Deubiquitinase BAP1 is crucial for surface expression of T cell receptor (TCR) complex, T cell-B cell conjugate formation, and T cell activation

Abstract

The adaptive immune response critically hinges on the functionality of T cell receptors, governed by complex molecular mechanisms, including ubiquitination. In this study, we delved into the role of in T cell immunity, focusing on T cell–B cell conjugate formation and T cell activation. Using a CRISPR-Cas9 screening approach targeting deubiquitinases genes in Jurkat T cells, we identified BAP1 as a key positive regulator of T cell-B cell conjugate formation. Subsequent investigations into BAP1 knockout cells revealed impaired T cell activation, evidenced by decreased MAPK and NF-kB signaling pathways and reduced CD69 expression upon T cell receptor stimulation. Flow cytometry and qPCR analyses demonstrated that BAP1 deficiency leads to decreased surface expression of T cell receptor complex components and reduced mRNA levels of the co-stimulatory molecule CD28. Notably, the observed phenotypes associated with BAP1 knockout are specific to T cells and fully dependent on BAP1 catalytic activity. In-depth RNA-seq and mass spectrometry analyses further revealed that BAP1 deficiency induces broad mRNA and protein expression changes. Overall, our findings elucidate the vital role of BAP1 in T cell biology, especially in T cell-B cell conjugate formation and T cell activation, offering new insights and directions for future research in immune regulation.

BAP1, CRISPR-Cas9 screening, T cell activation, T cell receptor (TCR), T cell-B cell conjugates

1. Introduction

T cell immunity stands at the forefront of the adaptive immune response, pivotal in the body's defense against pathogens and disease. Central to this function is the T cell receptor (TCR) complex, a sophisticated assembly of membrane proteins crucial for recognizing antigens and initiating T cell activation.¹ The intricate process of TCR signaling is fundamental to T cell development, differentiation, and effector functions.² This signaling cascade, initiated upon the formation of an immunological synapse during the conjugation of T cells with antigen-presenting cells, underscores the complexity of cellular communication essential for immune response.³ Understanding the molecular mechanisms that regulate TCR signaling and activation is key to deciphering T cell function and its implications in health and disease.

Post-translational modifications are critical in modulating immune signaling pathways⁴ Together with phosphorylation, ubiquitination, a reversible process marked by the attachment of the small protein ubiquitin to substrate proteins, emerges as a central regulatory mechanism⁵ The vast diversity of ubiquitin modifications can dictate the fate of proteins, influencing their stability, localization, interactions, and activity. Ubiquitination is orchestrated by a cascade involving E1 activating enzymes, E2 conjugating enzymes, and E3 ligating enzymes, with the latter group being remarkably diverse, encompassing over 600 members⁶ While the role of E3 ligases in T cell biology is increasingly recognized, an equally important but less explored aspect is the function of deubiquitinases (DUBs), a group of about 100 proteolytic enzymes that remove or edit ubiquitin and ubiquitin chains, thereby reversing their biological effects.⁷

In T cell biology, the regulation of signaling pathways by DUBs is a burgeoning field of interest. These enzymes have been implicated in various aspects of T cell development, differentiation, and function, including the regulation of TCR signaling⁸ However, the specific roles of many DUBs in these processes still need to be discovered. Given their potential as therapeutic targets⁹ understanding the function of DUBs in T cell biology is crucial. This knowledge gap prompted our investigation into the role of human DUBs in T cell immunity, particularly focusing on their involvement in T cell–B cell conjugation as proxies for immune synapse formation.

In this study, we conducted a comprehensive CRISPR-Cas9 knockout screening of human DUB genes in Jurkat T cells, a well-established model to examine T cell interactions with antigen-presenting cells, represented here by Raji B cells. This approach allowed us to dynamically simulate aspects of the immune synapse. Our screening led to the unexpected discovery of BAP1 as a critical regulator in the expression and functionality of the TCR complex and co-receptor CD28. Our findings not only shed light on the specific role of BAP1 in T cell biology but also underscore the broader impact of DUBs in regulating immune responses, potentially opening new avenues for therapeutic interventions in immunological disorders and cancer.

2. Methods

2.1 Cell culture

Jurkat and Raji cell lines, kindly provided by Václav Hořejší (Institute of Molecular Genetics, Prague, Czech Republic), were cultured in RPMI supplemented with 10% FBS and antibiotics (penicillin-streptomycin). Cell line CCRF-CEM-C119 was sourced from ATCC (ATCC CCL-119) and maintained under the same conditions. Cell line HEK 293FT was sourced from Invitrogen (R70007) and cultured in DMEM with 10% FBS and antibiotics.

2.2 Mice

We used 6- to 12-week-old female Ly5.1 and OT-I Rag2^KO/KO mice¹⁰ on the C57BL/6J background. Mice were kept in a pathogen-free facility (Institute of Molecular Genetics of the Czech Academy of Sciences) with a 12-h light/12-h dark cycle and temperature and relative humidity maintained at 22 ± 1 °C and 55 ± 5%, respectively. Mice were fed with standard rodent breeding diet and quenched with filtered water ad libitum.

2.3 sgRNA design for CRISPR-Cas9 library

sgRNAs were designed using the CHOPCHOP web tool¹¹ Priority was given to sequences in the first or second exons, focusing on common exons or predominant isoforms. Selection criteria included GC content (>45%), efficiency score (>0.5), and minimal self-complementarity/mismatch scores. The sgRNAs for the whole CRISPR-Cas9 DUB library are listed in Supplementary Table 1.

2.4 Generation of BAP1 knockout and knockdown cell lines

A two-vector CRISPR-Cas9 system was employed for bulk knockouts in Jurkat cells, using lentiGuide-Puro (Addgene #52963) and lenti-cas9 blast (Addgene #52962).¹² Three sgRNAs per gene were cloned into lentiGuide-Puro following established protocols¹² Lentiviral particles were prepared using packaging plasmids psPAX2 and pMD2.G provided by Didier Trono (Addgene #12260 and #12259). Briefly, HEK 293FT cells (50,000/well in a 12-well plate) were transfected with packaging plasmids psPAX2 (600 ng), pMD2.G (150 ng), three lentiGuide-Puro vectors (150 ng each), and 3.6 µL of linear polyethylenimine (MW 25000, 1 mg/mL) incubated for 15 min in 100 µL Opti-MEM (Gibco). Post-transfection, the media was replaced after 24 h. At 72 h, supernatants were collected and used to transduce Cas9-expressing Jurkat cells (50,000/well in a 24-well plate) via spin infection for 1 h at 800 × g at 32 °C in the presence of 10 µg/mL of Polybrene (Millipore). Cells were selected with puromycin (1 µg/mL) 72 h post-transduction.

For single-cell BAP1 knockouts, oligos (Eurofins) were cloned into pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138)¹³ Jurkat cells were electroporated (Neon™ NxT Electroporation System; 1325V, 10 ms, 3 pulses, 100 µL tip) with 10 µg of DNA. After 72 h, single cells were sorted (BD FACSAria™ III) into 96-well plates. Knockouts were confirmed by Western blot.

Lentiviral BAP1 shRNA knockdowns were performed using shRNAs from Sigma-Aldrich (TRCN0000435090, TRCN0000427717, TRCN0000007374, TRCN0000414307, TRCN0000412560). Knockdown efficiency was verified by Western blot post-transduction and puromycin selection.

2.5 Generation of gene knockouts in primary murine cells

For the targeted knockout of Bap1 and Ptprc, we employed Alt-R™ S.p. Cas9-GFP V3 (Integrated DNA Technologies, Cat No. 10008100) along with three gene-specific crRNAs for each gene (Bap1: TCAAATGGATCGAAGAGCGC, GTGGACAGATAAAGCTCGAA, CGAATGAAGGATTTCACCAA; Ptprc: AAACGCCTAAGCCTAGTTGT, GTCCAGAAGGGCAAATCCAA, ACTCTTACACCATCCACTCT) and a negative control crRNA (Cat No. 1079138) also sourced from Integrated DNA Technologies. The ribonucleoprotein (RNP) complexes were assembled according to the manufacturer's guidelines. Cells (2 to 4 million) harvested from spleens and lymph nodes of Ly5.2 OT-I Rag2^KO/KO mice, were nucleofected in 20 µl of P4 Primary Cell 4D-Nucleofector™ X Kit S electroporation buffer (Lonza, Cat No. V4XP-4024) using the DS 137 program on the 4D-Nucleofector X unit (Lonza, Cat No. AAF-1003X and AAF-1003B). Following nucleofection, the cells were incubated in complete IMDM medium supplemented with 10% FBS (Gibco), 100 U/ml penicillin (BB Pharma), 100 mg/ml streptomycin (Sigma-Aldrich), and 40 mg/ml gentamicin (Sandoz) in a 5% CO₂ incubator at 37 °C for 1 h. After initial recovery, cells were centrifuged and resuspended to a density of 1 million cells/ml in complete IMDM medium containing 5 ng/ml PMA and 0.5 µM ionomycin for 18 to 36 h. Subsequently, the cells were maintained in IMDM medium supplemented with 2 ng/ml recombinant IL-2 (Thermofisher, Cat No. 212-12-20UG) at a concentration of 2 million cells/ml for additional 72 h.

2.6 Generation of BAP1 overexpression and mutant cell lines

Wild-type BAP1 and the C91A mutant were synthesized (GenScript) and cloned into pLenti CMV GFP Puro (gift from Eric Campeau & Paul Kaufman, Addgene #17448).¹⁴ Viruses generated from these plasmids were used to transduce single-cell clones, followed by puromycin selection.

2.7 MTT proliferation assay

For each condition 10,000 cells/well were seeded in triplicate in a 96-well plate in 200 µL media. For every time point, cells were incubated for 1 h at 37 °C with MTT reagent (20 µL of 5 mg/mL stock). Absorbance at 570 nm was measured using an Infinite F Plex plate reader (Tecan) after solubilizing formazan crystals in 200 µL DMSO. Data analysis was performed using GraphPad Prism software.

2.8 Antibodies

Primary antibodies used at indicated dilutions included BAP1 (1:1000, #13271), GAPDH (1:1000, #97166S), Phospho-p38 MAPK (Thr180/Tyr182) (1:1000, #4511), p38 MAPK (1:1000, #8690), Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (1:1000, #4370), p44/42 MAPK (Erk1/2) (1:1000, #4695), Phospho-IκBα (Ser32) (1:1000, #2859), IκBα (1:1000, #9242), β-Actin (1:1000, #3700), Phospho-SLP-76 (Ser376) (E3G9U) (1:1000 #76384), SLP-76 (1:1000 #4958), Phospho-LAT (Tyr220) (1:1000, #3584), Phospho-PLCγ1(Tyr783)(D6M9S) (1:1000, #14008), PLCγ1 (D9H10) (1:1000, #5690) and were sourced from Cell Signaling Technology. LAT (1:1000, #11-360-c025) was from Exbio. Anti-TCRβ (1:500, #sc-5277) was from Santa Cruz Biotechnology, anti-β-Actin (AC-15) from Sigma-Aldrich (#A1978), anti-CD3ɛ (1:1000, #362701) from Biolegend, and anti-CD28 (1:1000, #ab243228) from Abcam. The anti-CD3 IgM (C305) hybridoma supernatant used for TCR stimulation was a gift from Václav Hořejší.

The HRP-conjugated secondary antibodies sourced from Jackson Immuno Research included goat anti-rabbit IgG (1:5000 #111-035-144), goat anti-mouse IgG (1:5000, #115-035-146), and anti-Rabbit IgG (H + L) (1:5000, #111-035-144) or from Rockland Immunochemicals included Mouse TrueBlot® ULTRA anti-mouse Ig (1:1000, #18-8817-33).

Flow cytometry antibodies included CD69-APC (clone FN50, #2154550) and CD3ɛ-PE (clone OKT3, #2186540), CD4 PE/Cy7 (Clone SK3, #2323060) from SONY, TCRα/β-APC (clone IP26, #1A-607-T100) and CD28-pacific blue (clone CD28.2, #PB-577-T100), CD20-Pacific Blue (clone 2H7, # PB-638-T100), CD19-PE (#ED7017), IgM (clone CH2, #1A-320-C100), anti-CD45-APC (clone EM-05, #1A-553-C100) from ExBio, anti-CD45.1-PE (clone A20, #553776, isotype IgG2a, κ) from BD Pharmingen, and anti-CD45.2-APC (clone 104, #109814) from Biolegend.

2.9 Western blotting

Whole-cell lysates were prepared in SDS lysis buffer (20 mM Tris-Cl pH 7.5, 100 mM NaCl, 5 mM EDTA pH 8.0) supplemented with Pierce Universal Nuclease (#8870) and protease phosphatase inhibitors (#A32961, Thermo Fisher Scientific). Lysates were resolved on SDS-PAGE using Bis-Tris gradient gels (4% to 12%) (#M00653 or #M00654, GenScript) and transferred to PVDF membranes. Membranes were blocked with 5% nonfat milk in PBS-T (phosphate buffer saline, 0.05% Tween-20) and incubated overnight at 4 °C with primary antibodies in 1% BSA/PBS-T. After washing with PBS-T, membranes were incubated with HRP-conjugated secondary antibodies, washed, and signal detected using ECL (Thermo Fisher Scientific) on a ChemiDoc MP system (Bio-Rad). Image Lab software v6.0.1 (Bio-Rad) was used for image processing and band intensity quantification. The intensity of bands was quantified using Image Lab software. The intensities were normalized to Actin or GAPDH as loading controls.

2.10 TCR activation for immunoblotting

Cells (2 million) were washed with PBS, resuspended in 500 µL RPMI without FBS, and stimulated with 10 µL anti-TCR IgM hybridoma supernatant in a 37 °C water bath. At designated time points (1, 3, 5, 10 min), cells were lysed, and proteins were denatured and resolved by SDS-PAGE. Western blotting was conducted as described, with primary and secondary antibodies targeting key signaling proteins.

2.11 T cell-B cell conjugate formation assay for screening DUB knockout library

The DUB knockout library in Jurkat T cells (104 DUB genes, 3 sgRNAs per gene) was screened for conjugate formation with the Raji B cell line. Jurkat cells were labeled with CellTracker™ Deep Red Dye (#C3456, Invitrogen) and Raji cells were labeled with CellTracker™ Violet BMQC Dye (#C10094, Invitrogen). First, Jurkat T cells were activated with CytoStim™ reagent (#130-092-172, Miltenyi Biotec) for 30 min and then mixed with Raji B cells. After 30 min of incubation, double-positive events (Jurkat:Raji conjugates), serving as proxies for immune synapse formation, were quantified by flow cytometry.

2.12 Conjugation assay with murine T cells

Splenocytes isolated from Ly5.1 mice were loaded or not with OVA peptide (SIINFEKL) at two different concentrations (100 and 1 nM) for 90 min in complete IMDM medium. The splenocytes were mixed with OT-I T cells at 2:1 ratio at final concentration of 4,000 cells/µl, and centrifuged (1000 × g, 1 min) at RT. Cells were activated for 20 min at 37 °C and then fixed by adding formaldehyde (2% final, 45 min). Cells were spun down (1,000 × g, 2 min), resuspended in PBS/FBS 0.5% (w/v) EDTA 2 mM, stained CD45.1 and CD45.2 for 30 min in dark at RT, and analyzed by flow cytometry. The conjugates were visualized using Aurora flow cytometer (Cytek). Each experiment was carried out in duplicates, which were averaged to obtain the final numerical result.

2.13 Surface flow cytometry

To assess the abundance of surface receptors, cells were stained with fluorescently labeled antibodies for 30 min at 4°C in the dark. For TCR stimulation, cells were treated with anti-CD3 IgM for 5 h before labeling with a CD69 antibody. After washing with PBS containing 0.5% BSA and 0.1% Sodium Azide, analyses were performed using flow cytometry, with data processing and analysis conducted in FlowJo software.

2.14 RNA isolation

Total RNA was extracted from 1 million cells using the RNeasy Mini Kit (#74106, Qiagen) and assessed for quality and quantity using a Qubit 2.0 fluorometer and Agilent 2200 TapeStation. The RNA aliquots were stored at −80 °C.

2.15 Quantitative real-time polymerase chain reaction (qPCR)

Complementary DNA (cDNA) synthesis was performed using RevertAid First Strand cDNA Synthesis Kit (#K1621, Thermo Fisher Scientific) according to the manufacturer's instructions. qPCR was performed using PowerUp SYBR Green Master Mix (#A25918, Applied Biosystems) on StrepOnePlus Real-Time PCR System (Applied Biosystems). Relative mRNA expression was calculated by 2^−ΔΔCt method and normalized to the GAPDH housekeeping gene. Oligonucleotide sequences are as follows:

BAP1	GAGGATGACGTGCAGAACACCA	CTCAGCCAAGACGTTGATGGTG
CD3E	TCCCAACCCAGACTATGAGC	CAAGACTAGCCCAGGAAACAG
CD28	GAGAAGAGCAATGGAACCATTATC	TAGCAAGCCAGGACTCCACCAA
GAPDH	TGCACCACCAACTGC	GGCATCGACTGTGGT

2.16 RNA-seq and transcriptome data analysis

Total RNA (1 µg) was independently isolated three times (n = 3) from each cell line and subjected to RNA-seq at Macrogen Europe. TruSeq stranded mRNA libraries were generated and sequenced on the NovaSeq 6000 Illumina platform.

The RNA sequencing data was processed with an in-house pipeline built with Snakemake¹⁵ workflow manager. The raw fastq files were trimmed for adapter and low-quality reads using TrimGalore v0.6.6, a wrapper of the Cutadapt program¹⁶ and rRNA reads were filtered out using SortMeRNA v4.2.0.¹⁷ An additional check for quality of the sequences was performed using STAR aligner v2.7.7a¹⁸ and Qualimap v2.2.2-dev.¹⁹ Reads passing the quality check were further subjected to transcript quantification using Salmon v1.4.0²⁰ Differential gene expression analyses were performed with DESeq2 v1.30.0.²¹

Significant genes were selected based on the following criteria: with Benjamini-Hochberg adjusted P-value < 0.05 and absolute value of Log2 Fold change > 1 and the data was visualized using the R and Inkscape tool for vector graphics.

2.17 Membrane fraction isolation and MS proteomic analysis

Membrane proteins from 5 million cells were enriched in quadruplicate (n = 4) for each cell line using the ProteoExtract Native Membrane Protein Extraction Kit (#444810, Sigma-Aldrich) according to enclosed instructions. MS analysis was performed at the Proteomics Core Facility, Masaryk University CEITEC—MU, Brno Czech Republic. Protein solutions were subjected to filter-aided sample preparation as described elsewhere²² Resulting peptides were analyzed by liquid chromatography–tandem mass spectrometry (LC–MS/MS) performed using UltiMate 3000 RSLCnano system, coupled with Orbitrap Exploris 480 spectrometer (Thermo Fisher Scientific). MS data analysis was conducted using MaxQuant software (version 2.0.3.0), with MS/MS ion searches against the cRAP and UniProtKB H. sapiens databases. Data processing included variable modifications (oxidation, deamidation, acetylation), fixed modification (carbamidomethylation), and trypsin/P enzyme specificity. Only proteins with FDR <0.01 and at least one unique or razor peptide were included. Post-analysis processing, including normalization and differential expression, was performed using the OmicsWorkflows software container environment.

2.18 Statistical analysis

As indicated in the figure legends, all experiments were performed at least three times (n = 3), except for the initial CRISPR library screening (Fig. 1A), which was performed two times (n = 2). Statistical analyses were performed using two-tailed paired t-tests or ANOVA in GraphPad Prism v9.5. Data are presented as mean ± SD. Significance levels are indicated in figure legends. Histograms in Fig. 3 were generated using FlowJo V10.

Fig. 1.

Investigating the role of DUBs in T cell-B cell conjugate formation. A) Experimental Design and Construction of the DUB Knockout (KO) Library for Screening in T Cell-B Cell Conjugate Formation Assay: (1) CRISPR Library Design and sgRNA Selection: Using the CHOPCHOP tool (https://chopchop.cbu.uib.no), three sgRNAs were selected for each DUB gene based on criteria of high cleavage efficiency, minimal off-target activity, and low mismatch scores. (2) Cloning and Jurkat Cell Transduction: The selected sgRNAs were cloned into a lentiviral vector containing a puromycin resistance gene. Cas9-expressing Jurkat T cells, previously developed via lentiviral transduction and blasticidin selection, were infected with lentivirus pools carrying the sgRNAs. Stable KO cells were established using puromycin selection. (3) Development of the T Cell-B Cell Conjugate Formation Assay: Knockout Jurkat T cells were labeled with CellTracker™ Deep Red Dye, and Raji B cells (antigen-presenting cells) were labeled with CellTracker™ Violet Dye. Jurkat cells were pulsed with CytoStim™ reagent for 30 min and the cell conjugate formation due to crosslinking of TCRs with MHCII by CytoStim, simulating aspects of the immune synapse formation, was triggered by mixing the pulsed Jurkat cells with Raji cells. (4) Flow Cytometry Analysis: After 30 min, the mixture of labeled Jurkat and Raji cells was analyzed via flow cytometry. The frequency of double-positive cell events, serving as proxies for immune synapse formation, was quantified and compared to a control group of Cas9-expressing cells. B) Screening Results for DUBs in Jurkat:Raji Conjugate Formation: The graph represents the fold change in the number of Jurkat:Raji cell conjugates (double-positive events) normalized to control cells for each DUB knockout. A notable reduction, approximately 40%, in conjugate formation was observed in BAP1 KO cells. The data shown is the mean of two biological replicates (n = 2). Note: Fig. 1A was created using BioRender.com.

3. Results

3.1 Development of arrayed DUBs-focused CRISPR-Cas9 knockout library

In our exploration of deubiquitinases (DUBs) in T cell–B cell conjugate formation, serving as a proxy for immunological synapse formation, we adopted a thorough CRISPR-Cas9 screening strategy. We constructed a focused arrayed library targeting all human DUB genes (totaling 104, Supplementary Table 1), by selecting three high-efficiency, minimal off-target single-guide RNAs (sgRNAs) for each DUB gene using the CHOPCHOP tool.^23,24 These sgRNAs were cloned into a lentiviral vector for efficient incorporation into Cas9-expressing Jurkat T cells, enabling the creation of stable knockouts essential for our library screening (Fig. 1A).

3.2 Screening of Jurkat DUB knockouts in T cell–B cell conjugate formation identifies BAP1 as a top positive modulator

To assess the impact of all individual DUB knockouts on T cell–B cell conjugate formation, we employed a model assay involving Jurkat T cells and antigen-presenting Raji B cells, each labeled with distinct CellTracker dyes. Cell activation was induced using CytoStim reagent, which acts like a superantigen to non-physiologically crosslink TCRs with MHCII molecules, simulating T cell activation. This setup facilitated the quantitative analysis of Jurkat:Raji conjugate formation through flow cytometry, measuring the frequency of double-positive cell events compared to Cas9-only Jurkat cells as a control (Fig. 1A).

Our analysis identified BAP1 and USP39 as top positive modulators. Specifically, BAP1 knockout led to a marked decrease in Jurkat:Raji conjugate formation compared to the control cells. Additionally, several potential negative regulators were identified, including USP19, STAMBPL1, OTULIN, MINDY4, and USP9Y (Fig. 1B).

Given the profound impact of BAP1 knockout and its known significance in various biological processes^25–27 and ^particularly in T cell development²⁸ we focused our in-depth analysis on BAP1. This decision was driven by the potential for BAP1 to offer critical insights into the mechanisms governing T cell–B cell conjugate dynamics and T cell functionality.

3.3 Validating BAP1's role in T cell–B cell conjugate formation

To validate BAP1's function in T Cell–B cell conjugate formation, we first generated single sgRNAs BAP1 knockouts in Jurkat cells (Fig. 2A). Each sgRNA successfully replicated the decrease in Jurkat:Raji conjugate formation as observed in our initial pooled sgRNA screening (Fig. 2B).

Fig. 2.

Evaluating the impact of BAP1 knockout on T cell-B cell conjugate formation A-B. Validation of BAP1 Knockout Effects Using Individual sgRNAs: A) Generation of Bulk BAP1 Knockouts: Lentiviral particles carrying individual sgRNAs (sgRNA1-3) were used to transduce Jurkat T cells, followed by puromycin selection. The effectiveness of the BAP1 knockout was confirmed via Western blot, using anti-BAP1 antibodies and anti-GAPDH as a loading control. B) Assessment of T Cell-B Cell Conjugate Formation: The ability of each BAP1 knockout clone to form T cell-B cell conjugates was evaluated. The graph represents data aggregated from three independent experiments (n = 3). Statistical significance was determined using one-way ANOVA (**P < 0.01, ***P < 0.001). C and D) Characterization of Single-Cell BAP1 Knockout Clones: C) Generation of Single-Cell Knockout Clones: BAP1 single-cell knockout clones were generated through vector electroporation and GFP-based sorting. These clones were then reconstituted with either wild-type BAP1 (WT) or a catalytic mutant (C91A). Successful knockout and reconstitution were confirmed by Western blot analysis. D) Analysis of T Cell-B Cell Conjugate Formation: The functionality of the reconstituted single-cell clones in forming Jurkat:Raji conjugates was assessed. The graph represents data aggregated from three independent experiments (n = 3). Statistical significance was determined using one-way ANOVA (***P < 0.001; “ns” denotes non-significant differences). E and F) Analysis of BAP1 Knockout in Raji B Cells: E: Generation of BAP1 Knockout Raji Cells: CRISPR-Cas9 with a pooled sgRNA targeting BAP1 was employed to generate knockouts in the Raji B cell line, confirmed through Western blot analysis. F: Quantification of Conjugate Formation: The capability of BAP1 knockout Raji cells to form conjugates with Jurkat T cells was quantified. The graph represents data aggregated from three independent experiments (n = 3). Statistical significance was determined using two-tailed paired Student's t-test (‘ns” denotes non-significant differences). G and H) Validation of Bap1 Knockout Effects in Primary Mouse T Cells. Freshly isolated OT-I T cells were electroporated with CRISPR-Cas9 RNP complexes targeting Bap1 (KO) or non-targeting complexes as a control (WT). The cells were expanded by PMA/ionomycin ex vivo. Three independent biological experiments were performed. G: The efficiency of Bap1 KO was analyzed by immunoblotting. A representative experiment is shown (n = 1). H) Quantification of the percentage of conjugated OT-I T cells in the indicated experimental groups (n = 3). Mean + SEM is shown. The statistical significance was calculated using a one-tailed paired Student's t test.

Additional validation involved creating single-cell-derived BAP1 knockout clones using sgRNAs 1 and 3, marked with GFP for sorting. These clones were reintroduced with either wild-type BAP1 or a catalytic mutant C91A²⁹ (Fig. 2C). Expression of wild-type BAP1, but not the catalytic mutant, restored conjugate formation (Fig. 2D), highlighting the essential role of BAP1's enzymatic activity in this process. Furthermore, BAP1 knockout clones demonstrated a significant reduction in cell proliferation, quantified using the MTT assay (Supplementary Fig. 1A), consistent with previous studies on BAP1's broader biological roles.^30,31

Extending our validation to another T cell line, CCRF-CEM, and employing RNA interference (shRNA knockdown) to reduce BAP1 expression, we observed similar effects. Both Jurkat and CCRF-CEM cells demonstrated a marked decrease in conjugate formation capacity with Raji B cells upon BAP1 knockdown (Supplementary Fig. 1B to F). In contrast, BAP1 knockout in Raji B cells did not significantly impact their capacity to form conjugates with unmodified Jurkat T cells (Fig. 2E and F), indicating a T cell-specific role for BAP1.

To extend our investigation towards a more physiological setting, we assessed the role of BAP1 in antigen-dependent conjugation in primary murine T cells. Utilizing the CRISPR-Cas9 approach, we knocked out Bap1 in monoclonal H2-K^b-SIINFEKL (OVA)-specific OT-I T cells freshly isolated from mice. After expansion using PMA/ionomycin, we observed a decreased percentage of conjugated OT-I T cells with OVA-loaded splenocytes in the Bap1 KO conditions compared to WT controls, despite mixed populations of knock-out, heterozygous, and WT cells (Fig. 2G and H, Supplementary Fig. 1G and H). These findings suggest that BAP1 plays a role in regulating the formation of stable conjugates of primary T-cells with antigen-presenting cells, supporting its essential role observed in human T cell lines.

Taken together, these validation experiments confirm BAP1's essential role in T cell-B cell conjugate formation, emphasizing its T-cell-specific enzymatic-dependent activity. The robustness of these findings, demonstrated across several T cell lines, primary murine T cells, and different gene expression targeting methods, provides a strong foundation for understanding BAP1's broader impact in T cell biology.

3.4 BAP1 knockout inhibits TCR signaling

Upon further investigation of BAP1's role in T cells, we focused on T cell activation in BAP1-deficient Jurkat T cells. Flow cytometry analysis of BAP1 knockout Jurkat cells, established from three individual sgRNAs, showed impaired expression of the early T cell activation marker CD69 following TCR crosslinking (Supplementary Fig. 2A). Reintroduction of wild-type BAP1, but not the catalytic mutant, C91A, restored CD69 expression, as demonstrated in Fig. 3A and Supplementary Fig. 2B. Additionally, Western blot analysis focusing on the MAPK and NF-kB signaling pathways showed decreased activation of critical signaling molecules, including phospho-LAT, phospho-SLP-76, phospho-PLCγ, phospho-p38, phospho-ERK, and phospho-IkB-α, in BAP1 knockout Jurkat T cells (Fig. 3B, Supplementary Fig. 2C). Collectively, these results suggest a pivotal role for BAP1 in modulating early TCR signaling.

Fig. 3.

BAP1 knockout decreases expression of T cell activation marker CD69 and TCR signaling pathways in Jurkat T cells. A) TCR-Induced CD69 Expression in BAP1 KO Jurkat Cells: Parental Jurkat cells, BAP1 knockout (KO1) cells, and BAP1 KO1 cells reconstituted with either wild-type BAP1 (WT) or the BAP1 C91A mutant (C91A) were stimulated with anti-TCR IgM for 5 h. Subsequent flow cytometry quantified the surface expression of CD69. The left panel graph displays the Mean Fluorescence Intensity (MFI) of CD69, collated from three independent experiments (n = 3). Statistical analysis utilized one-way ANOVA (****P < 0.0001). The right panel histogram illustrates CD69 levels from a representative experiment. B) Western Blot Analysis of TCR Signaling Pathways: Whole cell lysates from parental Jurkat cells and BAP1 KO cells (pooled sgRNA1-3), either unstimulated or stimulated with anti-TCR IgM for 1, 3, 5, and 10 min, were subjected to Western blotting. The analysis focused on the expression levels and phosphorylation states of key signaling proteins, including LAT, phospho-LAT, SLP-76, phospho-SLP-76, PLCγ, phospho-PLCγ, p-38, phospho-p38, ERK1/2, phospho-ERK1/2, IKB-α, and phospho-IKB-α, with actin serving as a loading control. The figure shows representative results of one of three independent experiments (n = 3). Quantification of phosphoprotein levels from all three experiments is shown in Supplementary Fig. 2C.

3.5 Selective impact of BAP1 knockout on TCR Complex and co-stimulatory molecule CD28

Our findings thus far have indicated a multifaceted role of BAP1 in T cell activation. Not only does BAP1 modulate the physical interaction between T and B cells in the formation of cell conjugates, but its enzymatic activity is also crucial for early activation signals downstream of TCR in Jurkat T cells. This prompted us to investigate the specific impact of BAP1 knockout on the expression of TCR and co-receptors.

Remarkably, flow cytometry analysis revealed that BAP1 knockout in Jurkat cells and knockdown in CCRF-CEM cells significantly reduced the surface expression of TCR α/β and CD3ɛ, as well as CD28, while CD4 surface levels remained unaffected (Fig. 4A to C, Supplementary Fig. 3A, E to G). Additionally, the surface expression of IgM, CD19, and CD20 in BAP1 knockout Raji B cells was analyzed and found to be largely unaffected (Supplementary Fig. 3B to D), consistent with the previous findings that BAP1 knockout does not alter their capacity to form conjugates with T cell lines (Fig. 2F).

Fig. 4.

Evaluating the effect of BAP1 knockout on TCRα/β, CD3ɛ, and CD28 proteins. A to C) Flow Cytometry Analysis of Surface Expression of TCR Complex Proteins and Co-Stimulatory Receptor CD28: This section presents the surface expression levels of TCR α/β (Panel A), CD3ɛ (Panel B), and CD28 (Panel C) measured by flow cytometry as Mean Fluorescence Intensity (MFI) in various cell groups: parental Jurkat cells, BAP1 Knockout (KO1), and BAP1 KO1 reconstituted with either wild-type BAP1 or the C91A catalytic mutant. Data analysis was performed using GraphPad Prism, with statistical significance assessed via one-way ANOVA. Results represent three independent experiments (n = 3), with significance levels indicated as **P < 0.01, ****P < 0.0001; “ns” denotes non-significant differences. D) Western Blot Analysis of Protein Levels of TCRβ, CD3ɛ, and CD28: The protein expression levels of TCRβ, CD3ɛ, and CD28 were evaluated in parental Jurkat cells and two distinct single-cell BAP1 KO clones (KO1 and KO3). Cell lysates were analyzed by Western blot, with GAPDH used as a loading control. The figure shows representative results of one of four independent experiments (n = 4). Quantification of protein levels from all four experiments is shown in Supplementary Fig. 3H. E and F) Transcript Levels of CD3E and CD28: mRNA expression levels of CD3E (Panel E) and CD28 (Panel F) were quantified in parental Jurkat cells, a single-cell BAP1 KO1 clone, and BAP1 KO1 cells reconstituted with either WT BAP1 or the C91A catalytic mutant. Data is presented as mean ± SD from three independent experiments (n = 3). Statistical analysis and calculations were performed using GraphPad Prism, with one-way ANOVA used for determining statistical significance (**P < 0.01, ****P < 0.0001; “ns” denotes non-significant).

Intriguingly, reintroducing wild-type BAP1, but not its catalytic mutant, restored the surface expression of TCR α/β, CD3ɛ, and CD28. These findings were further substantiated by Western blot analysis and transcriptional analysis using qPCR, which revealed that while total protein and mRNA levels of TCR β and CD3ɛ were not significantly impacted, CD28 levels were notably affected by BAP1 deficiency (Fig. 4D to F; Supplementary Fig. 3H to J).

The differential impact of BAP1 deficiency on individual surface proteins, such as TCR α/β, CD3ɛ, and CD28, underscores the complexity of BAP1's regulatory functions in T cell biology. While the restoration of receptor expression with wild-type BAP1 indicates a specific regulatory mechanism, it also raises questions about the broader implications of BAP1 deficiency at the cellular level. This observation compelled us to extend our investigation beyond receptor-specific effects, leading us to a comprehensive analysis of global gene and protein expression changes in BAP1 knockout Jurkat cells.

3.6 Global changes in gene and protein expression in BAP1 knockout Jurkat cells

Building on our observation of BAP1's specific regulatory effects on key T cell receptors, we expanded our investigation to encompass global gene and protein expression changes in BAP1 knockout Jurkat cells, employing RNA-seq and MS proteomics. This comprehensive analysis aimed to illuminate the extensive influence of BAP1 on the cellular machinery essential for T cell functionality.

Differential gene expression analysis between Jurkat WT and two BAP1 KO clones (Fig. 5A and B; Supplementary Table 2) confirmed mild changes in transcript levels of CD3E and TCR genes and a particularly pronounced downregulation of CD28 mRNA (Supplementary Fig. 4A). Moreover, quantitative proteomics analysis of the membrane-enriched fraction extracted from Jurkat WT and two BAP1 KO cells, corroborated these findings, and extended them by highlighting significant changes in other key membrane proteins crucial for T cell functions (Fig. 5C and D; Supplementary Table 3).

Fig. 5.

Comprehensive analysis of gene and protein expression alterations in BAP1 knockout Jurkat cells. A and B) Differential Gene Expression Profile in BAP1 KO Jurkat Cells. A) Volcano Plot of RNA-seq Data. This plot compares gene expression between wild-type (WT) and BAP1 knockout clone 1 (KO1). TCR genes, CD3E, and CD28 are specifically highlighted. Other significantly deregulated genes (adjusted P-value < 0.05 and absolute log2 fold change > 1) are color-coded as per the legend. The RNA-seq samples were prepared in triplicate (n = 3). B) Heatmap of Top 30 Deregulated Genes. This heatmap displays the differential expression of the 30 most significantly altered genes between WT, BAP1 KO1, and KO3 clones based on RNA-seq data. C and D) Changes in Membrane Protein Profile in BAP1 KO Jurkat Cells. C) Volcano Plot of MS Proteomic Analysis: Focusing on membrane-enriched cell fractions, this plot illustrates protein expression differences between WT and KO1. Proteins CD3ɛ and CD28 are highlighted, with other significantly deregulated proteins (adjusted P-value < 0.05 and absolute log2 fold change > 1) shown in color according to the legend. The proteomics samples were prepared in quadruplicate (n = 4). D) Summary of Downregulated Proteins: This section categorizes the most significantly downregulated proteins in BAP1 KO Jurkat cells, including CD28, which were exclusively detected in WT samples. The proteins are organized based on their cellular functions.

In summary, our comprehensive analysis of gene and protein expression in BAP1 knockout Jurkat cells has revealed substantial alterations in key proteins crucial for T cell functionality. These findings underscore BAP1's integral role as a transcriptional regulator in T cells. Specifically, BAP1's role extends across a wide array of genes and proteins, impacting not only gene expression regulation but also the composition of membrane proteins, which are pivotal for T cell biology.

4. Discussion

DUBs are crucial in shaping T cell biology, influencing various processes from cellular development to activation and differentiation.³² As key elements of the ubiquitin-proteasome system, DUBs regulate the stability and functionality of numerous proteins pivotal in T cell signaling pathways. Their central roles have highlighted DUBs as potential therapeutic targets, particularly in cancer and immune response modulation. This has significant implications for the treatment of autoimmune diseases and enhancing antitumor immunity, placing DUB inhibitors at the forefront of novel therapeutic strategies.^9,33–35

In our study, we thoroughly investigated the role of human DUBs in T cell-B cell conjugate formation. Utilizing CRISPR-Cas9-based knockout screening in Jurkat T cells, we identified BAP1 as a principal positive regulator in the formation of model Jurkat T cell-Raji B cell synapses (i.e. cell conjugates) and in activating TCR signaling pathways. Our model, employing Jurkat T cells and Raji B cells, serves as a simplified system to explore T cell interactions with antigen-presenting cells, providing insights into T cell activation mechanisms analogous to those observed in immune synapse formation. Moreover, the regulatory role of Bap1 in antigen-dependent T cell-B cell conjugation was confirmed using primary mouse (OVA)-specific OT-I T cells, highlighting a broader applicability of our findings across different T cell models and supporting the hypothesis that BAP1 plays a critical role in the stability and formation of these cellular interactions.

Our extensive RNA-seq and MS analyses further revealed that the absence of BAP1 impacts the surface expression of TCR complex proteins as well as the mRNA levels of the co-stimulatory molecule CD28 and leads to a spectrum of changes in other mRNA and protein expressions. Subsequent validation experiments showed that reintroducing wild-type BAP1, but not its catalytic mutant, into BAP1 knockout cells effectively restored the deficits in TCR and CD28 expression, cell conjugate formation, and T cell activation. These results indicate that BAP1 molecular functions extend beyond simple transcriptional control, implicating its role in the post-translational modifications and trafficking of essential T cell receptors.

BAP1 (BRCA1 Associated Protein-1) is widely recognized for its significant roles in various cellular processes, including cell cycle regulation, DNA damage response, and chromatin remodeling.^30,36 Functioning as a DUB, BAP1 modulates the stability and function of its protein substrates by removing their ubiquitin modifications. For instance, within the nucleus, BAP1 forms complexes with host cell factor-1 (HCF-1) for cell cycle regulation³⁷ and interacts with Polycomb group proteins ASXL1 and ASXL2, facilitating the deubiquitination of histone H2A, which is linked to transcriptional activation.³⁸ Beyond its nuclear roles, BAP1 modulates calcium release via the inositol-1,4,5-trisphosphate receptor channel type-3 (IP3R3) in the endoplasmic reticulum, highlighting its multifunctional nature.³⁹ Moreover, BAP1's role as a tumor suppressor has been extensively documented in cancer biology. The loss or mutation of BAP1 is associated with various malignancies, underlining its critical importance in cellular health and disease.⁴⁰

In the immune system, the role of BAP1 is gaining prominence, especially in the development of T and B cells. In mouse T cells, BAP1 is implicated in the progression through the critical DN3 stage of thymic development and is essential for peripheral T cell proliferation.²⁸ Similarly, in mouse B cells, BAP1 is necessary for normal pre-B cell development and influences the production of cytokines and chemokines in human B cell lines.^28,41,42 Our findings contribute to this emerging understanding, particularly highlighting BAP1's influence on the surface presentation of the TCR complex and the expression of other key molecules, such as CD28, which are pivotal for T cell functionality. In the context of thymic development, the DN3 stage represents a crucial checkpoint where developing thymocytes undergo pre-TCR selection.⁴³ Efficient expression and surface presentation of TCR components are vital at this stage, with any impairment potentially leading to developmental blocks.⁴⁴Our observations in human T cell lines, where BAP1 knockout resulted in diminished surface expression of TCR components, suggest a potential connection to these developmental processes. However, further in vivo validation using knockout mouse models is required to establish a direct causal relationship.

Equally intriguing is the differential impact of BAP1 on T cell activation. While mouse BAP1-deficient T cells exhibit a normal response to TCR/CD28 stimulation, characterized by upregulation of activation markers CD69 and CD25 they show defective proliferation,²⁸ and our human T cell line experiments revealed defective T cell-B cell conjugate formation and impaired activation of CD69 and TCR signaling pathways due to aberrant TCR complex expression. This discrepancy may reflect species-specific differences, or the inherent properties of the experimental models used, such as primary cells in vivo vs cancer cell lines in vitro.

Our findings reinforce the well-established role of BAP1 as a transcriptional regulator in the context of T cell biology. The marked downregulation of CD28 mRNA observed in BAP1 knockout cells, along with changes in the expression of genes such as CD2 and SELL (L-selectin), illustrates the profound influence BAP1 has on T cell functionality. These alterations in gene expression could be attributed to BAP1's role in modulating the transcriptional landscape, potentially through differential activation of promoters, including E2F and MYC target genes.^28,41 Furthermore, BAP1's interactions with proteins like HCF-1 and YY1 which are known to affect chromatin state and gene expression, provide additional insight into its regulatory mechanisms .^36,38,45,46

Particularly intriguing in our study is BAP1's unexpected influence on the surface expression of TCR components, suggesting regulatory mechanisms extending beyond mere transcriptional control, possibly involving post-translational modifications or protein trafficking. Given BAP1's role in locations such as the endoplasmic reticulum,^39,47 it's plausible that BAP1 might also directly influence membrane protein dynamics, affecting aspects such as protein stability, interactions, recycling, or exocytosis.⁴⁸ Alternatively, BAP1 may indirectly affect membrane protein expression through the transcriptional regulation of factors responsible for the post-translational modifications of TCR subunits or their exocytosis. Our exploratory studies, including TCR ubiquitination analysis and experiments with endocytosis inhibitors, did not conclusively pinpoint the molecular mechanism but suggest that the functional deficit may reside in the exocytosis pathway rather than in endocytic trafficking or recycling processes.

While our study sheds light on the complex role of BAP1 in modulating the surface landscape of T cells and influencing a spectrum of membrane proteins crucial for T cell signaling and function, we must acknowledge certain limitations. Primarily, our use of human T cell lines in vitro and murine OT-I T cells ex vivo, while providing a controlled environment for studying BAP1's functions, may not fully encompass the complexity of in vivo immune responses. Additionally, the lack of a knockout mouse model in this area of our research constrains our understanding of BAP1's systemic role in immune regulation and thymic development. These limitations underline the necessity for further research, particularly using diverse model systems, to unravel the precise molecular mechanisms of BAP1's action and its broader implications in immune function. In conclusion, our findings illuminate the multifaceted role of BAP1 in T cell biology, from transcriptional regulation to influencing membrane protein dynamics, providing a substantial foundation for future therapeutic exploration and a deeper understanding of immune regulation mechanisms.

Author contributions

Investigation: D.R., L.H., J.K., M.T., A.A.S., V.U., V.N., J.V., and M.D.; Visualization: M.H., J.K., D.R., M.T., A.A.S., V.U., V.N., O.S, and D.Z.; Formal analysis: T.J., Z.CH., O.S., and R.H.; Writing—original draft: M.H., D.R., and D.Z.; Writing—review & editing: all authors; Funding acquisition: M.H., Z.CH., D.Z., T.J., O.S., and R.H; Supervision: M.H, D.Z., O.S., T.J., and R.H. All authors read and approved the final manuscript.

Supplementary material

Supplementary material is available at Journal of Leukocyte Biology online.

Funding

This work was supported by the Czech Science Foundation (GA CR 21-21413S) awarded to M.H. and (GA CR 22-18046S) awarded to O.S. This work was supported by the Ministry of Health of the Czech Republic—Conceptual Development of Research Organization (FNOs/2022) and (FNOs/2023). V.N. was supported by the Charles University Grant Agency (404222). Supported by the Ministry of Education, Youth, and Sports of the Czech Republic OP JAK SALVAGE, reg. č. CZ.02.01.01/00/22_008/0004644. This article has been produced with the financial support of the Ministry of the Environment of the Czech Republic and the European Union under the LERCO project number CZ.10.03.01/00/22_003/0000003 via the Operational Programme Just Transition. This publication was written at Faculty of Science, University of Ostrava as part of the project number SGS04/PřF/2023 with the support of the Specific University Research Grant in the year 2023, as provided by the Ministry of Education, Youth and Sports of the Czech Republic. M.T. and D.R. were supported by Interní grantová soutěž pro studenty doktorského studia na Ostravské univerzitě, reg. č. CZ.02.2.69/0.0/0.0/19_073/0016939 provided by the Ministry of Education, Youth and Sports of the Czech Republic via OP VVV. Support of Science and research in Mo-644 Moravian-Silesian Region 2021 awarded to A.A.S. CIISB, Instruct-CZ Centre of Instruct-ERIC EU consortium, funded by the Ministry of Education, Youth and Sports of the Czech Republic via MEYS CR infrastructure project LM2023042, is gratefully acknowledged for the financial support of the measurements at the CEITEC Proteomics Core Facility. Computational resources were provided by the e-INFRA CZ project (ID:90254), supported by the Ministry of Education, Youth and Sports of the Czech Republic via MEYS CR.

Author notes

Conflict of interest statement. None declared.