Abstract

Anopheles melas is a brackish water mosquito found in coastal West Africa where it is a dominant malaria vector locally. In order to facilitate genetic studies of this species, 45 microsatellite loci originally developed for Anopheles gambiae were sequenced in An. melas. Those that were suitable based on repeat number and flanking regions were examined in 2 natural populations from Equatorial Guinea. Only 15 loci were eventually deemed suitable as polymorphic markers in An. melas populations. These loci were screened in 4 populations from a wider geographic range. Heterozygosity estimates ranged from 0.18 to 0.79, and 2.5–15 average alleles were observed per locus, yielding 13 highly polymorphic markers and 2 loci with lower variability. To examine the usefulness of microsatellite markers when applied in a sibling species, the original An. gambiae specific markers were used to amplify 5 loci in An. melas. Null alleles were found for 1 An. gambiae marker. We discuss the pitfalls of using microsatellite loci across closely related species and conclude that in addition to the problem of null alleles associated with this practice, many loci may prove to be of very limited use as polymorphic markers even when used in a sibling species.

Microsatellite markers have been widely used in studies of population genetics, molecular ecology, evolutionary genetics, and genetic mapping. Although recent advances in genomics have made available other methods of population-scale genotyping (Thomas and Klaper 2004; Stinchcombe and Hoekstra 2008; Ekblom and Galindo 2011), microsatellite markers remain a cost-effective and useful tool. Microsatellite markers are developed for specific species, but it is common for such markers to be used across species boundaries in closely related taxa (e.g., Donnelly et al. 1999; Athrey et al. 2007). However, such use is often complicated by the occurrence of null alleles due to failed amplification as a result of a polymorphism in the annealing site of one or both primers (Callen et al. 1993; Paetkau and Strobeck 1995; Pompanon et al. 2005).

Data sets containing null alleles will be deficient in heterozygotes, and such errors can result in incorrect parentage assignment or exclusion (Dakin and Avise 2004) and biases in population genetic data. Null alleles have been shown to lead to an underestimation of intrapopulation variance and overestimation of interpopulation genetic differentiation (FST) and genetic distance (Chapuis and Estoup 2007). These problems can be ameliorated through careful selection and screening of microsatellite loci, identification, and quantification of genotyping errors (Pompanon et al. 2005; Guichoux et al. 2011), screening for the presence of null alleles in the data set, and the subsequent correction of allele frequencies (van Oosterhout et al. 2004).

Despite the availability of methods to detect and correct for null alleles (Chakraborty et al. 1992; Brookfield 1996), Dakin and Avise (2004) found that of 233 reviewed articles, 90% of the studies that identified null alleles merely reported their presence and failed to take corrective action. This is in part due to the inability to use null-corrected allele frequencies in a variety of analyses that are based on individual multilocus genotypic data; for example, the popular Bayesian assignment tests implemented in the programs STRUCTURE 2.1 (Pritchard et al. 2000; Falush et al. 2003) and BAPS 5.4 (Corander et al. 2006, 2008) and the inference of parentage and kinship (Queller et al. 1993).

Some authors have made an effort to develop microsatellite markers for use in multiple species. For example, Dawson et al. (2010) identified microsatellites conserved across passerine birds by characterizing expressed sequence tag loci with sequence homology between the zebra finch and chicken genomes. The most common strategy, however, is to simply screen a number of nonspecific markers in a target species and to discard those loci that do not consistently amplify, are monomorphic, or deviate from Hardy–Weinberg equilibrium (HWE) (Chambers et al. 2004; Kim et al. 2004; Wilson et al. 2004; Miles et al. 2009).

If microsatellite loci are used across species boundaries, the presence of null alleles is increasingly likely as genetic distances increase (Jarne and Lagoda 1996; Dakin and Avise 2004). Barbará et al. (2007) found that the cross-species utility of microsatellite loci, including the level of polymorphism, was inversely correlated with taxonomic distance in a large number of animals, fungi, and plants. Not surprisingly, Hendrix et al. (2010) showed microsatellite cross-species amplification success was negatively correlated (r = −0.84) with increasing mitochondrial DNA (mtDNA) sequence divergence between species within the family Salamandridae. These authors also reported the amplification of a large number of loci over considerable genetic distances. Of 20 tested loci, 12 or 13 amplified in species with mtDNA divergence of 14–16%. However, these authors only tested a few individuals per species to see if the loci amplified and did not test for the presence of null alleles in population samples.

Despite the well-known null allele problem associated with using microsatellite markers across species boundaries (Panova et al. 2008), this practice is common in studies of a wide variety of organisms, including malaria vectors within the Anopheles gambiae complex. This complex is comprised of 7 morphologically indistinguishable species (Coluzzi et al. 1979; Favia et al. 1997; Hunt et al. 1998; Coetzee 2004), 2 of which are major malaria vectors and are intensively studied. Insight into the population genetics of these species can inform the potential introduction of transgenes into populations (e.g., Tabachnick 2003; Tripet et al. 2005), help to monitor and predict the spread of insecticide resistance alleles (e.g., Chandre et al. 1999; Weill et al. 2000; Reimer et al. 2005), and gauge the efficacy of malaria control campaigns (e.g., Pinto et al. 2002). Such studies were facilitated by the development of 131 microsatellite markers for An. gambiae by Zheng et al. (1996). These loci have since been used in the closely related malaria vector A. arabiensis for mapping studies (e.g., Slotman et al. 2004), studies investigating the population structure (e.g., Donnelly et al. 1999; Kamau et al. 1999; Onyabe and Conn 2001; Kent et al. 2007) and effective population size estimates (e.g., Simard et al. 2000; Wondji et al. 2005). Kent et al. (2007) evaluated 20 of the An. gambiae loci for use in A. arabiensis and found that only 12 amplified well. Furthermore, 2 of the 12 loci that amplified had failed to produce a PCR product in a previous study (Donnelly et al. 1999), demonstrating that cross-amplification success, and by extension, null alleles, can be population specific.

Based on a documented history of introgression between An. gambiae and A. arabiensis (Besansky et al. 2003; Slotman et al. 2007) as well as evidence from several immune genes (Parmakelis et al. 2008; Parmakelis et al. 2010), the genetic distance between An. gambiae and A. arabiensis appears to be less than between An. gambiae and An. melas, another member of the An. gambiae complex (Besansky et al. 2003). Anopheles melas is a brackish water breeding malaria vector confined to the west coast of Africa (Sinka et al. 2010), where it is an important malaria vector locally (e.g., Bryan 1983; Bryan et al. 1987). On Bioko Island, Equatorial Guinea, An. melas is an important and dominant malaria vector locally (Sharp et al. 2007; Slotman MA, unpublished data). Bioko Island has been subject to intensive vector control under the Bioko Island Malaria Control Project (BIMCP) since 2004 (Sharp et al. 2007; Kleinschmidt et al. 2009). Knowledge of the population genetic structure of An. melas and estimates of migration rates between Bioko and mainland Africa will better inform current control measures.

In a microsatellite study on 5 of the species of the An. gambiae complex, Wang-Sattler et al. (2007) used 42 An. gambiae–specific loci in an An. melas population from Senegal. The authors found that 4 of the loci did not amplify and that 5 loci were monomorphic in their An. melas sample. Unfortunately, this study did not examine the data for the presence of null alleles, so it is not known if the remaining 33 loci are useful for population genetic studies for this species. As part of the operational research component of the BIMCP, we have adapted An. gambiae microsatellite loci (Zheng et al. 1996) for use in An. melas by resequencing and evaluating 45 loci and examining a subset of these in natural populations of An. melas from a wide geographic region. This yielded 15 polymorphic microsatellite markers for use in this species. We also amplified 5 of these loci in 4 populations using the original An. gambiae primers and compared the 2 data sets. We discuss the implications for cross-amplification of microsatellite loci across species boundaries.

Materials and Methods

Mosquito Collections

Adult female of An. melas were collected from 4 countries along the West African coast. Mosquitoes from Equatorial Guinea (E.G.) were collected using CDC light traps and human landing catches from Cacahual (CAC) (lat 3°46′N, long 8°42′E) and Bomé (BOM) (lat 1°53′N, long 9°47′E) in October 2008 and Luba (LUB) (lat 3°27′N, long 8°33′E) in April 2009. Cacahual and Luba are located on Bioko Island, whereas Bomé is on the Equatorial Guinea mainland. Mosquitoes were collected from Ipono, Cameroon (CAM) (lat 2°22′N, long 9°49′E), using human landing catches in December 2005. Resting female mosquitoes were collected using aspirators inside residences in Ballingho, The Gambia (GAM) (lat 13°30′N, long 15°36′W) in February 2010 and Ponta Abanaca, Guinea Bissau (GUI) (lat 11°18′N, long 16°14′W) in December 2009.

Molecular Methods

Mosquito DNA was extracted from partial or whole mosquitoes using a Qiagen Biosprint 96 DNA extraction kit (Qiagen Inc., Valencia, CA). Species diagnostics were performed following Scott et al. (1993). A total of 45 An. gambiae microsatellite markers (Zheng et al. 1996) were selected based on chromosomal location, distance from each other, and location relative to chromosomal inversions on right arms of the second (2Rm1, 2Rn, and 2Rn1) and third (3Re and 3Rc) chromosomes (Bryan et al. 1987). Markers inside polymorphic inversions known to be present in An. melas were excluded from this study, as these can create a false impression of population subdivision. Sequences containing the published microsatellite loci were downloaded from the An. gambiae genome (Holt et al. 2002) using VectorBase (Lawson et al. 2009). Primer3 0.4.0 (Rozen and Skaletsky 2000) was used to design primers located outside the original An. gambiae primer annealing sites. These primers were used to amplify 1–3 An. melas individuals from Ipono, Cameroon. Reactions contained 10–20 ng DNA template, with 1× PCR buffer (10 mM Tris–HCl pH 8.5, 50 mM KCl), 2.5 mM MgCl2. Two hundred micromolars of each dNTP, 2.0 μM of each forward (F) and reverse (R) primer, 0.03 U of Promega GoTaq DNA Polymerase (Promega Co., Madison, WI), and ddH2O to the final 20 μl reaction volume. PCRs were performed with an initial denaturing time of 2 min at 94 °C followed by 5 cycles of 30 s at 94 °C, 30 s at 50 °C, 35 s at 72 °C, 30 cycles of 30 s at 94 °C, 30 s at 52 °C, 35 s at 72 °C, followed by a 15 min extension step at 72 °C.

PCR products were ligated in a pGEM-T vector (Promega Co.) and transformed into Escherichia coli competent cells. Colonies were grown in LB media overnight, and DNA was extracted using a Qiagen QIAprep Spin Miniprep Kit (Qiagen Inc.). Plasmid DNA was used as template in 10 μl sequencing reactions, which were performed in forward and reverse directions using BigDye Terminator 3.1 Cycle Sequencing Kit (Life Technologies Corporation, Carlsbad, CA), with a final primer concentration of 250 nM. Sequences have been submitted to GenBank under accession numbers JQ341414–JQ341458.

The An. melas sequences were used to design An. melas–specific primers using Primer3 0.4.0 (Rozen and Skaletsky 2000). As part of an initial screen, An. melas–specific primers were used to amplify 24 loci in 35 individuals from Cacahual and 43 individuals from Bomé, located on Bioko Island and the Equatorial Guinea mainland, respectively. PCR conditions were as above, except that a fluorescently labeled forward primer was used so PCR products could be analyzed on a 96-cappillary Applied Biosystems 3730xl DNA Genetic Analyzer (Life Technologies Corporation). To verify levels of polymorphism across a broader geographic scale, a second screen was conducted including 4 additional populations (LUB, CAM, GAM, and GUI).

Five of these 15 microsatellite loci (agxh25, agxh38, ag2h157, ag2h215, and ag3h127) were also amplified in these 4 An. melas populations using the original An. gambiae–specific primers published by Zheng et al. (1996) rather than the An. melas–specific ones. These 5 markers vary in the number of mismatches (1–3 bp) between the An. gambiae primer and the An. melas sequence (Supplementary Table S1). PCRs were performed and analyzed as outlined above.

Data Analysis

Sequence data were aligned using Sequencher 4.9 (GeneCodes, Ann Arbor, MI), and genotypes were assigned using GeneMarker 1.85 (SoftGenetics, LLC, State College, PA). Observed heterozygosity (HO), expected heterozygosity (HE), tests for deviation from HWE, and population pairwise FST values were calculated using Arlequin 3.5.1.2 (Excoffier and Lischer 2010). Locus-specific FST values were calculated using Genepop 4.0.10 (Raymond and Rousset 1995; Rousset 2008). Micro-Checker 2.2.3 was used to examine the data for the presence of null alleles (van Oosterhout et al. 2004), and allele frequencies were corrected for the presence of null alleles using the method of van Oosterhout et al. (2004). Null-corrected allele frequencies were then used to recalculate population pairwise FST values.

Ethical Considerations

Human landing catch protocols in Equatorial Guinea were reviewed and approved by authorities from the National Malaria Control Programme (NMCP) of the Equatoguinean Ministry of Health and Social Welfare. Collections were monitored by the lead entomologist of the NMCP. Malaria screening and treatment was provided under the NMCP. Landing catches in Cameroon were approved by the Ministry of Public Health. A national ethical clearance (No: FWA IRB00001954, dated 05/11/2005) was obtained from the National Ethics Committee (Yaounde, Cameroon) and an institutional ethical approval from OCEAC (No: 0287-05/SG/CAB, dated 03/17/2005) for the collections in Ipono, Cameroon. Volunteers received presumptive malaria treatment throughout the course of the study as recommended by the NMCP.

Results

Anopheles melas– Specific Microsatellite Markers

A total of 45 An. gambiae microsatellite loci were resequenced in 1–3 An. melas individuals. Out of 90 An. gambiae primers, 48 contained a mismatch with the obtained An. melas sequence. The number of mismatches between primer and annealing site ranged from 0 to 5 (Supplementary Table S1), with 21 primers containing more than a single mismatch; 14 primers contained 2 mismatches, 2 primers contained 3 mismatches, 3 primers contained 4 mismatches, and 2 primers contained 5 mismatches. A total of 42 of 90 primers did not contain any mismatches. In 2 loci (agxh100 and agxh678), no microsatellite repeat was present in An. melas. Because the mutation rate of microsatellites is positively correlated with repeat number (Weber 1990), only loci containing more than 5 uninterrupted repeats in the sequenced individuals were selected for adaptation to An. melas. This was done to obtain markers that are likely to contain a suitable amount of variability for a population genetic study. Nine loci were discarded for this reason. Two loci with only 5 continuous repeats were examined in An. melas populations from Bome and/or Cacahual, Equatorial Guinea, but both proved to be monomorphic. Locus agxh810 was discarded because it contained 36 uninterrupted repeats, which would likely have resulted in significant slippage during PCR amplification, making it difficult, if not impossible, to assign alleles to the correct size class. An additional 5 loci were discarded because single- or trinucleotide repeats were present in the flanking regions of the microsatellite repeat. Finally, on comparison of An. melas sequences, it was realized that ag3h312 and ag3h154 (Zheng et al. 1996) are in fact the same locus.

Therefore, 18 of 45 resequenced An. gambiae loci were not considered suitable as genetic markers. If mismatches were present, An. melas–specific primers were designed for the remaining 27 suitable loci. Additionally, several primers were redesigned for these loci because Primer3 predicted more optimal priming sites. Three of these An. melasspecific markers did not amplify in our test populations using standard conditions and were excluded (Supplementary Table S1). The remaining 24 loci were examined in populations from Cacahual and Bomé, and levels of heterozygosity are reported in Supplementary Table S2. Six of the examined loci contained a limited amount of polymorphism (low Ho and/or low Na); and 2 loci deviated significantly from HWE, in one or both of the test populations. Locus ag2h417 was excluded to prevent overrepresentation of chromosome 2R. Therefore, our resequencing effort yielded 15 microsatellite markers for use in An. melas (Table 1).

Table 1

Description of 15 Anopheles melas microsatellite loci

Locus An. melas primer (5′ → 3′) An. melas repeat motif Tm (°C) AS AR (bp) Mean Na Mean HLoc. GenBank No. 
amxh25 F: AAAAGGGAAGCCGAAAACAT (GT)3 + (GT)5 47.7 143 134–148 4.25 0.4688  X: 2C JQ341445 
R: CAGTTATGCCGGCATGCTAC  53.8       
amxh38 F: TCCAGTGACTACGCTTCTCG (GT)26 53.8 236 180–244 11.25 0.7857 3R: 32A JQ341446 
R: TCAGCGCTATCACAGCAAAC  51.8       
am2h46 F: GCGCCCATAGACAAAGAGAG (GT)13 53.8 124 104–136 10 0.7458 2R: 7A JQ341415 
R: GAGGGTGCAGAACATTTACCA  52.4       
am3h93 F: GTTGTCTCGCGCCGTCTA (GT)26 52.6 306 276–332 15 0.7176 3R: 29A JQ341431 
R: TCGTCATCGTACATCAATACCC  53.0       
am3h127 F: CGCCGGTACGTCATTAAACT (GT)10 51.8 129 119–131 5.25 0.6495 3L: 41C JQ341432 
R: CTGGGAGTTCAGGGAATTGA  51.8       
am2h143 F: TCTACGCACAAGGTCGTTTC (CT)6 51.8 296 289–303 7.25 0.6802 2L: 25D JQ341417 
R: CGCACGTCTCTGTTATGCTC  53.8       
am2h157 F: TTAAAGTGTGCACGGGAAATC (TG)12 50.5 173 158–186 7.25 0.6326 2R: 9A JQ341419 
R: AGTTCGCGCAACTAGAAACG  51.8       
am2h215 F: GGAACTGATTGTGGTGATCAAA (GT)10 51.1 125 112–132 7.25 0.7712 2L: 24A JQ341423 
R: ACGGTTTGGTCTGCAAGTGT  51.8       
amxh293 F: ACATCTTTCAGCACCACTGG (GA)7 51.8 145 138–170 7.25 0.6950  X: 4C JQ341453 
R: GGTGCCACATTGTGTTACTGA  52.4       
am3h555 F: GTGGAGCAGCTGACCTCATT (GT)13 53.8 155 140–232 10.75 0.6946 3R: 32C JQ341437 
R: TTGCCGTCTGATATGAATGC  49.7       
am2h603 F: TGCACCGTTGATGCACATGC (GT)6 53.8 111 107–111 2.5 0.1789 2L: 26D JQ341426 
R: GTTGGTTGTGGACGATGTGA  51.8       
am3h753 F: GGCAAAACAGGATGGTCGT (AC)6 + (AC)5 51.1 112 106–114 2.75 0.1952 3L: 44C JQ341440 
R: CAGGCCAATGAGGTATCGAG  53.8       
amxh755 F: CAGCAGCAGCTGAACGATATT (GT)8 52.4 156 149–159 4.5 0.6605  X: 4A JQ341456 
R: AGGCAGCGGGTTAAAAAGAT  49.7       
am2h793 F: TTACGACGGAATGCAATGTT (TG)10 47.7 198 191–249 12.75 0.7119 2R: 8B JQ341428 
R: GTAATCGGCTCGTTTTCTGC  51.8       
amxh808 F: CAGTGTGACCGAAGCTGTTG (GT)15 53.8 177 152–178 7.5 0.7226  X: 3D JQ341457 
R: AAACGGGTGGACACGATAAG  51.8       
Locus An. melas primer (5′ → 3′) An. melas repeat motif Tm (°C) AS AR (bp) Mean Na Mean HLoc. GenBank No. 
amxh25 F: AAAAGGGAAGCCGAAAACAT (GT)3 + (GT)5 47.7 143 134–148 4.25 0.4688  X: 2C JQ341445 
R: CAGTTATGCCGGCATGCTAC  53.8       
amxh38 F: TCCAGTGACTACGCTTCTCG (GT)26 53.8 236 180–244 11.25 0.7857 3R: 32A JQ341446 
R: TCAGCGCTATCACAGCAAAC  51.8       
am2h46 F: GCGCCCATAGACAAAGAGAG (GT)13 53.8 124 104–136 10 0.7458 2R: 7A JQ341415 
R: GAGGGTGCAGAACATTTACCA  52.4       
am3h93 F: GTTGTCTCGCGCCGTCTA (GT)26 52.6 306 276–332 15 0.7176 3R: 29A JQ341431 
R: TCGTCATCGTACATCAATACCC  53.0       
am3h127 F: CGCCGGTACGTCATTAAACT (GT)10 51.8 129 119–131 5.25 0.6495 3L: 41C JQ341432 
R: CTGGGAGTTCAGGGAATTGA  51.8       
am2h143 F: TCTACGCACAAGGTCGTTTC (CT)6 51.8 296 289–303 7.25 0.6802 2L: 25D JQ341417 
R: CGCACGTCTCTGTTATGCTC  53.8       
am2h157 F: TTAAAGTGTGCACGGGAAATC (TG)12 50.5 173 158–186 7.25 0.6326 2R: 9A JQ341419 
R: AGTTCGCGCAACTAGAAACG  51.8       
am2h215 F: GGAACTGATTGTGGTGATCAAA (GT)10 51.1 125 112–132 7.25 0.7712 2L: 24A JQ341423 
R: ACGGTTTGGTCTGCAAGTGT  51.8       
amxh293 F: ACATCTTTCAGCACCACTGG (GA)7 51.8 145 138–170 7.25 0.6950  X: 4C JQ341453 
R: GGTGCCACATTGTGTTACTGA  52.4       
am3h555 F: GTGGAGCAGCTGACCTCATT (GT)13 53.8 155 140–232 10.75 0.6946 3R: 32C JQ341437 
R: TTGCCGTCTGATATGAATGC  49.7       
am2h603 F: TGCACCGTTGATGCACATGC (GT)6 53.8 111 107–111 2.5 0.1789 2L: 26D JQ341426 
R: GTTGGTTGTGGACGATGTGA  51.8       
am3h753 F: GGCAAAACAGGATGGTCGT (AC)6 + (AC)5 51.1 112 106–114 2.75 0.1952 3L: 44C JQ341440 
R: CAGGCCAATGAGGTATCGAG  53.8       
amxh755 F: CAGCAGCAGCTGAACGATATT (GT)8 52.4 156 149–159 4.5 0.6605  X: 4A JQ341456 
R: AGGCAGCGGGTTAAAAAGAT  49.7       
am2h793 F: TTACGACGGAATGCAATGTT (TG)10 47.7 198 191–249 12.75 0.7119 2R: 8B JQ341428 
R: GTAATCGGCTCGTTTTCTGC  51.8       
amxh808 F: CAGTGTGACCGAAGCTGTTG (GT)15 53.8 177 152–178 7.5 0.7226  X: 3D JQ341457 
R: AAACGGGTGGACACGATAAG  51.8       

Loci were renamed to indicate An. melas specificity. We followed the Zheng et al. (1996) naming convention but replaced ag with am. Tm: An. melas–specific primer melting temperature; AS: allele size of original An. melas sequence; AR: allele range in test populations. Mean Na: Mean allelic richness calculated across 4 test populations; Mean Ho: Mean observed heterozygosity calculated across 4 test populations; Loc.: Location on Anopheles gambiae chromosome. GeneBank No.: GenBank accession number.

To better characterize these 15 loci, they were subsequently amplified in an additional 26 samples from Bomé as well as 48 An. melas specimens from each of 4 populations representing a wider geographic region covering as much as 1380 km. Table 1 reports average levels of genetic diversity for each locus. Both allelic diversity and heterozygosity levels were higher in mainland versus Bioko Island populations, with 2 loci (am2h603 and am3h753) being less variable than the other loci (Supplementary Table S2).

Out of 60 HWE tests, 4 indicated an excess of homozygotes: am2h793 in Ipono, am3h93 and am2h157 in Luba, and am2h143 in Ballingho (Supplementary Table S3). After Bonferroni correction, only locus am3h93 in Luba showed a significant excess of homozygotes. Microchecker detected the presence of null alleles in this locus/population combination, but also in locus am2h143 in Luba and am3h753 in Ipono, both of which did not deviate significantly from HWE.

Cross-Amplification Using An. gambiae Markers

To examine if the original An. gambiae microsatellite markers produce a usable data set when applied to An. melas populations, 5 loci were amplified in 48 individuals in each of 4 An. melas populations using the original An. gambiae primers (ag2h#, ag3h#, or agxh#, respectively). These loci were chosen because they included a variable number of mismatches (1–3) between the An. gambiae primers and the corresponding An. melas sequence (Supplementary Table S4). The use of An. melasspecific primers resulted in slightly higher levels of heterozygosity than the An. gambiaeprimers; 65.92% of An. melas–primer individuals and 63.70% of An. gambiae–primer individuals amplified as heterozygotes. Most of this difference is due to differences at a single locus, as 21 individuals that were homozygous in the ag3h127 but not the am3h127 data set. Conversely, 3 individuals were heterozygous in the ag3h127 but not the am3h127 data set. In the agxh38 data set, 4 individuals were homozygous that were heterozygous in the respective An. melasprimer data set. In the other 2 loci, the respective data sets were in complete congruence with respect to heterozygosity levels. Overall, our data indicate that the use of nonspecific primers caused 2.6% (25/960) of individuals to amplify as false homozygotes using An. gambiae primers.

In the An. gambiae–primer data set, 2 of 20 tests showed a significant excess of homozygotes before Bonferroni correction: ag2h157 in Luba and ag3h127 in Guinea Bissau. Only the latter was significant after Bonferroni correction (Supplementary Table S4). Microchecker analyses confirmed the presence of null alleles in ag3h127 in Guinea Bissau but not in ag2h157 in Luba. Given that am2h157 also showed a slightly significant deviation from HWE, factors besides null alleles are likely responsible. Microchecker analyses also detected null alleles in ag3h127 in Ballingho, The Gambia, for which the excess of homozygotes was just below significant (P = 0.0577). Because no excess of homozygotes (or null alleles; Microchecker) were detected for am3h127 in Ballingho (P = 0.633) or Guinea Bissau (P = 0.967), these results indicate that the development of An. melas–specific primers for this locus circumvented the problem of null alleles in these 2 populations.

The An. gambiae loci chosen for cross-amplification in An. melas populations showed a varying number of mismatches (1–3) between the primers and the obtained An. melas sequences (Supplementary Table S4). Not surprisingly, the An. gambiae primers amplifying locus ag2h127, which has a null allele problem in 2 examined populations, had the largest number of mismatches; 2 and 3 in the forward and reverse primer, respectively. Single base pair mismatches in the other primers did not appear to lead to the occurrence of null alleles.

When comparing the FST values derived from the An. gambiae–primer and An. melas–primer data sets (Table 2), the former showed somewhat higher levels of genetic differentiation between CAM versus GUI (0.20 vs. 0.18). FST values calculated from null corrected allele frequencies still showed some disparity between the 2 data sets. The other FST values were very similar between the 2 data sets (Table 2). A comparison of locus-specific FST values for marker am3h127 versus ag3h127 is presented in Table 3 (for other loci, see Supplementary Table S5.1–S5.4). Microchecker analyses detected null alleles only in the population from Guinea Bissau (0.22) and The Gambia (0.11). The presence of these null alleles did have a substantial impact on FST estimates in 3 pairwise comparisons. The presence of null alleles in the Guinea Bissau sample led to an overestimation of FST values for IPO-GUI (FST = 0.190 vs. 0.110) and GUI-LUB (FST = 0.178 vs. 0.150). No differentiation was detected between GUI-GAM using either am3h127 or ag3h127. Additionally, the presence of null alleles in The Gambia population resulted in an overestimation of FST in the IPO-GAM comparison (FST = 0.184 vs. 0.159). As expected, the other 2 pairwise FST estimates were very similar.

Table 2

Anopheles melasprimer and Anopheles gambiaeprimer amplified pairwise FST and null-corrected pairwise FST values

 Ipono, Cameroon Luba, Bioko The Gambia Guinea Bissau 
Ipono, Cameroon — 0.332 (0.332) 0.176 (0.176) 0.202 (0.201) 
Luba, Bioko 0.338 (0.320) — 0.230 (0.230) 0.247 (0.250) 
The Gambia 0.171 (0.171) 0.236 (0.220) — 0.009 (0.005
Guinea Bissau 0.185 (0.185) 0.251 (0.239) 0.010 (0.010) — 
 Ipono, Cameroon Luba, Bioko The Gambia Guinea Bissau 
Ipono, Cameroon — 0.332 (0.332) 0.176 (0.176) 0.202 (0.201) 
Luba, Bioko 0.338 (0.320) — 0.230 (0.230) 0.247 (0.250) 
The Gambia 0.171 (0.171) 0.236 (0.220) — 0.009 (0.005
Guinea Bissau 0.185 (0.185) 0.251 (0.239) 0.010 (0.010) — 

Italicized value is nonsignificant with P value > 0.05. Lower diagonal: An. melas–specific primer FST. Upper diagonal: An. gambiae primer FST. Null-corrected FST values in parentheses.

Table 3

Comparison of FST values for marker am3h127 versus ag3h127

 Ipono, Cameroon Luba, Bioko The Gambia Guinea Bissau 
Ipono, Cameroon — 0.256 0.184 0.190 
Luba, Bioko 0.255 — 0.175 0.178 
The Gambia 0.159 0.170 — 0.000 
Guinea Bissau 0.110 0.150 0.000 — 
 Ipono, Cameroon Luba, Bioko The Gambia Guinea Bissau 
Ipono, Cameroon — 0.256 0.184 0.190 
Luba, Bioko 0.255 — 0.175 0.178 
The Gambia 0.159 0.170 — 0.000 
Guinea Bissau 0.110 0.150 0.000 — 

am3h127 FST values are depicted below the diagonal. ag3h127 FST values are depicted above the diagonal.

Discussion

The usefulness of 45 microsatellite loci developed for the malaria mosquito An. gambiae was evaluated based on a set of criteria designed to determine their potential as polymorphic markers for An. melas. Out of 45 loci, 17 were not considered promising markers for use in An. melas. Of the remaining loci, 6 contained very low polymorphism and 2 deviated significantly from HWE in 1 or both of the 2 An. melas populations from Equatorial Guinea. Additionally, 3 loci failed to amplify consistently. The result is 15 loci with varying levels of polymorphism in populations from a wider geographic area. The availability of these markers will facilitate genetic studies of this locally important vector along the West African coast.

Excluding the duplicate locus and locus ag2h417, 23 of 43 (53.48%) of the An. gambiae loci examined in this study are not readily suitable for use as polymorphic markers in its sibling species An. melas due to either a very low/high repeat number, low variability, or single- or trinucleotide repeats in the flanking sequence. This also does not include the 3 loci that failed to amplify or the 2 loci that are in HW disequilibrium even when using An. melas–specific primers, as additional effort presumably could have led to the development of better working primers. Besides null alleles, deviations from HWE can also be caused by the dropout of large alleles, poor sample quality, and population subdivision. The latter 2 are expected to affect a large number of loci, and we paid particular attention to detecting the very low multiple peaks typical of alleles with a very high number of repeats. Therefore, the fact that 2 loci showed a deviation from HWE even after designing species-specific primers, illustrates that null alleles are a potential problem even within a single species.

Based on 4 protein-coding genes examined by Besansky et al. (2003), the level of DNA divergence between An. gambiae and An. melas ranges from 1.8% to 6.8% (Dxy). Based on 32 protein-coding genes, Obbard et al. (2009) calculated an average divergence of 6.4% (Ks). The high number of microsatellite loci that had to be screened to yield sufficient polymorphic markers for a population genetic study demonstrates the difficulty of using microsatellite loci across species boundaries besides the occurrence of null alleles and the necessity of extensive screening of loci even between closely related species.

Of the loci that were amplified in An. melas populations with An. gambiae–specific primers, 4 of 5 yielded reliable data sets without the presence of null alleles. In all of these cases, the number of mismatches between the An. gambiae primer and the An. melas sequence was small, with single base pair mismatches present in one (agxh25, agxh38, and ag2h157) or in both primers (ag2h215). In locus ag3h127, 2 and 3 mismatches were present in the forward and reverse primers, respectively, and null alleles were detected when this locus was amplified in An. melas populations from The Gambia and Guinea Bissau. The null alleles at this locus resulted in an overestimation of the FST values between some populations. Our limited data are consistent with a report based on a simulation study showing that null alleles lead to an overestimation of FST values (Chapuis and Estoup 2007).

We also found that even between these very closely related species, 21 of a total of 90 primers contained more than a single base pair mismatch (2–5 bp). Although we did not examine the amplification success of all of these primers, we expect that the probability of null alleles occurring will increase with a higher number of mismatches. A single base pair mismatch between primers away from the 3′ region did not cause any null allele problems in our data set. Other studies have examined the amplification success of microsatellite markers in species other than the one they were designed for. Carreras-Carbonell et al. (2008), Hendrix et al. (2010), and Primmer et al. (2005) assessed the cross-species amplification efficiency of microsatellites in fish, true salamanders, and birds, respectively, with an emphasis on the correlation between mtDNA divergence and amplification success. All of these authors concluded, not surprisingly, that amplification success decreased with increased mtDNA genetic divergence. Both Primmer et al. (2005) and Carreras-Carbonell et al. (2008) report that microsatellite polymorphism also decreases with increased genetic distance from the target species, though only Primmer et al. (2005) warn against the potential for null alleles.

In their paper, Chambers et al. (2004) screened 47 human microsatellite markers for use in Hylobates lar, the white-handed gibbon. Of the screened loci, only 8 amplified well and were polymorphic when tested in 49 individuals from 12 social groups. Of the other 39 loci, 23 were excluded because they failed to amplify or amplified poorly, and the remaining 16 were mono- or dimorphic. These data also indicate that although a high proportion of loci may amplify across more distantly related species boundaries, this is not a good measure of their usefulness as many of such loci will not have the qualities that make them suitable genetic markers, such as lack of null alleles, high genetic variability, lack of flanking repeats with different repeat length, or lack of high repeat number.

A number of An. gambiae microsatellite loci (Zheng et al. 1996) have been used successfully in various studies of another sibling species in the complex, A. arabiensis (e.g., Donnelly et al. 1999, Kamau et al. 1999, Simard et al. 2000, Onyabe and Conn 2001, Wondji et al. 2005), even though Kent et al. (2007) found that only 12 of 20 An. gambiae loci amplified well in this species. The level of protein-coding gene divergence between An. gambiae and A. arabiensis is about half of that between An. gambiae and An. melas (Obbard et al. 2009). In addition, a history of introgression is well documented between the 2 former species (della Torre et al. 1997; Besansky et al. 2003; Slotman et al. 2005). This may account for some of the success in using An. gambiae microsatellite loci in A. arabiensis, although numerous An. gambiae markers are available and the number screened before the start of a study is not always reported.

Although a common practice, the main hazard of using microsatellite markers across species boundaries is generally considered the occurrence of null alleles in the data set. Our results highlight another substantial problem; the rapid evolution of these markers renders many of them useless even in closely related species due to the absence of the repeat or low repeat number/low polymorphism. Researchers planning a study reliant on the amplification of markers across species boundaries are well advised to plan for the inclusion of 2–3 times the number of markers needed to produce the desired data set. This is particularly problematic for taxa for which only a limited number of microsatellite markers are available, and researchers should evaluate the need to develop species-specific microsatellite markers for their research subject.

Supplementary Material

Supplementary material can be found at http://www.jhered.oxfordjournals.org/.

Funding

Bioko Island Malaria Control Project (BIMCP) to M.A.S. and Texas Agrilife Research funds; BIMCP funded by a consortium led by Marathon Oil Corporation (Houston, TX) and the Government of Equatorial Guinea.

We are grateful to Dr Chris Schwabe, Dr Luis Segura, and Ed Aldrich from Medical Care Development International; Dr Gloria Nseng and Simon Abaga from the National Malaria Control Program; and Jaime Kuklinski from One World Development Group for operations support in Equatorial Guinea. We are grateful to Dr Gregory Lanzaro for providing An. melas samples from Guinea Bissau and to Drs Frederic Simard, C. Antonio-Nkondjio, and Parfait H. Awono-Ambene for logistical support during collections in Ipono, Cameroon.

References

Athrey
NRG
Leberg
PL
Klerks
PL
Laboratory culturing and selection for increased resistance to cadmium reduce genetic variation in the least killifish, Heterandria Formosa
Environ Toxicol Chem
 , 
2007
, vol. 
26
 (pg. 
1916
-
1921
)
Barbará
T
Palma-Silva
C
Paggi
GM
Bered
F
Fay
MF
Lexer
C
Cross-species transfer of nuclear microsatellite markers: potential and limitations
Mol Ecol
 , 
2007
, vol. 
16
 (pg. 
3759
-
3767
)
Besansky
NJ
Krzywinski
J
Lehmann
T
Simard
F
Kern
M
Mukabayire
O
Fontenille
D
Touré
Y
Sagnon
N’F
Semipermeable species boundaries between Anopheles gambiae and Anopheles arabiensis: evidence from multilocus DNA sequence variation
Proc Natl Acad Sci U S A
 , 
2003
, vol. 
100
 (pg. 
10818
-
10823
)
Brookfield
JFY
A simple new method for estimating null allele frequency from heterozygote deficiency
Mol Ecol
 , 
1996
, vol. 
5
 (pg. 
453
-
455
)
Bryan
JH
Anopheles gambiae and An. melas at Brefet, The Gambia, and their role in malaria transmission
Ann Trop Med Parasitol
 , 
1983
, vol. 
77
 (pg. 
1
-
12
)
Bryan
JH
Petrarca
V
Di Deco
MA
Coluzzi
M
Adult behavior of members of the Anopheles gambiae complex in the Gambia with special reference to An. melas and its chromosomal variants
Parassitologia
 , 
1987
, vol. 
29
 (pg. 
221
-
249
)
Callen
DF
Thompson
AD
Shen
Y
Phillips
HA
Richards
RI
Mulley
JC
Sutherland
GR
Incidence and origin of “null” alleles in the (AC)n microsatellite markers
Am J Hum Genet
 , 
1993
, vol. 
52
 (pg. 
922
-
927
)
Carreras-Carbonell
J
Macpherson
E
Pascual
M
Utility of pairwise mtDNA genetic distances for predicting cross-species amplification and polymorphism success in fishes
Conserv Genet
 , 
2008
, vol. 
9
 (pg. 
181
-
190
)
Chakraborty
R
De Andrade
M
Daiger
SP
Budowle
B
Apparent heterozygote deficiencies observed in DNA typing data and their implications in forensic applications
Ann Hum Genet
 , 
1992
, vol. 
56
 (pg. 
45
-
57
)
Chambers
KE
Reichard
UH
Möller
A
Nowak
K
Vigilant
L
Cross-species amplification of human microsatellite markers using noninvasive samples from white-handed gibbons (Hylobates Iar)
Am J Primatol
 , 
2004
, vol. 
64
 (pg. 
19
-
27
)
Chandre
F
Manguin
S
Brengues
C
Yovo
JD
Darriet
F
Diabate
A
Carnevale
P
Guillet
P
Current distribution of a pyrethroid resistance gene (kdr) in Anopheles gambiae complex from west Africa and further evidence for reproductive isolation of the Mopti form
Parassitologia
 , 
1999
, vol. 
41
 (pg. 
319
-
322
)
Chapuis
MP
Estoup
A
Microsatellite null alleles and estimation of population differentiation
Mol Biol Evol
 , 
2007
, vol. 
24
 (pg. 
621
-
631
)
Coetzee
M
Distribution of the African malaria vectors of the Anopheles gambiae complex
Am J Trop Med Hyg
 , 
2004
, vol. 
70
 (pg. 
103
-
104
)
Coluzzi
M
Sabatini
A
Petrarca
V
Di Deco
MA
Chromosomal differentiation and adaptation to human environments in the Anopheles gambiae complex
Trans R Soc Trop Med Hyg
 , 
1979
, vol. 
73
 (pg. 
483
-
497
)
Corander
J
Marttinen
P
Mäntyniemi
S
Bayesian identification of stock mixtures from molecular marker data
Fish Bull
 , 
2006
, vol. 
104
 (pg. 
550
-
558
)
Corander
J
Marttinen
P
Sirén
J
Tang
J
Enhanced Bayesian modeling in BAPS software for learning genetic structures of populations
BMC Bioinformatics
 , 
2008
, vol. 
9
 pg. 
539
 
Dakin
EE
Avise
JC
Microsatellite null alleles in parentage analysis
Heredity
 , 
2004
, vol. 
93
 (pg. 
504
-
509
)
Dawson
DA
Horsburgh
GJ
Küpper
C
Stewart
IRK
Ball
AD
Durrant
KL
Hansson
B
Bacon
I
Bird
S
Klein
Á
, et al.  . 
New methods to identify conserved microsatellite loci and develop primer sets of high cross-species utility—as demonstrated for birds
Mol Ecol Resour
 , 
2010
, vol. 
10
 (pg. 
475
-
494
)
della Torre
A
Merzagora
L
Powell
JR
Coluzzi
M
Selective introgression of paracentric inversions between two sibling species of the Anopheles gambiae complex
Genetics
 , 
1997
, vol. 
146
 (pg. 
239
-
244
)
Donnelly
MJ
Cuamba
N
Charlwood
JD
Collins
FH
Townson
H
Population structure in the malaria vector, Anopheles arabiensis Patton, in East Africa
Heredity
 , 
1999
, vol. 
83
 (pg. 
408
-
417
)
Ekblom
R
Galindo
J
Applications of next generation sequencing in molecular ecology of non-model organisms
Heredity
 , 
2011
, vol. 
107
 (pg. 
1
-
15
)
Excoffier
L
Lischer
HEL
Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows
Mol Ecol Resour
 , 
2010
, vol. 
10
 (pg. 
564
-
567
)
Falush
D
Stephens
M
Pritchard
JK
Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies
Genetics
 , 
2003
, vol. 
164
 (pg. 
1567
-
1587
)
Favia
G
della Torre
A
Bagayoko
M
Lanfrancotti
A
Sagnon
N
Touré
YT
Coluzzi
M
Molecular identification of sympatric chromosomal forms of Anopheles gambiae and further evidence of their reproductive isolation
Insect Mol Biol
 , 
1997
, vol. 
6
 (pg. 
377
-
383
)
Guichoux
E
Lagache
L
Wagner
S
Chaumeil
P
Léger
P
Lepais
O
Lepoittevin
C
Malausa
T
Revardel
E
Salin
F
, et al.  . 
Current trends in microsatellite genotyping
Mol Ecol Resour
 , 
2011
, vol. 
11
 (pg. 
591
-
611
)
Hendrix
R
Hauswaldt
JS
Veiths
M
Steinfartz
S
Strong correlation between cross-amplification success and genetic distance across all members of ‘True Salamanders’ (Amphibia: Salamandridae) revealed by Salamandra salamandra-specific microsatellite loci
Mol Ecol Resour
 , 
2010
, vol. 
10
 (pg. 
1038
-
1047
)
Holt
RA
Subramanian
GM
Halpern
A
Sutton
GG
Charlab
R
Nusskern
DR
Wincker
P
Clark
AG
Ribeiro
JM
Wides
R
, et al.  . 
The genome sequence of the malaria mosquito Anopheles gambiae
Science
 , 
2002
, vol. 
298
 (pg. 
129
-
149
)
Hunt
RH
Coetzee
M
Fettene
M
The Anopheles gambiae complex: a new species from Ethiopia
Trans R Soc Trop Med Hyg
 , 
1998
, vol. 
92
 (pg. 
231
-
235
)
Jarne
P
Lagoda
PJL
Microsatellites, from molecules to populations and back
Trends Ecol Evol
 , 
1996
, vol. 
11
 (pg. 
424
-
429
)
Kamau
L
Mukabana
WR
Hawley
WA
Lehmann
T
Irungu
LW
Orago
AAS
Collins
FH
Analysis of genetic variability in Anopheles arabiensis and Anopheles gambiae using microsatellite loci
Insect Mol Biol
 , 
1999
, vol. 
8
 (pg. 
287
-
297
)
Kent
RJ
Mharakurwa
S
Norris
DE
Spatial and temporal genetic structure of Anopheles arabiensis in Southern Zambia over consecutive wet and drought years
Am J Trop Med Hyg
 , 
2007
, vol. 
77
 (pg. 
316
-
323
)
Kim
KS
Min
MS
An
JH
Lee
H
Cross-species amplification of Bovidae microsatellites and low diversity of the endangered Korean goral
J Hered
 , 
2004
, vol. 
95
 (pg. 
521
-
525
)
Kleinschmidt
I
Schwabe
C
Benavente
L
Torrez
M
Ridl
FC
Segura
JL
Ehmer
P
Nchama
GN
Marked increase in child survival after four years of intensive malaria control
Am J Trop Med Hyg
 , 
2009
, vol. 
80
 (pg. 
882
-
888
)
Lawson
D
Arensburger
P
Atkinson
P
Besansky
NJ
Bruggner
RV
Butler
R
Campbell
KS
Christophides
GK
Christley
S
Dialynas
E
, et al.  . 
VectorBase: a data resource for invertebrate vector genomics
Nucleic Acids Res
 , 
2009
, vol. 
37
 (pg. 
D583
-
D587
)
Miles
LG
Lance
SL
Isberg
SR
Moran
C
Glenn
TC
Cross-species amplification of microsatellites in crocodilians: assessment and applications for the future
Conserv Genet
 , 
2009
, vol. 
10
 (pg. 
935
-
954
)
Obbard
DJ
Welch
JJ
Little
TJ
Inferring selection in the Anopheles gambiae species complex: an example from immune-related serine protease inhibitors
Malar J
 , 
2009
, vol. 
8
 pg. 
117
 
Onyabe
DY
Conn
JE
Population genetic structure of the malaria mosquito Anopheles arabiensis across Nigeria suggests range expansion
Mol Ecol
 , 
2001
, vol. 
10
 (pg. 
2577
-
2591
)
Paetkau
D
Strobeck
C
The molecular basis and evolutionary history of a microsatellite null allele in bears
Mol Ecol
 , 
1995
, vol. 
4
 (pg. 
519
-
520
)
Panova
M
Mäkinen
T
Fokin
M
André
C
Johannesson
K
Microsatellite cross-species amplification in the genus Littorina and detection of null alleles in Littorina saxatilis
J Molluscan Stud
 , 
2008
, vol. 
74
 (pg. 
111
-
117
)
Parmakelis
A
Moustaka
M
Poulakakis
N
Louis
C
Slotman
MA
Marshall
JC
Awono-Ambene
PH
Antonio-Nkondjio
F
Simard
F
Caccone
A
, et al.  . 
Anopheles immune genes and amino acid sites evolving under the effect of positive selection
PLoS One
 , 
2010
, vol. 
5
 pg. 
e8885
 
Parmakelis
A
Slotman
MA
Marshall
J
Awono-Ambene
P
Antonio-Nkondjio
C
Simard
F
Caccone
A
Powell
JR
The molecular evolution of four anti-malarial immune genes in the Anopheles gambiae complex
BMC Evol Biol
 , 
2008
, vol. 
8
 pg. 
79
 
Pinto
J
Donnelly
MJ
Sousa
CA
Gill
V
Ferreira
C
Elissa
N
Do Rosário
VE
Charlwood
JD
Genetic structure of Anopheles gambiae (Diptera: Culicidae) in São Tomé and Príncipe (West Africa): implications for malaria control
Mol Ecol
 , 
2002
, vol. 
11
 (pg. 
2183
-
2187
)
Pompanon
F
Bonin
A
Bellemain
E
Taberlet
P
Genotyping errors: causes, consequences and solutions
Nat Rev Genet
 , 
2005
, vol. 
6
 (pg. 
847
-
859
)
Primmer
CR
Painter
JN
Koskinen
MT
Palo
JU
Merilä
J
Factors affecting avian cross-species microsatellite amplification
J Avian Biol
 , 
2005
, vol. 
36
 (pg. 
348
-
360
)
Pritchard
JK
Stephens
M
Donnelly
P
Inference of population structure using multilocus genotype data
Genetics
 , 
2000
, vol. 
155
 (pg. 
945
-
959
)
Queller
DC
Strassmann
JE
Hughes
CR
Microsatellites and kinship
Trends Ecol Evol
 , 
1993
, vol. 
8
 (pg. 
285
-
288
)
Raymond
M
Rousset
F
GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism
J Hered
 , 
1995
, vol. 
86
 (pg. 
248
-
249
)
Reimer
L
Tripet
F
Slotman
MA
Spielman
A
Lanzaro
GC
An unusual distribution of the kdr gene among populations of Anopheles gambiae on the Island of Bioko, Equatorial Guinea
Insect Mol Biol
 , 
2005
, vol. 
14
 (pg. 
683
-
688
)
Rousset
F
Genepop'007: a complete reimplementation of the Genepop software for Windows and Linux
Mol Ecol Resour
 , 
2008
, vol. 
8
 (pg. 
103
-
106
)
Rozen
S
Skaletsky
HJ
Krawetz
S
Misener
S
Primer3 on the WWW for general users and for biologist programmers
Bioinformatics methods and protocols: methods in molecular biology
 , 
2000
Totowa (NJ)
Humana Press
(pg. 
365
-
386
)
Scott
JA
Brogdon
WG
Collins
FH
Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction
Am J Trop Med Hyg
 , 
1993
, vol. 
49
 (pg. 
520
-
529
)
Sharp
BL
Ridl
FC
Govender
D
Kuklinski
J
Kleinschmidt
I
Malaria vector control by indoor residual insecticide spraying on the tropical island of Bioko, Equatorial Guinea
Malar J
 , 
2007
, vol. 
6
 pg. 
52
 
Simard
F
Lehmann
T
Lemasson
JJ
Diatta
M
Fontenille
D
Persistence of Anopheles arabiensis during the severe dry season conditions in Senegal: an indirect approach using microsatellite loci
Insect Mol Biol
 , 
2000
, vol. 
9
 (pg. 
467
-
479
)
Sinka
ME
Bangs
MJ
Manguin
S
Coetzee
M
Mbogo
CM
Hemingway
J
Patil
AP
Temperley
WH
Gething
PW
Kabaria
CW
, et al.  . 
The dominant Anopheles vectors of human malaria in Africa, Europe, and the Middle East: occurrence data, distribution maps, and bionomic précis
Parasit Vectors
 , 
2010
, vol. 
3
 pg. 
117
 
Slotman
MA
della Torre
A
Calzetta
M
Powell
JR
Differential introgression of chromosomal regions between Anopheles gambiae and Anopheles arabiensis
Am J Trop Med Hyg
 , 
2005
, vol. 
73
 (pg. 
326
-
335
)
Slotman
MA
della Torre
A
Powell
JR
The genetics of inviability and male sterility in hybrids between Anopheles gambiae and Anopheles arabiensis
Genetics
 , 
2004
, vol. 
167
 (pg. 
275
-
287
)
Slotman
MA
Parmakelis
A
Marshall
JC
Awono-Ambene
PH
Antonio-Nkondjio
C
Simard
F
Caconne
A
Powell
JR
Patterns of selection in anti-malarial immune genes in malaria vectors: evidence for adaptive evolution in LRIM1 in Anopheles arabiensis
PLoS One
 , 
2007
, vol. 
2
 pg. 
e793
 
Stinchcombe
JR
Hoekstra
HE
Combining population genomics and quantitative genetics: finding the genes underlying ecologically important traits
Heredity
 , 
2008
, vol. 
100
 (pg. 
158
-
179
)
Tabachnick
WJ
Reflections on the Anopheles gambiae genome sequence, transgenic mosquitoes and the prospect for controlling malaria and other vector borne diseases
J Med Entomol
 , 
2003
, vol. 
40
 (pg. 
597
-
606
)
Thomas
MA
Klaper
R
Genomics for the ecological toolbox
Trends Ecol Evol
 , 
2004
, vol. 
19
 (pg. 
439
-
445
)
Tripet
F
Dolo
G
Lanzaro
GC
Multilevel analyses of genetic differentiation in Anopheles gambiae s.s. reveal patterns of gene flow important for malaria-fighting mosquito projects
Genetics
 , 
2005
, vol. 
169
 (pg. 
313
-
324
)
van Oosterhout
C
Hutchinson
WF
Wills
DPM
Shipley
P
Michro-Checker: software for identifying and correcting genotyping error is microsatellite data
Mol Ecol Notes
 , 
2004
, vol. 
4
 (pg. 
535
-
538
)
Wang-Sattler
R
Blandin
S
Ning
Y
Blass
C
Dolo
G
, et al.  . 
Mosaic genome architecture of the Anopheles gambiae species complex
PLoS One
 , 
2007
, vol. 
2
 pg. 
e1249
 
Weber
JL
Informativeness of human (dC-dA)n•(dG-dT)n polymorphisms
Genomics
 , 
1990
, vol. 
7
 (pg. 
524
-
530
)
Weill
M
Chandre
F
Brengues
C
Manguin
S
Akogbeto
M
Pasteur
N
Guillet
P
Raymond
M
The kdr mutation occurs in the Mopti form of Anopheles gambiae s.s. through introgression
Insect Mol Biol
 , 
2000
, vol. 
9
 (pg. 
451
-
455
)
Wilson
ACC
Massonnet
B
Simon
JC
Prunier-Leterme
N
Dolatti
L
Llewellyn
KS
Figueroa
CC
Ramirez
CC
Blackman
RL
Estoup
A
, et al.  . 
Cross-species amplification of microsatellite loci in aphids: assessment and application
Mol Ecol Notes
 , 
2004
, vol. 
4
 (pg. 
104
-
109
)
Wondji
C
Simard
F
Lehmann
T
Fondjo
E
Samè-Ekobo
A
Fontenille
D
Impact of insecticide-treated bed nets implementation on the genetic structure of Anopheles arabiensis in an area of irrigated rice fields in the Sahelian region of Cameroon
Mol Ecol
 , 
2005
, vol. 
14
 (pg. 
3683
-
3693
)
Zheng
L
Benedict
MQ
Cornel
AJ
Collins
FH
Kafatos
FC
An integrated genetic map of the African human malaria vector mosquito, Anopheles gambiae
Genetics
 , 
1996
, vol. 
143
 (pg. 
941
-
952
)

Author notes

Corresponding Editor: Jose Lopez