Ehlers–Danlos Syndrome: Molecular and Clinical Characterization of TNXA/TNXB Chimeras in Congenital Adrenal Hyperplasia

Abstract

Context

The syndrome CAH-X is due to a contiguous gene deletion of CYP21A2 and TNXB resulting in TNXA/TNXB chimeras.

Objective

To analyze TNXB gene status and to clinically evaluate the Ehlers–Danlos syndrome phenotype in a large cohort of Argentine congenital adrenal hyperplasia (CAH) patients to assess the prevalence of this condition in our population.

Methods

TNXB gene analysis was performed in 66 nonrelated CAH patients that were carriers of the CYP21A2 gene deletion. A molecular strategy based on multiplex ligation–dependent probe amplification and Sanger sequencing analysis was developed allowing for the detection of different, previously described TNXA/TNXB chimeras, named CH1, CH2, and CH3. The main outcome measures were TNXB status of CAH patients that were carriers of the CYP21A2 deletion in the homozygous or heterozygous state.

Results

TNXA/TNXB CH1 was found in 41%, CH2 in 29%, and CH3 in 1% of nonrelated alleles carrying the CYP21A2 deletion. Thus, overall 71% of alleles were found to carry a contiguous gene deletion. Sixty-seven percent of patients analyzed had a monoallelic form and 6% a biallelic form. All patients with the biallelic form had severe skin hyperextensibility and generalized joint hypermobility.

Conclusion

Based on the high frequency of TNXB alterations found in CYP21A2 deletion carrier alleles, we recommend evaluating TNXB status in these patients, and assessing connective tissue dysplasia, including cardiologic alterations in positive cases. The number of patients undergoing cardiological evaluation should be expanded to determine the incidence of structural and functional abnormalities in this cohort.

Congenital adrenal hyperplasia, CAH-X, CYP21A2, TNXB, Ehlers–Danlos syndrome, TNXA/TNXB chimera

21-Hydroxylase deficiency (21-OHD), the most common form of congenital adrenal hyperplasia (CAH), is an autosomal recessive disorder characterized by variable degrees of cortisol and aldosterone deficiencies and androgen excess (OMIM: 201910) (1). Clinical manifestations comprise a continuous spectrum of disease severity related to residual enzyme activity. The more severe or classical forms (salt-wasting and simple virilizing forms) account approximately for 1:16 000 live birth for Caucasian population (2).

In Argentina, Gruñeiro-Papendiek et al. reported a frequency of 1:8937 (3). The nonclassical or late onset form is the most common, varying from 1:1000 to 1:500 according to ethnicity and geographic area.

The 21-hydroxylase enzyme P450c21 is encoded by the CYP21A2 gene located on chromosome 6p21.33 within the human leukocyte antigen (HLA) major histocompatibility complex. This locus also contains CYP21A1P, a nonfunctional pseudogene, highly homologous (98% in exons) to the CYP21A2 gene. The locus is among the most complex in the human genome because it contains a group of sometimes overlapping genes and their pseudogenes spanning 30 kb duplicated units. The other duplicated genes are C4A and C4B, encoding 2 isoforms of complement factor C4, the RP1 gene (also called STK19) encoding a serine/threonine protein kinase, and the TNXB gene, encoding an extracellular matrix glycoprotein tenascin-X (TNX), in addition to the respective pseudogenes RP2 (or STK19P) and TNXA, comprising the RCCX module (RP-C4-CYP21-TNX) (4, 5) (Fig. 1A).

Figure 1.

(A) Genomic organization of the CYP21 locus: The functional CYP21A2 gene and its nonfunctional CYP21A1P pseudogene are arranged in tandem repeat with the 2 C4 genes encoding for factor 4 of the complement system. The functional TNXB and the TNXA pseudogene are localized on the complement strand. (B) Schematic representation of the 3 described TNXA/TNXB chimeras, which differ in the junction site. TNXB gene exons are represented in light gray and TNXA gene exons in darker gray. The white triangle indicates a 120 bp deletion in exon 35 and gray triangles indicate different pseudogene-derived variants. CH1: TNXA/TNXB chimera 1. CH2: TNXA/TNXB chimera 2. CH3: TNXA/TNXB chimera 3. (C) Molecular strategy for TNXA/TNXB-chimera analysis consisting of a mixed-primer strategy generating a 5010 bp fragment, which was used as a template for the subsequent sequence analysis to searching the different chimeras.

The transcriptional direction of TNXB and TNXA is opposite to that of the other genes of the cluster. TNXB is a large gene composed of 44 exons spanning 68.2 kb, whereas TNXA is a truncated gene of 4.5 kb, homologous to exons 32 to 44 of TNXB. The last exons of TNXA and TNXB are located in the 3′-untranslated region of CYP21A1P and CYP21A2, respectively.

The TNX protein belongs to a family of evolutionarily conserved large glycoproteins of the extracellular matrix (6). It plays a role in collagen deposition by dermal fibroblasts and is expressed in the dermis of the skin and in the connective tissue of the heart and skeletal muscle (7, 8). TNXB deficiency is associated with the development of Ehlers–Danlos syndrome (EDS).

EDS comprises a clinically and genetically heterogeneous group of connective tissue disorders characterized by joint hypermobility, skin hyperextensibility, and tissue fragility. In 2017, the International EDS Consortium proposed a revised EDS classification recognizing 13 subtypes (9). For most of these subtypes, mutations in collagen-encoding genes or in genes encoding collagen-modifying enzymes have been identified. TNX-deficient EDS (OMIM 606408) is caused by homozygous or compound heterozygous mutations in the TNXB gene. The clinical phenotype resembles the classical EDS type (classical-like EDS) with a pattern of autosomal recessive inheritance. TNXB haploinsufficiency is associated with hypermobility type EDS (hEDS) and it is caused by heterozygous mutations in the TNXB gene (10). As molecular analysis of the TNXB gene is challenging, the TNX-deficient type EDS is probably underdiagnosed.

The high degree homology between genes and their corresponding pseudogenes in this locus leads to frequent homologous recombination. Misalignment may occur during meiosis generating large gene deletions or gene conversion events resulting in chimeric genes. Overall, in 21-OHD patients 20% to 30% of the pathogenic variants in the CYP21A2 gene are CYP21A1P/CYP21A2 chimeras. To date, 9 such chimeras that differ in the junction site have been described (CYP21A1P/CYP21A2 CH1 to CH9) (11, 12).

Similarly, chimeric recombination occurs between TNXB and TNXA, and 3 TNXA/TNXB chimeras that differ in the junction site and result in a contiguous CYP21A2 and TNXB gene deletion (CH1 to CH3) have been described (13, 14) (Fig. 1B).

TNXA/TNXB CH1 is characterized by a 120 bp deletion in exon and intron 35 carried over from TNXA pseudogene sequences. TNXA/TNXB CH2 lacks this deletion but contains a pseudogene-derived variant c.12174C>G (p.Cys4058Trp) in TNXB exon 40. TNXA/TNXB CH3 is characterized by the presence of any variant of a cluster of 3 pseudogene-derived variants (exon 41: c.12218G>A, p.Arg4073His; exon 43: c.12514G>A, p.Asp4172Asn and c.12524G>A, p.Ser4175Asn). There is evidence that CH1 results in reduced dermal and serum TNX expression supporting a haploinsufficient mechanism while both CH2 and CH3 cause structural changes in the TNX protein. CH2 (p.Cys4058Trp) deletes a cysteine that forms a disulfide bond which has been shown to alter the structure of the protein by computational studies. The p.Arg4073His variant in CH3 is predicted to reduce protein-folding energy by interfering with a cation–pi interaction between p.Arg4073 and p.Phe4080. Because CH2 and CH3 produce altered proteins rather than reducing TNX expression, they are associated with a dominant-negative effect.

The contiguous gene deletion syndrome CAH-X, which is caused by deletions of the CYP21A2 and TNXB genes, was reported in 15.6% of CAH patients and 29.2% of patients carrying a CYP21A2 30 kb deletion with a TNXA/TNXB chimera (CH1 and CH2) (15). Very recently, Gao et al. have reported a frequency of TNXA/TNXB chimeras as high as 62.8% (CH1, CH2, CH3) in patients that are carriers of the CYP21A2 deletion (16).

Monoallelic and biallelic forms of CAH-X have been described (14). The term “autosomal recessive” has recently been replaced by the term “biallelic” to describe patients with CAH-X who have TNXB disease causing mutations on both alleles, as the former implies that having 1 affected allele does not result in clinical manifestations, which is not the case with CAH-X.

In this study we analyzed copy number variations and genetic status of the TNXB gene in a cohort of CAH patients carrying a CYP21A2 gene deletion to determine the prevalence of CAH-X syndrome in our population. Furthermore, clinical features of EDS were investigated to assess the impact on connective tissue dysplasia in these patients. A high frequency of TNXB alterations in CYP21A2 deletion carrier alleles was found in our population. In addition, all patients with the biallelic form had severe skin hyperextensibility and generalized joint hypermobility (GJH).

Materials and Methods

Patients

A total of 337 unrelated patients with CAH due to 21-OHD referred to our endocrine laboratory between 2005 and 2017 and whose diagnosis was confirmed by genetic testing were enrolled in the study.

Overall 66/337 patients who were carriers of a large 30 kb CYP21A2 gene deletion in the homozygous or heterozygous state (22 males, 44 females; aged 4 days to 36 years) along with 43 parents and 8 siblings that also carried the deletion were screened for TNXB defects. The 66 patients included in this group were those with a 30 kb deletion in which the junction site was downstream exon 7 (Table 1).

Table 1.

CYP21A2 and TNXB genotype and clinical evaluation of 66 CAH patients that were homozygous or heterozygous carriers of a large 30 kb CYP21A2 gene deletion with the junction site downstream exon 7

PATIENT (P)	CYP21A2		TNXB	EDS CLINICAL EVALUATION
	ALLELE 1	ALLELE 2	ALLELE 1/ALLELE 2
P1	DELCONV	DELCONV	CH1/CH1	X
P2	DELCONV	ClEx6;p.Val281Leu	CH1/N	X
P3	DELCONV	In2	CH1/N	X
P4	DELCONV	p.Arg356Trp	CH1/N
P5	DELCONV	p.Ile172Asn	CH1/N	X
P6	DELCONV	Del8bpE3	CH1/N
P7	DELCONV	DELCONV	CH1/CH2	X
P8	DELCONV	Del (E1-E3)	CH1/N
P9	DELCONV	p.Ile172Asn	CH1/N	X
P10	DELCONV	DELCONV	CH1/N	X
P11	DELCONV	p.Val281Leu	CH2/N
P12	DELCONV	p.Val281Leu	N/N
P13	DELCONV	DELCONV	N/N
P14	DELCONV	DELCONV	CH1/CH1	X
P15	DELCONV	p.Val281Leu	N/N
P16	DELCONV	p.Ile172Asn;p.Val281Leu	CH1/N
P17	DELCONV	In2	CH1/N	X
P18	DELCONV	In2	CH2/N
P19	DELCONV	In2	CH2/N	X
P20	DELCONV	p.Ile172Asn	N/N
P21	DELCONV	p.Arg356Trp	CH1/N	X
P22	DELCONV	In2	N/N
P23	DELCONV	p.Val281Leu	CH2/N	X
P24	DELCONV	p.Gln318Ter	CH1/N
P25	DELCONV	p.Ile172Asn	CH2/N
P26	DELCONV	p.Val281Leu	CH2/N
P27	DELCONV	p.Val281Leu	N/N
P28	DELCONV	p.Arg356Trp	CH1/N
P29	DELCONV	ClEx6;p.Val281Leu	N/N
P30	DELCONV	In2	CH2/N
P31	DELCONV	p.Ile172Asn	CH1/N
P32	DELCONV	p.Gln318Ter	CH2/N
P33	DELCONV	p.Gln318Ter	CH1/N
P34	DELCONV	p.Val281Leu	CH1/N
P35	DELCONV	p.Val281Leu	CH2/N
P36	DELCONV	In2	CH2/N	X
P37	DELCONV	In2	N/N
P38	DELCONV	p.Val281Leu	N/N
P39	DELCONV	In2	CH1/N
P40	DELCONV	p.Gln318Ter	CH2/N	X
P41	DELCONV	DELCONV	CH1/CH2	X
P42	DELCONV	p.Arg356Trp	CH2/N	X
P43	DELCONV	p.Val281Leu	N/N
P44	DELCONV	p.Val281Leu	CH3/N
P45	DELCONV	PromCYP21A1P;p.Pro30Leu	CH1/N
P46	DELCONV	p.Pro30Leu; Pro482Ser	CH2/N
P47	DELCONV	In2	CH1/N
P48	DELCONV	In2	CH2/N
P49	DELCONV	p.Val281Leu	CH2/N
P50	DELCONV	ClEx6;p.Val281Leu	N/N
P51	DELCONV	p.Ile172Asn	N/N
P52	DELCONV	ClEx6	CH1/N
P53	DELCONV	p.Val281Leu	CH1/N
P54	DELCONV	p.Ile172Asn	N/N
P55	DELCONV	In2	CH1/N	X
P56	DELCONV	p.Val281Leu	CH2/N
P57	DELCONV	p.Val281Leu	N/N
P58	DELCONV	DELCONV	N/N
P59	DELCONV	In2	CH2/N
P60	DELCONV	p.Arg426His	N/N
P61	DELCONV	p.Pro453Ser	N/N
P62	DELCONV	p.Ile172Asn	CH2/N
P63	DELCONV	p.Val281Leu	N/N
P64	DELCONV	p.Arg356Trp	CH2/N
P65	DELCONV	PromCYP21A1P;p.Pro30Leu	CH1/N
P66	DELCONV	In2	CH1/N

Nomenclature of different mutations at the protein and nucleotide level is as follows: p.Pro30Leu: g.89C>T, c.89C>T; In2: g.656C>G, c.293-13C>G; Del8bpE3: p.Gly110ValfsTer21, g.708_715delGAGACTAC, c.329_336delGAGACTAC; p.Ile172Asn: g.1000T>A, c.515T> A; ClEx6: [Ile236Asn;Val237Glu;Met239Lys], g.[1382T>A;1385T>A;1391T>A], c.[707T>A;710T>A;716T>A]; p.Val281Leu: g.1685G>T, c.841G>T; p.Gln318Ter: g.1996C>T, c.952C>T; p.Arg356Trp: g.2110C>T, c.1066C>T; p.Pro453Ser: g.2581C>T, c.1357C>T; p.Arg483ProfsTer58: g.2671_2672delGGinsC, c.1447-1448delGGinsC; DELCONV: large rearrangements (30 kb deletion including 3′ of CYP21A1P and 5′ of CYP21A2 and CYP21A2 converted to CYP21A1P in the 5′ part).

NCBI Reference sequence: NG_007941.2.

Abbreviations: CAH, congenital adrenal hyperplasia; CH1, TNXA/TNXB chimera 1; CH2, TNXA/TNXB chimera 2; CH3, TNXA/TNXB chimera 3; EDS, Ehlers–Danlos syndrome.

Informed consent for the genetic study was obtained from all adult patients or the parents of the patients. Consent was obtained after full explanation of the purpose and nature of all procedures used. The study was approved by the Institutional Ethics Committee of Hospital de Pediatría “Prof. Dr J. P. Garrahan.”

Clinical evaluation focusing on the phenotype based on connective tissue involvement associated with EDS was performed in those individuals who were able to attend the appointment after being called. Overall, 17 unrelated probands, 3 siblings, and 12 parents in whom a TNXB alteration was found were available for clinical evaluation. For all patients physical examination and review of medical and family histories were performed by the same examiner looking for clinical manifestations of classical-like EDS and hEDS as previously reported (10) (Table 1).

The Beighton 9-point scoring system was used to evaluate GJH defined as a Beighton score ≥6 for children, ≥5 for postpubertal adolescents and adults under 50 years old, and ≥4 for adults ≥50 years old (17, 18).

Structural cardiac abnormalities were evaluated by echocardiography.

Molecular Analysis

The CYP21A2 gene was analyzed for 11 common mutations using DNA extracted from peripheral blood leukocytes by standard procedures as previously described (19).

In brief, the 10 most common point mutations were analyzed with allele-specific polymerase chain reaction (In2, Del8bpE3, p.Ile172Asn, ClEx6, p.Val281Leu, p.Arg356Trp, p.Pro453Ser, p.Arg483ProfsTer58) or restriction fragment length polymorphism (p.Pro30Leu, p.Gln318Ter) while gene deletions and large gene conversions (DEL/CONV) were detected with Southern blot analysis of TaqI and BglII digested DNA hybridized with a specific radiolabeled probe for CYP21 or multiplex ligation probe amplification (MLPA) analysis (SALSA P050-CAH, MRC Holland). Human genome variation society (HGVS) nomenclature of mutations is described in the footnotes of Table 1. Gene sequence analysis was performed when at least 1 nondetected allele was present after analysis of the 10 most common point mutations and large gene deletions or conversions (19).

Analysis of the TNXB gene was performed with a specifically developed molecular strategy that allowed for the detection of different previously described TNXA/TNXB chimeras (13, 14). The presence of TNXA/TNXB CH1 was evidenced by a 120 bp deletion in TNXB exon 35 that derives from the TNXA pseudogene (SALSA P050-CAH version C1, MRC Holland) using the MLPA technique according to the manufacturer’s instructions. Multiplex polymerase chain reaction (PCR) amplification fragments were detected using capillary electrophoresis (ABI PRISM® 3130 Genetic Analyzer capillary DNA Sequencer, Applied Biosystems, Buenos Aires, Argentina). The data obtained by gene scanning were analyzed using Genemarker software (Softgenetics).

To assess the presence of different TNXA/TNXB chimeras, a PCR using a mixed oligonucleotide strategy was designed. We amplified a 5010 bp fragment of the TNXB gene that included from part of intron 31 to part of intron 43 using a pair of previously reported primers (20) and Taq polymerase Expand™ Long Template PCR System–Roche. The sequences of primers used were TNXB-31R: 5′-CTCGATCACAGCAGGGAAG-3′ (with the complementary sequence of a specific region in intron 31 of TNXB, absent in TNXA) and TNXB-42.43F: 5′-CTGTTACACTGTGGGGCTGA-3′ (with the complementary sequence of intron 43 present in TNXB and TNXA) (Fig. 1C).

Following PCR, the product was assessed using electrophoresis on a 1% agarose gel stained with ethidium bromide and showing a single band with expected size. The PCR product was purified (Qia Quick PCR Purification Kit, Qiagen, Buenos Aires, Argentina) and exons 35, 40, 41, and 43 were sequenced using a BigDye Terminator version 3.1 cycle sequencing kit (Applied Biosystems, Buenos Aires, Argentina) on an ABI PRISM® 3130 Genetic Analyzer capillary DNA Sequencer (Applied Biosystems, Buenos Aires, Argentina). The primers used for sequencing are shown in Table 2.

Table 2.

List of primers used for TNXB sequencing

Primer	Sequence 5′3′
TNXB-34.35R	ATCTGCAGAGCGACTTCCAT
TNXB-34.35F	CCCTCCTCGTTCTCTCTCAA
TNXB-40.41R	CGTGTCCACCTCTTTCACC
TNXB-40.41F	ACGCGCATGGAGTAGTCAC
TNXB-42.43R	CACAGGGACTGGGGAACTAC
TNXB-42.43F	CTGTTACACTGTGGGGCTGA

The nucleotide sequences obtained were compared with those from Genbank accession number: RefSeqGene NG_008337.2, using SeqScape software v0.2.6 (Applied Biosystems).

All TNXA/TNXB CH1 alleles were identified by MLPA analysis and confirmed by TNXB exon 35 Sanger sequencing while the CH2 and CH3 alleles were identified by sequence analysis of different pseudogene missense variants in exons 40, 41, and 43. Genomic organization of CYP21A2/TNXB locus and the 3 TNXA/TNXB chimeras’ structure (CH1 to CH3) are shown in Fig. 1A and 1B.

Results

TNXB Molecular Analysis

A total of 337 nonrelated patients with CAH due to 21-OHD confirmed by molecular diagnosis were enrolled in the study. Overall, 66/337 patients (19.6%) were found to carry a large 30 kb CYP21A2 gene deletion in the homozygous or heterozygous state. In these 66 patients a total of 73 alleles with a large 30 kb CYP21A2 gene deletion were found.

For TNXB molecular study, initially all 66 probands (index cases) were analyzed for the presence of CH1 using MLPA analysis evidenced by the 120 bp deletion in TNXB exon 35, and confirmed by exon 35 sequence analysis.

The presence of TNXA/TNXB CH1 was found in 30 alleles (41%) out of 73 nonrelated alleles that carried the CYP21A2 gene deletion from the 66 probands analyzed.

In addition, all 66 probands were screened for other TNXB alterations related to CH2 and CH3 by Sanger sequencing of exons 40, 41, and 43.

In the analysis of 73 nonrelated alleles carrying a CYP21A2 gene deletion, a CH2 was found in 21 (29%) and a CH3 in 1 (1%).

Taken the 3 chimeras together, 71% of alleles were found to carry a contiguous gene deletion that extended into TNXB gene.

Of 66 nonrelated patients that were homozygous or heterozygous for the CYP21A2 gene deletion and were evaluated in this study for copy number variations of the TNXB gene, the monoallelic form was found in 44 patients (67%) and the biallelic form in 4 (6%) (Fig. 2). The overall rate of CAH-X patients in this cohort was 44/337 (13%) for monoallelic and 4/337 (1%) for biallelic form.

Figure 2.

(A) Distribution of the 3 TNXA/TNXB chimeras found in 73 alleles carrying the complete deletion of the CYP21A2 gene. The presence of a CH1 was found in 30 alleles (41%), CH2 was found in 21 alleles (29%), and CH3 in 1 allele (1%). Considering all 3 chimeras, 71% of alleles were found to carry a contiguous gene deletion that extended into the TNXB gene. (B) Distribution of the 3 TNXA/TNXB chimeras found in 66 probands with a diagnosis of CAH carrying the complete deletion of the CYP21A2 gene in the homozygous or heterozygous state. The monoallelic form was found in 44 patients (67%) and the biallelic form in 4 (6%). CH1, TNXA/TNXB chimera 1; CH2, TNXA/TNXB chimera 2; CH3, TNXA/TNXB chimera 3.

Whenever possible, the presence of the chimera was confirmed in both parents for the biallelic form or in 1 parent for the monoallelic form. Overall, 25 mothers and 20 fathers were analyzed. In all of them, the presence of the chimera was confirmed in CYP21A2 deletion allele, while in 2 fathers neither the chimera nor the CYP21A2 deletion was found (de novo deletion).

Moreover, 1 patient (P6) was found to harbor the CH1 in 1 allele inherited from her father. MLPA and sequence analysis revealed the presence of CH1 in DNA blood leukocytes of the patient’s father in a lower proportion than in a heterozygous patient, suggesting a probable mosaicism in the father (Fig. 3).

Figure 3.

The family of P6; TNXA/TNXB CH1 mosaicism was found in the father. In the sample of the father, MLPA analysis was repeated when the CYP21A2 deletion that had been found in the index case was not observed (in the sample of the mother a Del8bp E3 point mutation was found). Sequencing of TNXB exon 35 revealed the presence of CH1 (120 bp deletion) in a lower proportion than in a heterozygous patient together with a normal sequence. With this result, the relative height of peaks in CYP21A2 and TNXB probes were revised in the sample of the father, and it was found to be borderline between a normal control and a heterozygous patient. RV ratio, deletion < 0.75; normal 0.75–1.30; duplication > 1.30. (A) Pedigree of the family (P6). The female proband inherited Del8bpE3 point mutation in the CYP21A2 gene from her mother (in light gray) and TNXA/TNXB CH1 from her father (in black). Molecular analysis revealed mosaicism in the DNA sample from the father extracted from peripheral blood leukocytes (in dark gray). (B and C) MLPA and sequence analysis, respectively, shows the presence of CH1 in heterozygous state in the patient while the DNA extracted from blood leukocytes of the father shows the presence of CH1 in a lower proportion than in a heterozygous patient suggesting the presence of mosaicism.

We also analyzed the presence of the chimera in 7 siblings (4 affected and 3 carriers) and 1 other relative from 1 family.

Figure 4 shows the pedigrees and genetic data of the different chimeras found in 4 patients with the more severe biallelic form.

Figure 4.

Biallelic CAH-X Genetics. Different TNXB variants found on the paternal and maternal alleles of each proband, and pedigrees of 4 biallelic CAH-X families. Light gray represents the TNXB sequence and darker gray represents the TNXA sequence in each chimera found. CH1: TNXA/TNXB chimera 1. CH2: TNXA/TNXB chimera 2.

When we analyzed the TNXB variants in exons 35, 40, 41, and 43 in these 4 patients, P1 was found to be homozygous for CH1. Molecular studies revealed that this patient was homozygous for the 120 bp deletion in exon 35, the c.12174C>G (p.Cys4058Trp) variant, and for the 3 variant cluster [exon 41: c.12218G>A (p.Arg4073His); exon 43: c.12514G>A (p.Asp4172Asn) and c.12524G>A (p.Ser4175Asn)].

In P7, compound heterozygosity for CH1 and CH2 was found. Molecular studies revealed a heterozygous exon 35 120 bp deletion, homozygous exon 40: c.12174C>G (p.Cys4058Trp), exon 41: c.12218G>A (p.Arg4073His) and exon 43: c.12524G>A (p.Ser4175Asn) variants; but a heterozygous for exon 43: c.12514G>A (p.Asp4172Asn) variant.

P14 was found to be homozygous for the 120 bp deletion in exon 35 (homozygous for CH1), and for the exon 41: c.12218G>A (p.Arg4073His) variant, but heterozygous for 3 other variants.

And finally, in P41 compound heterozygosity for CH1 and CH2, but homozygosity for 4 other variants was found.

As shown in Fig. 5, in patients with monoallelic forms, the 120 bp deletion in exon 35 and all other 4 variants were the most frequent allelic variant found in the CH1 alleles (18/24 alleles). In the majority of the CH2 alleles, the presence of all 4 variants was also the most frequent allelic variant found (12/19 alleles).

Figure 5.

Haplotypes with the different variants in the chimeras found in monoallelic CAH-X probands. Of 44 monoallelic CAH-X probands found in this study, 24 were carriers of CH1, 19 carriers of CH2, and 1 carrier of CH3. The presence of different polymorphisms are shown in all the haplotypes found. The presence of a 120 bp deletion in exon 35 and all other 4 variants were the most frequent allelic variant found in the CH1 alleles (18/24 alleles). In the majority of the CH2 alleles the presence of all 4 variants were the most frequent allelic variant found (12/19 alleles). Light gray represents the TNXB sequence and darker gray represents the TNXA sequence in each chimera found. N indicates the total number of each chimera found. Numbers under each haplotype indicate the quantity was found of each. CH1: TNXA/TNXB chimera 1. CH2: TNXA/TNXB chimera 2.CH3: TNXA/TNXB chimera 3.

Clinical Findings in Patients With Biallelic and Monoallelic Forms

Table 3 shows the clinical findings associated with EDS in the 4 patients with biallelic forms. All 4 patients had GJH as well as thin skin and skin laxity. Echocardiography revealed structural cardiac abnormalities in 2, consisting of an atrial septum defect in P7 and a dysplastic pulmonary valve in P41. In addition, other distinct features related to the classical type Ehlers–Danlos phenotype were observed (Table 3).

Table 3.

Clinical findings in 4 CAH-X patients with the biallelic form

Patient (P)	Sex/age (years)	CAH clinical form	TNXA/TNXB chimeras	Musculoskeletal (Beighton score)	Other musculoskeletal findings	Skin findings	Cardiac findings	Additional clinical findings
P1	M / 13	SW	CH1/CH1	Generalized joint hypermobility (7)	Hypermobility of fingers. Transient hip synovitis	Thin skin with laxity. Easy bruising. Striae (abdomen and groin). Piezogenic Papulae	Normal echocardiography	Bilateral pes planus. Genu valgo
P7	F/10	SW	CH1/CH2	Generalized joint hypermobility (9)	Hypermobility of fingers, shoulders and hip	Thin skin with laxity	Atrial septum defect	Edema
P14	F / 2	SW	CH1/CH1	Generalized joint hypermobility (9)	Hypermobility of large and small joints. 4th left finger camptodactyly	Thin skin with laxity. Easy bruising	N/E	Growth retardation (height SDS: –2.88)
P41	M / 7	SW	CH1/CH2	Generalized joint hypermobility (9)	Chronic arthralgias in knees and shoulders. Hypermobility of fingers.	Thin skin with laxity. Easy bruising	Dysplastic pulmonary valve.	Right inguinal hernia. Growth retardation (weight SDS: –2.2; height SDS: –2.14)

Abbreviations: CAH, congenital adrenal hyperplasia; CH1, TNXA/TNXB chimera 1; CH2, TNXA/TNXB chimera 2; N/E, not evaluated; SW, salt wasting.

P41 presented with a more severe EDS phenotype, with a Beighton score of 9/9, indicating severe GJH and greater skin involvement displayed by soft and hyperelastic skin (which could be stretched over 3 cm in the neck) as well as easy bruising. He also had a history of unilateral inguinal hernia and chronic joint pain in knees and shoulders. Similarly, P7 showed greater skin involvement, with soft hyperelastic skin and edema, and also severe GJH with a Beighton score 9/9. In the 2 latter patients, compound heterozygosis for CH1 and CH2 was found. Among the 4 biallelic patients, they seemed to have the most severe phenotype, and with greater skin manifestations in particular (Fig. 6).

Figure 6.

Clinical findings in probands with biallelic CAH-X. Hypermobility of small joints and large joints (1, 3-7, 10), hyperextensible skin (2, 8), striae in abdomen (9), and piezogenic pedal papules (11) were found. P1: images number 9 and 11; P7: images number 6, 7, 8, and 10; P41: images number 1, 2, 3, 4, and 5.

Patients P14 and P41 presented with short stature (Table 3). P14 was born at term with adequate body length, weight, and head circumference for gestational age. At the time of first evaluation (2 years of age) she had postnatal growth failure (height standard deviation score [SDS]: –2.88). P41 was born at term (40 weeks) with adequate auxological parameters for gestational age: body length 54 cm (SDS: +1.89) and weight 4.150 kg (SDS: +1.46). Growth retardation has been present since 2 years of age: height 81 cm (SDS: –2.16) and weight 9.700 kg (SDS: –2.66). Growth hormone stimulation testing with arginine and clonidine was performed at 6.25 years of age (height 107.9 cm, –2.17 SDS) with a normal response.

Table 4 shows clinical findings in parents of patients with biallelic forms who were available for clinical evaluation. A less severe phenotype was observed in monoallelic parents than in CAH-X probands. In all of them, GJH together with symptoms compatible with hEDS were found while skin hyperextensibility was present in the 2 CH2 carriers.

Table 4.

Clinical findings in the parents of biallelic CAH-X patients

Patient (P)	Mother	Father
P1	Heterozygous CH1	Heterozygous CH1
	Beighton Score 5, easy bruising, knee hypermobility, long uvula	N/E
P7	Heterozygous CH1	Heterozygous CH2
	Beighton score 4, hypermobility	Thin skin with laxity, shoulder subluxation, pes planus
P14	Heterozygous CH1	Heterozygous CH1
	N/E.	N/E
P41	Heterozygous CH2	Heterozygous CH1
	Beighton score 5, thin skin with laxity	N/E

Abbreviations: N/E, not evaluated; CH1, TNXA/TNXB chimera; CH2, TNXA/TNXB chimera 2.

Table 5 shows the clinical findings in nonrelated patients (n = 8), affected sibling (n = 1), and parents (n = 5) with TNXA/TNXB CH1 monoallelic forms that were available for clinical evaluation. Table 6 shows the clinical findings in nonrelated patients (n = 5), affected siblings (n = 2), and parents (n = 4) with TNXA/TNXB CH2 monoallelic forms that were available for clinical evaluation (total probands, n = 16).

Table 5.

Clinical findings in nonrelated monoallelic CH1 CAH-X patients, their affected monoallelic CH1 CAH-X siblings, and the parents evaluated

Patient (P)	Gender	Age (y)	CAH phenotype	GJH (Beighton score)	Dermatologic findings	Echocardiogram	Other clinical features
P9	F	10.9	SV	No (3)	Easy bruising	NE	Long uvula
P21.I	M	8	SW	Yes (6)		Normal	Lumbar hyperlordosis, bilateral hallux valgus
P21.II	F	5.3	SW	Yes (6)	Thin skin with laxity	Normal	Lumbar hyperlordosis
P3	F	10.4	NC	Yes (6)	Thin skin with laxity, easy bruising	Normal	Multiple dislocations, chronic constipation
P17	F	10.9	SW	No (3)	Easy bruising	N/E	Long uvula
P55	M	9.8	SW	Yes(7)		N/E	Pes planus
P5	F	3.4	SW	No (3)		Trivial mitral insufficiency	Long uvula high palate, convergent strabismus, chronic abdominal pain
P2	M	3	SW	Yes (6)		Normal	Chronic constipation
P10	F	5	SW	Yes(7)		Normal	Arthralgias, elbow dislocations, pes planus , long uvula constipation
Parent
Mother P9	F	24		No (4)		N/E
Mother P21	F	33		Yes (5)		N/E	Hallus valgus, post cesarean intestinal eventration
Mother P55	F	33		Yes (6)		N/E	Hallus valgus, pes planus, long uvula
Mother P5	F	33		Yes (6)		N/E	Chronic arthralgias
Mother P2	F	30		Yes (6)	Mild skin laxity	Normal

Roman numerals (I, II) indicate 2 CAH-X affected siblings in the same family. GJH was evaluated using the 9-point Beighton scale. Arthralgias were defined as at least 3 months of duration.

Abbreviations: CAH-X: contiguous gene deletion syndrome (CYP21A2-TNXB); CH1, TNXA/TNXB chimera 1; GJH, generalized joint hypermobility; NC, nonclassical; N/E, not evaluated; SV, simple virilizing; SW, salt wasting.

Table 6.

Clinical findings in nonrelated monoallelic CH2 CAH-X patients, their affected monoallelic CH2 CAH-X siblings, and the parents evaluated

Patient (P)	Gender	Age (y)	CAH Phenotype	GJH (Beighton score)	Dermatologic findings	Echocardiogram	Other clinical features
P42.I	F	10	SW	NO (3)	Striae	N/E	Pes planus
P42.II	F	7	SW	NO (3)		N/E	Scoliosis
P40.I	M	17	SW	YES (6)	Skin with laxity (neck and elbows)	N/E	Long uvula
P40.II	M	6	SW	NO (5)	Skin with laxity (neck and elbows)	N/E	High palate
P36	F	7	SW	YES (6)		Normal	Long uvula
P19	F	4.8	SV	YES (7)		Mitral regurgitation	High palate
P23	F	37.9	NC	YES (6)	Thin skin with laxity, easy bruising	Normal	Pes planus
Parent
Mother P42	F	26		YES (5)		N/E
Father P40	M	41		NO (4)	Skin with laxity (neck and elbows)	N/E	Multiple dislocations, long uvula
Mother P36	F	26		YES (6)		N/E	Hallux valgus, pes planus, long uvula, chronic constipation
Father P19	M	42		NO (0)		N/E	Fibromyalgias, history of recurrent sprained ankle

Roman numerals (I, II) indicate 2 CAH-X affected siblings in the same family. GJH was evaluated using the 9-point Beighton scale. Arthralgias were defined as at least 3 months of duration.

Abbreviations: CAH-X, contiguous gene deletion syndrome (CYP21A2-TNXB); CH2, TNXA/TNXB chimera 2; GJH, generalized joint hypermobility; NC, nonclassical; N/E, not evaluated; SV, simple virilizing; SW, salt wasting.

All probands had clinical features of the hEDS phenotype. GJH was observed in 6/9 (66.7%) and 4/7 (57.1%) CH1 and CH2 patients, respectively, while skin hyperextensibility was seen in 2/9 (22.2%) and 3/7 (42.9%) CH1 and CH2 patients respectively. Although not statistically significant, a trend toward a higher prevalence of joint hypermobility symptoms was observed in monoallelic CH1 patients and skin involvement in monoallelic CH2 patients (Fisher exact test P = 1.00 for GJH and P = .59 for skin hyperextensibility).

Cardiac defects, consisting of trivial mitral insufficiency and mitral regurgitation, were found in 2/10 (20%) monoallelic patients. All affected parents evaluated also had clinical features of hEDS; however, their phenotype was less severe than that of the probands.

Discussion

For this study, we developed a molecular strategy to characterize the 3 TNXA/TNXB chimeras described in CAH-X patients. In the CYP21A2/TNXB locus, molecular analysis is challenging and may lead to errors due to the complexity of gene duplications, deletions, and rearrangements within chromosome 6. In addition, next generation sequencing is complicated, as regions with high homology and high polymorphism may lead to false-positive variant calls when reads are incorrectly aligned to a homologous region, but also to false-negative results when variant-containing reads align to homologous loci. Therefore, we developed a strategy based on Sanger sequencing and MLPA analysis that allowed us to accurately characterize a large cohort of 21-OHD patients that were carriers of the CYP21A2 large 30 kb deletion in 1 or both alleles. This is the first time that molecular analysis of the TNXB gene is described in a large Argentinian cohort of 21-OHD patients.

In our population of 21-OHD patients carrying the CYP21A2 deletion, the incidence of TNXA/TNXB chimeras was higher than previously described (11, 13, 15, 16). This finding may be related to differences in terms of ethnicity in our population or to the methodological approach used in the molecular study of TNXA/TNXB chimeras. In this line, a lower frequency (29.2%) was found in a study using other methodologies, such as qPCR and ddPCR (15), whereas, recently, a comparable frequency of 62.8% was reported by Gao et al. using a similar methodology based on Sanger sequencing and MLPA analysis in a cohort of patients from China (16). The overall prevalence of CAH-X in 21-OHD patients in our cohort was 14%, which was similar to that previously found in a large cohort from the NIH or in the Chinese population (15% and 14% respectively) (15, 16).

In agreement with other studies performed in different populations, the TNXA/TNXB CH1 was the most frequently found chimera (13, 16).

Interestingly, mosaicism for TNXA/TNXB chimeras was observed in 1 family (Fig. 3). CAH mosaicism was previously reported (21, 22); however, to our knowledge mosaicism for TNXA/TNXB chimeras has not been described before.

CH3 was first reported in a biallelic patient and its significance is still under investigation (14). Recently, Gao et al. have also reported the presence of CH3 in 11 monoallelic patients, but only 1 of them was clinically evaluated (16). In our cohort, CH3 was found in only 1 monoallelic patient, but unfortunately she was not available for clinical evaluation. As CH3 seems to be rare, assessing connective tissue dysplasia in this patient would be interesting to elucidate its significance in EDS phenotype.

In our cohort of 21-OHD patients, the characterization of copy number variation and TNXB status led us to clinically evaluate the patients with a focus on the EDS phenotype to assess the degree of connective tissue dysplasia. Interestingly, clinical manifestations of EDS that were not previously suspected were identified in many of them.

Musculoskeletal manifestations including cardiac abnormalities secondary to connective tissue disorders have been reported in EDS; unfortunately, a number of patients in our CAH-X cohort were not available for clinical evaluation, mainly due to travel cost–related inconveniences. This is a major drawback of our study. Nevertheless, in all the patients that could be evaluated, clinical features of EDS were found. Moreover, we here report the molecular characterization related to clinical EDS phenotype in the largest number of biallelic patients to date.

Severe skin hyperextensibility, GJH, and general symptoms of connective tissue alterations were observed in 4 biallelic patients. Consistent with previous reports, more severe clinical manifestations were found in patients with a biallelic than in those with a monoallelic form (14).

In all 4 patients, molecular studies revealed different combinations of TNXB chimeras and variants in both alleles (Fig. 4). Interestingly, P1 was homozygous for CH1 (for the 120 bp deletion in exon 35, the p.Cys4058Trp variant, and the 3 variant cluster). Prior studies performed in carriers of monoallelic CH1 showed reduced dermal and serum TNX expression compared to controls, supporting a haploinsufficient mechanism (11, 23, 24).

P7 and P41 presented with a more severe phenotype consisting mainly of skin abnormalities. Both of them were found to be compound heterozygous for CH1 and CH2. The p.Cys4058Trp variant characteristic of CH2 has been shown to result in the loss of a critical disulfide bond in the tertiary structure of the TNX C-terminal fibrinogen-like domain, leading to at least partial misfolding and a functional impact. Nevertheless, TNX expression was unchanged suggesting a dominant-negative effect (13).

Compared with haploinsufficiency, a dominant-negative effect causes a more severe phenotype displayed by greater skin and joint involvement in monoallelic CAH-X CH2 patients and an even greater disruption of elastic and fibrillin-1 fibers in biallelic CAH-X CH2 patients. Moreover, an accumulative effect of missense variants on the same allele is suggested to result in a more severe phenotype (14). Molecular characterization of CH2 in our 2 patients (P7 and P41) showed the presence of the exon 40 p.Cys4058Trp variant together with a cluster of the exon 41 p.Arg4073His and exon 43: p.Ser4175Asn and p.Asp4172Asn variants, probably generating more detrimental effects in the protein (Fig. 4).

Two biallelic patients (P14 and P41) presented with postnatal growth retardation. To our knowledge, this clinical manifestation was not previously reported in patients carrying a TNXB deletion, either in monoallelic or in biallelic form. It could be hypothesized that in these patients chondrogenesis is affected through a possible role of TNX in growth plate chondrocytes. Nevertheless, inadequate steroid replacement therapy and the possibility of other unrelated genetic defects as a cause of their short stature could not be ruled out.

In agreement with other reports, cardiac abnormalities were found on echocardiography in 50% (2/4) of the biallelic probands, consisting of an atrial septum defect in 1 and a dysplastic pulmonary valve in the other. As the former is a prevalent congenital defect in the general population, it was likely not related to the EDS phenotype. Cardiac abnormalities were also found in 22% of the monoallelic probands. However, 1 of the limitations of our study is that cardiovascular magnetic resonance was not available and the number of patients studied was reduced. Therefore, it would be important to expand the number of patients undergoing cardiac evaluation and cardiovascular magnetic resonance to determine the incidence of structural and functional abnormalities in this cohort.

Based on the high frequency of TNXB alterations in the alleles carrying a CYP21A2 deletion, we recommend evaluating TNXB status in these patients and assessing connective tissue dysplasia including cardiologic alterations in positive cases.

Finally, the molecular strategy described in this study allowed us to characterize TNXB alterations in the molecular diagnosis of CAH-X. The identification of the CAH-X syndrome and molecular characterization of these patients contributes to our understanding of the molecular mechanisms involved in TNX physiology. Early detection of CAH-X is important to prevent long-term musculoskeletal manifestations. Physical therapy for joint instability may be helpful to reduce the risk of late development of joint dislocations and chronic musculoskeletal pain.

Furthermore, molecular characterization of CAH-X is important for genetic counseling and may contribute to the improvement of the clinical management of patients preventing long-term symptoms of EDS.

Abbreviations

Abbreviations
 
• 21-OHD

  21-hydroxylase deficiency; CAH, congenital adrenal hyperplasia; EDS, Ehlers–Danlos syndrome; GJH, generalized joint hypermobility; hEDS, hypermobility type EDS; MLPA, multiplex ligation probe amplification; PCR, polymerase chain reaction; TNX, tenascin-X.

Additional Information

Disclosures: The authors declare that the research was conducted in the absence of any conflict of interest.

Data Availability

All data generated or analyzed during this study are included in this published article.