencing

Straina			TIC	TZP	AZM	CAZ	C/T	CZA	FEP	IPM		I/R	MEM	COL	CIP	AMK	TOB	Genotype
			(R > 16)	(R > 16)	(R > 16)	(R > 8)	(R > 4)	(R > 8)	(R > 8)	(R > 4)		(R > 2)	(R > 8)	(R > 2)	(R > 0.5)	(R > 16)	(R > 2)
PAO1			16	4	4	1–2	≤0.5	1	1–2		0.5–1	0.125–0.25	0.5–1	2	≤0.12	≤2	0.5	–
ST175-2 (103-H8)			512	32	32	64	64	>32	16		1	1	16	4	>16	4	32	oprD (Q142*), ampR (G154R), mexZ (G195D), gyrA (T83I, D87N), parC (S87W), ampC (E247K)
C/T	1	m1	256	32	32	>64	256	>32	16		2	0.5	4	1	>16	4	16–32	PA2583.1 (nt50InsAGAG), dacB (nt885Δ14), ampC (G129D)
		m2	256	32	32–64	>64	256	>32	16		2	0.5	4	1	>16	4	16–32	PA1964 (nt9InsAAAA), dacB (nt885Δ14), ampC (G129D)
	2	m1	256–512	32	64	>64	256	32	16–32		2	0.5	4	1	>16	4	32	PA1362 (nt223ΔGC), dacB (G282D), ampC (V366I)
		m2	512	32–64	64	>64	256–512	32	8–16		2	0.5	4	1	>16	4	16	dacB (T428P), ampC (V366I)
	3	m1	256–512	32–64	64	>64	256	32	16		2	0.5	4	1–2	>16	4	16–32	PA1362 (nt223ΔGC), ampC (D280E), mpl (nt1322Δ9)
		m2	512	32–64	64	>64	256	>32	16–32		2	0.5	4	1	>16	4	32	dacB (L469Q), ampC (R126S)
I/R	1	m1	>512	64	128	>64	64	>32	32		8–16	8	32	4	8–16	8	>32	mexR (E74*), mexB (V767G), phoQ (L364Q)
		m2	512	64	128	>64	64	16–32	32		16	8	32	4	8–16	8	>32	mexR (E74*), mexB (V767G), phoQ (L364Q)
	2	m1	512	>256	64	>64	64	>32	64		64	4–8	16	4	8–16	16–32	>32	mexB (V767G), phoP (L20P)
		m2	512	>256	64	>64	64	>32	64		32–64	8	16	4	8–16	16	>32	mexB (V767G), phoP (L20P)
	3	m1	>512	64–128	>128	>64	512	>32	64		16	16	64	4	8–16	4–8	>32	mexR (T130P), mexB (A627 V), PA4317 (P83T), PA5121 (T64P)
		m2	512	32	64	>64	128	>32	16–32		8	4–8	32–64	4	8–16	8	32	mexR (T130P), mexB (A627 V), PA4317 (P83T), PA5121 (T64P)

a

Data for two colonies (m1 and m2) from each of three experiments per treatment, imipenem/relebactam (I/R) or ceftolozane/tazobactam (C/T), are shown. MICs were determined in duplicate and both values obtained are shown when not identical. Relevant resistance genotype of the parental strain is indicated, and all acquired mutations detected in each of the mutants are listed.

Fitness and virulence of XDR high-risk clones evolved in the presence of ceftolozane/tazobactam or imipenem/relebactam

In vitro competition assays between each of the evolved lineages and PAO1 were performed, and results are shown in Figure 2. Competition assays between parent ST175, ST111 and ST235 strains and PAO1 were also included as reference. As shown, in all cases the lineages evolved in the presence of ceftolozane/tazobactam showed no or little fitness defect as compared with parent strains. In contrast, the lineages evolved in the presence of imipenem/relebactam showed a high fitness cost compared with parent strains and lineages evolved in the presence of ceftolozane/tazobactam. The fitness cost associated with imipenem/relebactam exposure was evidenced also when measuring individual growth rates for all ST235 and some ST111 lineages, but no major growth defects were detected for ST175 lineages (Figure S1, available as Supplementary data at JAC Online).

Figure 2.

Fitness (competition index, CI, with respect to PAO1) of ST111, ST235 and ST111 high-risk clones isolates evolved in the presence of ceftolozane/tazobactam or imipenem/relebactam. Dotted lines indicate basal CI for the respective parent strains. Statistical significance (Mann–Whitney U-test P values) for the comparisons are indicated.

The impact on virulence was also analysed using the C. elegans model and results are shown in Figure S2. Consistently with previous experiences,²⁵ parent ST175 was fully avirulent in this model and therefore the impact of the acquisition of ceftolozane/tazobactam or imipenem/relebactam in virulence could not be assessed. On the other hand, the vast majority of ST235 and ST111 lineages evolved in the presence of either imipenem/relebactam or ceftolozane/tazobactam showed a significantly reduced virulence compared with their respective parent strains.

Discussion

According to the WHO, MDR P. aeruginosa, along with Acinetobacter baumannii and Enterobacterales, are at the top of the list of pathogens for which the development of novel antibiotic treatments is critical.²⁶ The introduction of ceftolozane/tazobactam, along with ceftazidime/avibactam, has helped to mitigate this need to some extent.²⁷ Initial in vitro evolution experiments with reference wild-type strains evidenced that resistance development to ceftolozane/tazobactam required the simultaneous acquisition of mutations leading to the overexpression and the structural modification of AmpC and only occurred in a mutator (mutS deficient) background.⁶ In this work we show that high-level ceftolozane/tazobactam resistance emerges readily in XDR clinical isolates that already show AmpC overexpression or produce a narrow-spectrum OXA β-lactamase, due to mutations in the catalytic centres of these enzymes that lead to enhanced cephalosporin resistance and increased carbapenem susceptibility. Our results are thus consistent with recent evidence from clinical practice, from which resistance development is not uncommonly reported, and typically occurs during the treatment of infections by MDR/XDR strains that already show resistance to classical β-lactams through mechanisms such as AmpC overexpression or the production of OXA β-lactamases.^7–9,14,28 Moreover, it is noteworthy that most of the mutations detected in the catalytic centre of AmpC have also been documented to cause ceftolozane/tazobactam treatment failure in clinical practice.^7,14 In contrast to ceftolozane/tazobactam, imipenem/relebactam stepwise resistance development was not significantly increased for the tested XDR high-risk clone isolates, as compared with previous experiments with wild-type reference strain PAO1,¹² despite all of them being carbapenem resistant due to OprD inactivation. Moreover, imipenem/relebactam stepwise resistance development was not facilitated in a clinical XDR strain that had already acquired ceftolozane/tazobactam resistance during treatment. A further positive finding of this work is the absence of evidence of any potential for AmpC or OXA β-lactamases to evolve mutations conferring imipenem/relebactam resistance. Likewise, mutations in essential PBPs (such as PBP1a, PBP2, or PBP3) associated with development of high-level resistance in mutS deficient PAO1 strains were not detected in any of the evolved lineages.¹² However, as noted in the previous work for PAO1, overexpression and modification of the substrate specificity of efflux pumps such as MexAB-OprM could compromise to some extent the activity of relebactam.^12,29 Mutations in the two-component regulator ParRS were also selected in lineages evolved in the presence of imipenem/relebactam. ParRS mutations have been associated with MDR profiles since they lead to oprD downregulation, MexXY efflux pump overexpression and LPS modification.²¹ While oprD downregulation should not have a relevant impact in the studied XDR strains, since they all showed an inactivated OprD, the overexpression of the efflux pump could be behind the selection of parS mutations under imipenem/relebactam exposure. It is noteworthy that parS mutations, including the ones detected in this work, are frequently documented in the genomes of P. aeruginosa clinical strains.³⁰ Moreover, one of the genes highly upregulated by such parS mutations, PA1797, shows homology with β-lactamases.^21,31 The potential role of this determinant in carbapenem and imipenem/relebactam susceptibility is still under investigation in our laboratory, but RT-PCR assays have already confirmed PA1797 overexpression (>10-fold) in all parS mutants detected (data not shown).

Another relevant aspect to consider is the impact on fitness and virulence of the selected resistance mechanisms. Lineages evolved in the presence of imipenem/relebactam showed major fitness defects, as evidenced in competitive growth assays, and both ceftolozane/tazobactam and imipenem/relebactam lineages showed reduced virulence in the C. elegans model.

Beyond uncovering basic information on resistance mechanisms to novel β-lactams, this work provides some useful clues to be explored for their positioning and use in the treatment of P. aeruginosa infections from the perspective of antimicrobial stewardship: (i) ceftolozane/tazobactam and imipenem/relebactam do not show cross-resistance development, a fact that might be of interest from the perspective of treatment diversification in hospital wards; (ii) ceftolozane/tazobactam resistance development is collaterally associated with imipenem/relebactam increased susceptibility, and therefore the latter could be considered an appropriate rescue therapy in case of resistance development to the former; and (iii) resistance development to imipenem/relebactam remains low even for XDR strains resistant to all classical antipseudomonal β-lactams, whereas ceftolozane/tazobactam resistance is facilitated in XDR strains that overexpress ampC or produce OXA type β-lactamases. Thus, although further in vivo data and clinical experience are still needed, the information provided in this work might be useful for the selection of antipseudomonal treatments, positioning ceftolozane/tazobactam as an earlier option (i.e. for MDR strains that do not overexpress ampC or produce OXA β-lactamases) and considering imipenem/relebactam for the treatment of infections produced by XDR isolates showing these types of resistance mechanisms. Further alternatives are still needed, however, for the treatment of carbapenemase-producing strains.³²

Funding

This work was supported by Merck Sharp and Dohme (MSD) Investigator Initiated Studies Program and by Plan Nacional de I + D + i 2013–2016 and Instituto de Salud Carlos III, Subdirección General de Redes y Centros de Investigación Cooperativa, Ministerio de Economía, Industria y Competitividad, Spanish Network for Research in Infectious Diseases (REIPI RD16/0016) and grants PI18/00076 and PI21/00017 co-financed by European Development Regional Fund ERDF ‘A way to achieve Europe’, Operative program Intelligent Growth 2014–2020.

Transparency declarations

None to declare.

Data availability

Sequence files have been deposited in the European Nucleotide Archive under study number PRJEB48951

Supplementary data

Figures S1 and S2 are available as Supplementary data at JAC Online.