Abstract

Aging and metabolism-related disorders are risk factors for Alzheimer disease (AD). Because sirtuins may increase the life span through regulation of cellular metabolism, we compared the concentration of sirtuin 1 (SIRT1) in the brains of AD patients (n = 19) and controls (n = 22) using Western immunoblots and in situ hybridization. We report a significant reduction of SIRT1 (messenger RNA [mRNA], −29%; protein, −45%) in the parietal cortex of AD patients, but not in the cerebellum. Further analyses in a second cohort of 36 subjects confirmed that cortical SIRT1 was decreased in AD but not in individuals with mild cognitive impairment. SIRT1 mRNA and its translated protein correlated negatively with the duration of symptoms (mRNA, r2 = −0.367; protein, r2 = −0.326) and the accumulation of paired helical filament tau (mRNA, r2 = −0.230; protein, r2 = −0.119), but weakly with insoluble amyloid-β 42 (mRNA, r2 = −0.090; protein, r2 = −0.072). A significant relationship between SIRT1 levels and global cognition scores proximate to death was also found (r2 = +0.09, p = 0.049). In contrast, cortical SIRT1 levels remained unchanged in a triple-transgenic animal model of AD. Collectively, our results indicate that loss of SIRT1 is closely associated with the accumulation of amyloid-β and tau in the cerebral cortex of persons with AD.

Introduction

Alzheimer disease (AD) is a prevalent cause of the loss of cerebral functions and is mainly diagnosed postmortem by the accumulation of neurofibrillary tangles and amyloid-β (Aβ) plaques in the brain (1). Despite the identification of genetic and environmental factors, aging remains the main risk factor of AD. The incidence of AD is extremely low before the age of 65 years, and even in the presence of highly penetrant genetic factors, the development of AD is delayed until old age in most cases (2-4). In parallel, peripheral metabolic diseases, such as diabetes, obesity, and insulin resistance have been associated with an increased risk of developing AD (5-8). It is thus highly probable that molecular events linked with aging and metabolic processes are closely involved in AD pathogenesis.

Silent information regulator 2 (Sir2) proteins, or sirtuins (SIRTs), are protein deacetylases found in organisms ranging from bacteria to humans (9-11). Their nicotine adenine dinucleotide-dependent capacity to deacetylate both histone and nonhistone substrates is essential to the regulation of various cellular functions (9,10). In mammals, SIRTs 1 to 7 have been identified as homologs of Sir2. From the 7 sirtuins in mammals, SIRT1 is the most closely related to Sir2 and has been the most studied (9,10,12,13). In addition to histone targets, SIRT1 deacetylates various substrates including p53, forkhead transcription factor, nuclear factor-κB, and liver X receptor (12,13). Most importantly, the capacity of SIRTs to promote longevity has been demonstrated in yeast, Caenorhabditis elegans and Drosophila, and is thought to act similarly in mammals (10,14-18). Calorie restriction is one of the most consistent nongenetic strategies to prolong life span, whereas inducing SIRT activity (3,9,10,13,16) has been shown to reduce Aβ pathology and tau concentration, and improve cognitive performance in animal models of AD (19-22).

Because SIRT1 might regulate aging and metabolic processes involved in the pathogenesis of AD and could, therefore, represent a potential therapeutic target, the connection between SIRTs and AD has received much recent attention (9-11,23). Specifically, SIRT1 has recently been shown to suppress γ-secretase activity in different in vitro models, thereby reducing the production of Aβ (24). Reduction of γ-secretase activity has been replicated in vivo using transgenic mice that overexpress SIRT1, thus providing the first evidence linking calorie restriction, SIRTs, and AD (24). A correlative relationship between SIRT1 and Aβ load was also found in the brains of calorie-restricted nonhuman primates (21).

To investigate the regulation of SIRT1 and its link with the progression of AD, we compared SIRT1 protein and messenger RNA (mRNA) in postmortem brain samples from individuals with the neuropathologic diagnosis of AD with those from controls. SIRT1 was also studied in a second study cohort divided into 3 groups based on detailed antemortem assessment of cognitive function as no cognitive impairment (NCI), mild cognitive impairment (MCI), or AD. The relationships between brain SIRT1 protein and mRNA concentrations and all available neuropathologic, biochemical, and clinical indexes were investigated to identify significant correlations. At the current state of knowledge, such postmortem investigations are critical for determining the role of SIRTs as potential therapeutic targets in AD.

Materials and Methods

Patients and Handling of Brain Tissue

Cohort No. 1: Douglas Hospital Research Center Brain Bank

Tissue from the parietal cortex, hippocampus, and cerebellum from 19 AD patients and 22 controls who died with no other neurological disorders were obtained from the Douglas Hospital Research Center Brain Bank (Montreal, Canada) and have been detailed elsewhere (25). All brain samples included in the present study were from patients from whom informed consent forms had been obtained from either the patient or a family member. Table 1 summarizes relevant information available for the subjects from Cohort No. 1. The diagnosis of AD was based on the neuropathologic examination as having “definite AD” or “probable AD” according to the Consortium to Establish a Registry for AD (CERAD 1-2) diagnostic criteria; controls were rated as “possible AD” or “no AD” (CERAD 3-4) (26).

TABLE 1.

Clinical and Biochemical Data of Cohort No. 1 From the Douglas Hospital Research Center Brain Bank

Cohort No. 2: Religious Orders Study (Rush Alzheimer's Disease Center)

Samples from the parietal cortex from 36 individuals were divided into 3 groups based on clinical diagnoses (12 MCI, 12 AD, and 12 NCI), as described (27). The study volunteers were from the Religious Orders Study, a longitudinal clinicopathologic study of aging and dementia from which an extensive amount of clinical and neuropathologic data are available (28,29). The institutional review board of Rush University Medical Center approved the study. Each participant underwent a uniform structured baseline clinical evaluation as described elsewhere (28-30). Briefly, the evaluation included a medical history, neurological examination, neuropsychological performance testing, review of a brain scan when available, and diagnostic classification by an examining physician. In addition to the Mini-Mental State Examination, the 19 tests used in these analyses included measures of episodic memory, semantic memory, working memory, perceptual speed, and visuospatial ability (31). The composite measure of global cognition combined these 19 separate tests (31). At death, each case was assigned a Braak score based on neurofibrillary tau pathology, a senile plaque score based on modified CERAD criteria, and a diagnosis based on the National Institute on Aging-Reagan criteria by a neuropathologist blinded to all clinical data (30). Density of Aβ and paired helical filament tau (PHFtau) staining area was determined in paraffin-embedded sections from the temporal cortex by immunohistochemistry using MO0872 and AT8 antibodies, respectively, as described (32). Neuritic plaques, diffuse plaques, and neurofibrillary tangles in the temporal cortex were counted after Bielschowsky silver staining, as previously described (33). Cerebellar pH was measured to assess the degree of preservation of the tissue (34,35). Concentrations of Aβ and tau in the temporoparietal cortex were assessed using ELISA and Western immunoblotting, as described (27). Table 2 summarizes relevant data on Cohort No. 2 (27).

TABLE 2.

Clinical and Biochemical Data of Subjects From Cohort No. 2 (Religious Order Study)

Tissue Handling

Tissue blocks were cut into coronal sections (20 μm) on a cryostat (−18°C) from which small punches (∼50 mg) of tissue were extracted. Sections were used for in situ hybridization, whereas tissue extracts were kept for Western immunoblotting, ELISA, and/or gas chromatography (see later).

Animals

The triple transgenic model of AD (3×Tg-AD) was developed to produce age-dependent Aβ and tau pathology in the mouse brain (36). Male and female 3×Tg-AD mice were raised in our animal facilities with the approval of Laval University Animal Ethics Committee in accordance with the standards of the Canadian Council on Animal Care. Animals were perfused at different ages with 1× PBS containing a cocktail of protease inhibitors (SIGMAFAST Protease Inhibitor Tablets, Sigma-Aldrich, Oakbridge, Ontario, Canada) and phosphatase inhibitors (1 mmol/L each of sodium vanadate and sodium pyrophosphate, 50 mmol/L sodium fluoride). Brain regions were dissected from 1 hemisphere as previously described (37).

Sample Preparation

Tissue extracts were homogenized in 5 volumes of Tris buffered saline (TBS) containing a cocktail of protease inhibitors and phosphatase inhibitors as described (25). Samples were sonicated briefly (3 × 10 seconds) and centrifuged at 100,000 × g for 20 minutes at 4°C to generate a TBS-soluble fraction containing intracellular and extracellular proteins (TBS-soluble fraction). The TBS-insoluble pellet was sonicated in 5 volumes of lysis buffer (150 mmol/L NaCl, 10 mmol/L NaH2PO4, 1% Triton X-100, 0.5% sodium dodecyl sulfate, and 0.5% deoxycholate) containing the same protease and phosphatase inhibitor cocktail. The resulting homogenate was centrifuged at 100,000 × g for 20 minutes at 4°C to produce a lysis buffer-soluble fraction (detergent-soluble fraction). The pellets were homogenized in 5 volumes of 99% formic acid followed by a short sonication (3 × 10 seconds). The resultant suspension was centrifuged (100,000 × g, 4°C, 20 minutes) to generate a formic acid extract (detergent-insoluble fraction). Fifty microliters of this supernatant were neutralized with a 1:30 dilution of Tris-base 1 mol/L (pH 10) to be used for ELISA. The rest of the supernatant was dried by SpeedVac (Thermo Savant, Waltham, MA), solubilized in Laemmli buffer and processed for Western immunoblotting.

Elisa

Concentrations of Aβ40 and Aβ42 in the brain parietal cortex were measured with the Aβ40/β42 ELISA (HS) kits (The Genetics Company, Schlieren, Switzerland), as described (25, 27).

Western Immunoblotting

The protein concentration in each fraction was determined using bicinchoninic acid assays (Pierce, Rockford, IL). Equal amounts of protein per sample (15 mg of total protein per lane) were added to Laemmli loading buffer, heated to 95°C for 5 minutes before loading, and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Proteins were electroblotted onto polyvinylidene difluoride membranes (Immobilon, Millipore, MA) before blocking in 10% nonfat dry milk and 0.1% gelatin in PBS for 1 hour. Membranes were immunoblotted with appropriate primary and secondary antibodies followed by chemiluminescence reagents (ECL, Amersham/Pharmacia Biotech, Piscataway, NJ, or Supersignal from Pierce). Band intensities were quantified using a KODAK Image Station 4000 Digital Imaging System (Molecular Imaging Software version 4.0.5f7, KODAK, New Haven, CT). The following primary antibodies were used in this study: drebrin (clone M2F6; MBL, Woburn, MA), p21-activated kinase (PAK1/2/3; Cell Signaling Technology, Danvers, MA), ROCK1 (Chemicon, Temecula, CA), SIRT1 (anti-Sir2; Upstate, Chicago, IL), SNAP-25 (clone SMI 81; Covance, Berkeley, CA), synaptophysin (clone SVP-38; Chemicon), total tau (tau-13, Covance), anti-PHFtau (AD2, Bio-Rad, Hercules, CA), and actin (Chemicon).

In Situ Hybridization

In situ hybridization procedures were performed essentially as described (25), at room temperature unless otherwise noted. Oligonucleotide sequences used correspond to bases 461-420 (h461: CGCCGCCTCTTCCTCCTCCTCGCCCTCGTCGTCGTCGTCTTC) and 328-289 (h328: GCCTCTTGCTCCCCGCCTGCCGCCGCCGCCTCTGCCTCCG) of human SIRT1 mRNA (NM_012238) (38). The series of in situ hybridization experiments were performed in parallel; total mRNA level was assessed with a 35-mer T-only probe targeting poly-A tails. Oligonucleotides were labeled with 33P-dATP (PerkinElmer, Wellesley, MA) using a 3-terminal deoxynucleotidyltransferase enzyme kit (GE Healthcare, Baie d'Urfé, Quebec, Canada). The reaction was carried out at 37°C for 60 minutes, and labeled oligonucleotides were purified using a QIAquick Nucleotide Removal Kit (Qiagen, Mississauga, Ontario, Canada). The purified probes were kept at −20°C until the assay on the next day.

Tissue sections were dried under vacuum with desiccant at 4°C, were fixed for 5 minutes in 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) in 0.1 mol/L of sodium phosphate buffer (PBS; pH 7.4), and then rinsed twice for 5 minutes each in PBS. The sections were then incubated in a fresh solution of 0.25% acetic anhydride in 0.1 mol/L of triethanolamine (pH 8.0) for 10 minutes. They were then rinsed (2 minutes) twice in 2× standard saline citrate (SSC; 1× SSC is 0.15 mol/L of NaCl, 0.015 mol/L of trisodium citrate, pH 7.0) and dehydrated through a series of ascending concentrations of ethanol (70%, 85%, and 95%, 1 minute each), air-dried, and stored 2 to 3 hours under vacuum with desiccant.

The 2 SIRT1 oligonucleotide probes (h461:h328, ratio 2:1) were diluted (10,000 c.p.m./mL final) in the hybridization buffer containing 50% deionized formamide, 10% dextran sulfate, 1× Denhardt solution, 0.25 mg/mL yeast tRNA, 0.5 mg/mL denatured salmon sperm DNA, and 4× SSC. Hybridization was performed at 37°C for 18 hours in a humid chamber with each slide covered with a glass coverslip. Sections were then washed successively in 2× SSC (90 minutes), 1× SSC (120 minutes), 0.5× SSC (30 minutes, 42°C), 0.5× SSC (30 minutes), 0.5× SSC (30 minutes, 50°C). Finally, the slides were dehydrated in a series of ascending concentrations of ethanol (70%, 85%, and 95%, 1 minute each), air-dried, and exposed to Kodak Biomax MR film for 28 days. Unless specified otherwise, hybridization products were obtained from Sigma-Aldrich (Oakbridge, Ontario, Canada).

Optical densities within subregions were macroscopically quantified on the KODAK IS 4000MM Digital Imaging System. Computed optical density data corresponded to the mean of all pixels inside the delimited areas of the parietal cortex, dentate gyrus/CA1/CA3 regions of the hippocampus, or the cerebellum. The hybridization signal value from a single section was obtained after subtracting the labeling from the white matter quantified in the same section. The final data from each individual was from the mean of 4 to 8 tissue sections. Nonspecific hybridization to tissue sections was found to be negligible, as determined by adding a 100-fold excess of unlabeled probes. To control for total mRNA content, we measured poly-A mRNA expression, and this did not differ between experimental groups (Table 1).

Gas Chromatography

Fatty acid profiles of samples from Cohort No. 1 were generated using gas chromatography and flame ionization detection, using a previously reported methodology (39, 40). Approximately 30 mg of frozen cortical tissue from each sample was used for the present study. Weighed brain tissues were homogenized with BHT-Methanol (Sigma, St Louis, MO) and with 22:3n-3 methyl ester internal standard (NuChek Prep company, Elysian, MN) at a concentration of 500 μg/g of tissue. Extraction of lipids and transmethylation was performed as described (41), and fatty acid methyl esters were quantified on a model 6890 series gas chromatograph (Agilent Technologies, Palo Alto, CA) using a FAST-GC method (39, 40).

Data and Statistical Analyses

Statistical comparisons of data between AD patients and controls were performed using the Student t-test for unpaired values when appropriate. Statistical comparisons of means between more than 2 groups were performed using an analysis of variance (ANOVA) followed by Tukey-Kramer post hoc tests. When homogeneity of variance was not confirmed (p > 0.05 using Bartlett test), Welch ANOVA followed by Dunnett post hoc tests were computed. In addition, variances were reduced using logarithmic transformations to provide more normally distributed measures when needed. Coefficients of correlation and significance of the degree of linear relationship between parameters were determined with a simple regression model, and all statistical analyses were done using JMP Statistical Analysis Software (version 5.0.1).

Results

Comparison Between Subjects

Table 1 shows that AD patients (CERAD 1-2) and controls (CERAD 3-4) from Cohort No. 1 (Douglas Hospital Research Center Brain Bank) were comparable with respect to sex, postmortem delay, cerebellar pH, and total poly-A mRNA content in gray matter from the brain cortex or cerebellum. Controls were significantly younger (−6.4 years; p = 0.0283) than subjects with AD (Table 1). Massive increases in Aβ40, Aβ42, and total tau were measured in fractions containing soluble (i.e. TBS) and insoluble (formic acid extracts) proteins (Table 1). Similarly, PHFtau was increased by 867% in formic acid extracts of parietal cortex homogenates (Table 1). No significant changes in brain fatty acid profiles were detected between the 2 groups of persons (Table 1 and data not shown). Alzheimer disease biochemical data have been presented in detail elsewhere (25).

Table 2 summarizes clinical, neuropathologic, and biochemical data from Cohort No. 2 (Religious Orders Study) as grouped by clinical diagnoses. Individuals with AD showed a significant cognitive deficit as assessed with Mini-Mental State Examination and global cognition measures compared with persons with MCI and NCI (Table 2). Accumulation of tau PHFtau and Aβ42 in the cerebral cortex was more prominent in AD, as demonstrated with immunostaining (Aβ or PHFtau density), Bielschowsky silver impregnation (plaque counts), ELISA (Aβ concentration), and Western immunoblotting (tau levels) (Table 2). Complete information on these patients was previously published (27).

Lower SIRT1 Levels in AD Patients From Cohort No. 1

Representative examples of SIRT1 immunostaining as seen on Western immunoblot of TBS-soluble fractions are shown in Figure 1A. Two bands immunoreactive to SIRT1 were detected at approximately 110 kDa, consistent with reports also showing the presence of a SIRT1 doublet in murine and human cells (15,42). The predicted molecular weight of SIRT1 is 82 kd; posttranslational events such as glycosylation, phosphorylation, or ubiquitination might explain differences in gel migration leading to the detection of 2 SIRT1 bands around 110 kd.

FIGURE 1.

Lower sirtuin 1 (SIRT1) protein concentration in the cerebral cortex of patients with advanced Alzheimer disease (AD). (A) Representative immunoblots from homogenates of the parietal cortex of control subjects and AD patients. (B) Sirtuin 1 concentrations normalized to actin in homogenates from the parietal cortex, the hippocampus and the cerebellum from control subjects (Consortium to Establish a Registry for AD [CERAD] 3-4) and persons diagnosed with AD (CERAD 1-2) based on CERAD neuropathology stages. Values are expressed as SIRT1/actin ratios based on relative optical densities (each point represents an individual and the horizontal bar is the average). **p < 0.01 versus control subjects. C, controls; CRB, cerebellum; Hip, hippocampus; kd, kilodaltons; OD, relative optical density; PCtx, parietal cortex.

FIGURE 1.

Lower sirtuin 1 (SIRT1) protein concentration in the cerebral cortex of patients with advanced Alzheimer disease (AD). (A) Representative immunoblots from homogenates of the parietal cortex of control subjects and AD patients. (B) Sirtuin 1 concentrations normalized to actin in homogenates from the parietal cortex, the hippocampus and the cerebellum from control subjects (Consortium to Establish a Registry for AD [CERAD] 3-4) and persons diagnosed with AD (CERAD 1-2) based on CERAD neuropathology stages. Values are expressed as SIRT1/actin ratios based on relative optical densities (each point represents an individual and the horizontal bar is the average). **p < 0.01 versus control subjects. C, controls; CRB, cerebellum; Hip, hippocampus; kd, kilodaltons; OD, relative optical density; PCtx, parietal cortex.

Western immunoblot analysis of samples from Cohort No. 1 revealed lower SIRT1/actin ratios in the parietal cortex (−45%; p = 0.0087, unpaired Student t-test) of AD patients (CERAD 1 or 2) compared with controls (CERAD 3 or 4; Fig. 1B). No differences were observed in hippocampal or cerebellar samples (Fig. 1B). Because SIRT1 showed no trend for correlation with the age of death (r2 = 0.03, p = 0.332; Table 3), differences in SIRT1/actin ratio cannot be explained by the younger ages of the controls compared with the AD patients.

TABLE 3.

Clinical and Biochemical Correlates of SIRT1 Loss

To determine whether the alteration in SIRT1 was present at the level of transcription, we performed in situ hybridization in the same series of samples. Figure 2A shows representative examples of the in situ hybridization of SIRT1 mRNA on parietal cortex, hippocampal, and cerebellar sections. Addition of unlabeled oligonucleotides (100×) completely abolished the signal from the specific hybridization; the 2 oligonucleotide probes tested led to an identical signal distribution, consistent with their specificity for SIRT1 mRNA (not shown).

SIRT1 mRNA levels in the parietal cortex of individuals diagnosed as definite or probable AD based on CERAD stages were significantly lower than levels in the controls (−29%, p = 0.0055, unpaired Student t-test; Fig. 2B). In contrast to the protein data, there were also differences in SIRT1 mRNA in the CA1 (−34%, p = 0.0128) and CA3 (−49%, p = 0.0053) regions of the hippocampus of AD patients compared with those of the controls, but there were no differences in the dentate gyrus or cerebellar samples (Fig. 2B). The age at death was not associated with SIRT1 mRNA level in the parietal cortex (r2 = 0.034, p = 0.249; Table 3). Sirtuin 1 mRNA content correlated positively with SIRT1 protein levels in the cerebral cortex (r2 = +0.208, p = 0.0046; Fig. 2C), but not in the cerebellar cortex (r2 = 0.05, p = 0.175; not shown).

FIGURE 2.

Lower sirtuin 1 (SIRT1) messenger RNA (mRNA) levels in the brain cortex and hippocampus of patients with advanced Alzheimer disease (AD). (A) Representative autoradiograms of parietal cortex (PCtx), hippocampus (Hip), and cerebellum (CRB) showing hybridization of [33P]-labeled probes to SIRT1 mRNA in a control (C) and an AD patient (Scale bar = 2 mm). (B) Quantification of SIRT1 mRNA expression in the PCtx, CA1, CA3, and dentate gyrus (DG) region of the Hip and in the CRB. (C) Correlation between SIRT1 mRNA content and SIRT1 protein levels. Values are expressed as percentage (mean ± SEM) of relative optical density (OD) compared with Consortium to Establish a Registry for AD (CERAD) 3 to 4 controls. Diagnoses were based on CERAD criteria (controls, CERAD 3-4; AD patients, CERAD 1-2). *p < 0.05, **p < 0.01 versus control levels. CA1 and CA3, CA1 and CA3 areas of the hippocampus; n.s., not significant; WM, white matter.

FIGURE 2.

Lower sirtuin 1 (SIRT1) messenger RNA (mRNA) levels in the brain cortex and hippocampus of patients with advanced Alzheimer disease (AD). (A) Representative autoradiograms of parietal cortex (PCtx), hippocampus (Hip), and cerebellum (CRB) showing hybridization of [33P]-labeled probes to SIRT1 mRNA in a control (C) and an AD patient (Scale bar = 2 mm). (B) Quantification of SIRT1 mRNA expression in the PCtx, CA1, CA3, and dentate gyrus (DG) region of the Hip and in the CRB. (C) Correlation between SIRT1 mRNA content and SIRT1 protein levels. Values are expressed as percentage (mean ± SEM) of relative optical density (OD) compared with Consortium to Establish a Registry for AD (CERAD) 3 to 4 controls. Diagnoses were based on CERAD criteria (controls, CERAD 3-4; AD patients, CERAD 1-2). *p < 0.05, **p < 0.01 versus control levels. CA1 and CA3, CA1 and CA3 areas of the hippocampus; n.s., not significant; WM, white matter.

Lower SIRT1 Levels Were Not Observed in MCI Subjects From Cohort No. 2

To determine whether the lower SIRT1 was related to the diagnosis of AD based on either the neuropathology or the clinical evaluation, we performed immunoblotting in a second cohort of participants with extensive antemortem clinical information from the Religious Orders Study. We again found a lower SIRT1 in individuals in whom the diagnosis of AD was supported by CERAD, Braak, and Reagan neuropathologic rating scales (Figs. 3A-C; unpaired Student t-test, unequal variance). Sirtuin 1 levels were, however, only moderately different between groups when the cases were divided according to the clinical diagnosis; these differences were not significant (Fig. 3D; Welch ANOVA, F2,18 (groups) = 2.84; p = 0.085). It is noteworthy that SIRT1 concentrations were very similar between individuals with MCI and noncognitively impaired subjects (Fig. 3D).

FIGURE 3.

Relationship between postmortem cortical sirtuin 1 (SIRT1) concentration, neuropathologic diagnoses, clinical diagnosis, and global cognition score. Severe Alzheimer disease (AD) neuropathology as assessed by (A) Consortium to Establish a Registry for AD (CERAD), (B) Braak, and (C) National Institute on Aging-Reagan criteria was associated with lower SIRT1 protein levels. (D) Cortical SIRT1 content was not significantly different among individuals with no cognitive impairment (NCI), mild cognitive impairment (MCI), or AD, based on the clinical evaluation (Welch analysis of variance). (E) There is a significant relationship between SIRT1 and the antemortem global cognition score. Values are expressed as SIRT1/actin ratios based on relative optical densities (each point represents an individual; horizontal bars indicate averages).

FIGURE 3.

Relationship between postmortem cortical sirtuin 1 (SIRT1) concentration, neuropathologic diagnoses, clinical diagnosis, and global cognition score. Severe Alzheimer disease (AD) neuropathology as assessed by (A) Consortium to Establish a Registry for AD (CERAD), (B) Braak, and (C) National Institute on Aging-Reagan criteria was associated with lower SIRT1 protein levels. (D) Cortical SIRT1 content was not significantly different among individuals with no cognitive impairment (NCI), mild cognitive impairment (MCI), or AD, based on the clinical evaluation (Welch analysis of variance). (E) There is a significant relationship between SIRT1 and the antemortem global cognition score. Values are expressed as SIRT1/actin ratios based on relative optical densities (each point represents an individual; horizontal bars indicate averages).

SIRT1 Correlated With Markers of Disease Severity

As shown in Figure 3E, the levels of SIRT1 in the temporoparietal cortex normalized to actin showed a weak but significant linear relationship with antemortem composite indices of global cognition (r2 = +0.09, p = 0.049). More detailed analyses revealed that SIRT1 also correlated linearly with episodic memory (r2 = + 0.09, p = 0.043) and perceptual speed (r2 = + 0.10, p = 0.037) but not with semantic memory (r2 = 0.04, p = 0.130), working memory (r2 = 0.02, p = 0.204), or visuospatial ability (r2 = 0.02, p = 0.202; data not shown). We next examined the relationship between the levels of SIRT1, markers of AD neuropathology, and clinical or biochemical variables by performing a series of correlative analyses. We found strong significant inverse correlations between SIRT1 and the time between the initial diagnosis and death ("duration of symptoms,” Table 3). A significant positive relationship between SIRT1 and brain weight was also observed (Table 3). On the other hand, no significant association between SIRT1 and the age at death was seen in any group (Table 3).

Interestingly, the levels of SIRT1 were inversely correlated with insoluble AD2-stained hyperphosphorylated paired helical filament tau (Table 3) and total insoluble tau (not shown). Sirtuin 1 loss was also associated with the conversion from normal soluble tau into insoluble tau (insoluble/soluble total tau ratio) (Table 3). Overall, the relationship between SIRT1 and accumulation of Aβ was weaker than with markers of tau pathology. Nevertheless, inverse correlations were detected between SIRT1 mRNA and soluble Aβ40 (not shown), and soluble Aβ42 (Table 3), whereas SIRT1 correlated negatively with insoluble Aβ42 (Table 3), but not with insoluble Aβ40, age, postmortem delay, or brain pH (Table 3 and data not shown). Because Rho-associated coiled-coil protein kinase 1 (ROCK1) is a possible mediator of the effect of SIRT1 on Aβ production (21, 24), we also measured ROCK1 in the parietal cortex of our 2 cohorts using Western immunoblots, but no significant change was observed (not shown).

Because AD is also characterized by a loss of synaptic proteins drebrin, synaptophysin, and PAK (37, 43, 44), we assessed the relationship between SIRT1 and selected synaptic markers. We observed that the SIRT1 decrease correlated with reduction of PAK and SNAP-25, particularly within subjects with a CERAD-based AD diagnosis (Table 4).

TABLE 4.

Correlations Between SIRT1 and SIRT1 mRNA and Synaptic Proteins

SIRT1 Correlated With Docosahexaenoic Acid Concentration

Epidemiological analyses and studies in animal models suggest that a deficiency in omega-3 polyunsaturated fatty acid (n-3 PUFA) intake plays a role in the development of AD (37, 45-48). Because of the role of SIRTs in various metabolic and cellular pathways, it has been recently hypothesized that n-3 PUFA effect is related to regulation of SIRT1 expression (49). Therefore, concentrations of fatty acids in brain tissue were determined using gas chromatography and studied in relation to SIRT1 levels. Our analysis did not reveal a significant difference in the concentrations of the 2 major n-3 PUFA, docosahexaenoic (DHA; 22:6n-3) and eicosapentaenoic acid (EPA; 20:5n-3), between samples from controls and AD patients (not shown). On the other hand, a positive relationship between SIRT1 protein and DHA concentration was significant in AD subjects (r2 = +0.315, p = 0.0190; Table 3). Intriguingly, we detected an inverse relationship between SIRT1 and EPA (r2 = −0.254, p = 0.0394), the main precursor of DHA in the brain from the same patients (Table 3).

SIRT1 Did Not Differ in 3×Tg-AD Mice at 12, 16, and 20 Months of Age

The triple-transgenic mouse model of AD (3×Tg-AD) developed by LaFerla and colleagues displays evidence of both Aβ and tau pathologies in AD-relevant brain regions (36). Antibody-based assessments indicate that both Aβ plaques and tau-loaded neurofibrillary tangles are readily detected in the 3×Tg-AD mice at 12 months of age and continue to accumulate thereafter (36, 50, 51). To determine whether overproduction of pathogenic mutant Aβ and tau directly alters brain SIRT1 concentrations, we performed Western immunoblotting on homogenates from the parietal cortex of 3×Tg-AD mice. Very similar levels of SIRT1 were found in the cortex of 12-, 16-, and 20-month-old 3×Tg-AD mice compared with control nontransgenic littermates (Fig. 4), indicating that this model does not reproduce the SIRT1 loss found in AD brains.

FIGURE 4.

Sirtuin 1 (SIRT1) protein levels are constant in 12-, 16-, and 20 month-old triple transgenic model of AD (3×Tg-AD or Tg) and control nontransgenic littermate (NonTg) mice. Values are expressed as SIRT1/actin ratios based on relative optical densities ([ODs] each point represents a single mouse; horizontal bars indicate averages).

FIGURE 4.

Sirtuin 1 (SIRT1) protein levels are constant in 12-, 16-, and 20 month-old triple transgenic model of AD (3×Tg-AD or Tg) and control nontransgenic littermate (NonTg) mice. Values are expressed as SIRT1/actin ratios based on relative optical densities ([ODs] each point represents a single mouse; horizontal bars indicate averages).

Discussion

To our knowledge, this study provides the first direct evidence for downregulation of SIRT1 in AD. Quantitative assessment of SIRT1 expression established a relationship between SIRT1, AD neuropathology, antemortem cognitive impairment, and disease duration; these correlations suggest that SIRT1 loss is associated with AD progression. Aging is central to AD pathogenesis, and growing evidence suggests that metabolic syndrome is linked to AD. Because SIRT1 activation may act against risk factors of AD by increasing longevity and regulating cellular metabolic processes, it is possible that the loss of SIRT1 we identified contributes to AD pathogenesis.

Among the brain regions investigated, greater losses of SIRT1 protein and mRNA were observed in the cerebral cortex, whereas no change was detected in the cerebellum. In the hippocampus, we found decreased SIRT1 transcripts in the CA1 and CA3 subregions, but not in the dentate gyrus. Interestingly, CA1 and CA3 subregions of the hippocampus are the target site of projecting neurons of the entorhinal cortex, which are among the first to develop neurofibrillary tangles in AD (52-54). In contrast, no such difference was detected by Western immunoblotting probably because the analysis was performed with homogenates from the whole hippocampal structure that precluded subregion analyses. Thus, overall, the reduction in SIRT1 was observed in AD-relevant regions but not in the cerebellum, a region that is relatively spared in AD. This pattern of loss suggests that a SIRT1 deficit occurs in affected brain regions over the course of AD progression.

It is not possible to determine exactly when SIRT1 loss occurs in AD, but our observations suggest that it is a relatively late event. First, we found a convincing relationship between SIRT1 and the duration of disease. This suggests that SIRT1 loss becomes more apparent in patients who have AD for a longer time; an observation inconsistent with an early occurrence. Second, individuals with MCI did not show any trend toward a decrease in SIRT1; statistically significant loss of SIRT1 occurred only in patients with the highest indices of AD neuropathology. That observation suggests that measurement of SIRT1 is unlikely to be of value as a marker in the early stages of AD. Third, no reduction of SIRT1 was detected in the 3×Tg-AD mouse model at ages when significant brain Aβ and tau pathologies are found. Because frank neuron loss is not observed in this transgenic mouse, it can be considered as a model of early AD, which does not progress to a stage at which SIRT1 loss would occur. Indeed, a reduction in SIRT1 expression was recently reported in the brains of senescence-accelerated mice (SAMP8 mice), supporting the contention that 3×Tg-AD mice may not model the aging characteristics necessary to reproduce the diminution of SIRT1 found in advance stages of AD (55). The present data are, therefore, consistent with the view that the decrease of SIRT1 occurs late in the disease, perhaps as a correlate of Aβ and tau pathologies.

Independent of its point of occurrence in the course of AD, a decrease of SIRT1 may have a wide range of consequences at the cellular level. A specific role of SIRT1 in the CNS has not been determined, but it is known to regulate a plethora of cellular cascades related to cell survival and metabolic homeostasis that likely affect brain cells (9-13, 23). Double labeling immunohistochemistry experiments in the mouse cortex using NeuN show that SIRT1 is mainly localized in neurons (24), whereas expression in astrocytes cannot be ruled out (56,57). Transgenic mice that overexpress SIRT1 display improved glucose homeostasis and increased metabolic rates (15), 2 processes expected to be beneficial in AD (6). More specifically, a reduction of SIRT1 desacetylating action in AD brain could limit the capacity of AcetylCoA synthetase to generate AcetylCoA, a key molecule in cellular metabolism (58). Additional evidence from experiments in cultured neurons suggests that decreased SIRT1 activity could accelerate neurodegeneration through upregulation of nicotinamide mononucleotide adenylyl-transferase 1 activity (59) or repression of p25-mediated cell death (60). In a more direct connection with Aβ production, SIRT1 loss might enhance the ROCK1-dependent γ-secretase cleavage of the amyloid precursor protein, thereby promoting the accumulation of Aβ (24). The present immunoblot data do not, however, support a modulation of ROCK1 levels in AD brains. In vitro evidence suggests that altered SIRT1 activity may also increase nuclear factor-κB signaling in microglia, which would exacerbate Aβ42 neurotoxicity (56). The significant correlation between SIRT1 and Aβ levels in the brain as seen in human patients (Table 3) and previously in squirrel monkeys (21) provides additional argument for a link between SIRT1 and Aβ production.

Brain samples in the present study were characterized for Aβ, tau, and synaptic abnormalities, making detailed correlative analyses possible. We found strong inverse relationships between the extent of tau pathology and the loss of SIRT1. This is particularly important because the conversion of normal tau into its detergent-insoluble PHF form usually correlates particularly well with cognitive impairment in AD (27,32,61-64). This association suggests that the conversion from normal tau into insoluble PHF shares common mechanistic pathways with the decrease in SIRT1 in AD, thus linking SIRT1 concentration to the severity of the disease. On the other hand, the relationships between SIRT1 and Aβ levels or between SIRT1 and synaptic markers were relatively weaker (except for p21-activated kinase). The stronger statistical significance between SIRT1 levels and Braak staging criteria, which focuses more on tangles compared with National Institute on Aging-Reagan or CERAD staging, also supports our correlative analyses. Therefore, these observations suggest the existence of a tight and specific link between the accumulation of tau and the regulation of SIRT1.

Mounting evidence suggests that brain fatty acids are involved in AD pathogenesis. The n-3 PUFA have received considerable attention because their concentrations in the brain depend on dietary consumption. Epidemiological, postmortem, and animal studies provide arguments for n-3 PUFA to be considered as modifiable risk factors or as therapeutic targets in AD (37,45-48). It has been speculated that n-3 PUFA could exert their action through regulation of SIRT1 activity (49). Our present data suggest that concentration in SIRT1 is indeed linked to DHA and EPA levels. Surprisingly, SIRT1 protein levels were positively and negatively linked to DHA and EPA, respectively. Brain EPA can be converted into DHA, which can be retroconverted into EPA, leading to an equilibrium where DHA concentrations are usually at least 20 times higher than EPA (65,66). The present observation suggests that SIRT1 is involved in this state of equilibrium between EPA and DHA and apparently linked to the conversion of EPA into DHA. Despite the fact that we observed no correlation between SIRT1 and autopsy delays, we cannot rule out the possibility that postmortem biochemical events may have altered PUFA levels, thereby contributing in part to the relationships reported here.

It has been proposed that SIRT1 plays a critical role in aging processes, metabolism-related disorders, and possibly neurodegenerative diseases. Indeed, profound postmortem losses of SIRT1 were detected in the frontal cortex of patients with Huntington disease (55). Our present analyses have established a strong relationship between SIRT1 decrease, duration of AD symptoms, and the accumulation of tau. Altogether, these data indicate that the loss of SIRT1 accompanies AD neurodegeneration. Whether SIRT1 loss plays a causal role or is a consequence of other neuropathologic events is unknown, but the findings in Huntington disease indicate that SIRT1 loss can occur in the absence of tau pathology. Because a decrease in SIRT1 activity can clearly have deleterious effects on neuron health, therapeutic strategies aiming at increasing SIRTs activity in AD brain warrant further research.

Acknowledgments

The authors thank Dr Frédéric Picard for constructive comments and Caroline Rancourt for technical support. The authors are indebted to all volunteers who participated in the Religious Orders Study and donors who contributed to the Douglas Hospital Research Centre Brain Bank.

References

1.
Goedert
M
Spillantini
MG
.
A century of Alzheimer's disease
.
Science
 
2006
;
314
:
777
81
2.
Ferri
CP
Prince
M
Brayne
C
et al
.
Global prevalence of dementia: A Delphi consensus study
.
Lancet
 
2005
;
366
:
2112
17
3.
Mattson
MP
.
Gene-diet interactions in brain aging and neurodegenerative disorders
.
Ann Intern Med
 
2003
;
139
:
441
44
4.
Walsh
DM
Selkoe
DJ
.
Deciphering the molecular basis of memory failure in Alzheimer's disease
.
Neuron
 
2004
;
44
:
181
93
5.
Irie
F
Fitzpatrick
AL
Lopez
OL
et al
.
Enhanced risk for Alzheimer disease in persons with type 2 diabetes and APOE epsilon4: The Cardiovascular Health Study Cognition Study
.
Arch Neurol
 
2008
;
65
:
89
93
6.
Pasinetti
GM
Zhao
Z
Qin
W
et al
.
Caloric intake and Alzheimer's disease
.
Experimental approaches and therapeutic implications. Interdiscip Top Gerontol
 
2007
;
35
:
159
75
7.
Rönnemaa
E
Zethelius
B
Sundelöf
J
et al
.
Impaired insulin secretion increases the risk of Alzheimer disease
.
Neurology
 
2008
;
71
:
1065
71
8.
Whitmer
RA
Gunderson
EP
Quesenberry
CP
et al
.
Body mass index in midlife and risk of Alzheimer disease and vascular dementia
.
Curr Alzheimer Res
 
2007
;
4
:
103
9
9.
Anekonda
TS
Reddy
PH
.
Neuronal protection by sirtuins in Alzheimer's disease
.
J Neurochem
 
2006
;
96
:
305
13
10.
Gan
L
Mucke
L
.
Paths of convergence: Sirtuins in aging and neurodegeneration
.
Neuron
 
2008
;
58
:
10
14
11.
Nunomura
A
Moreira
PI
Lee
HG
et al
.
Neuronal death and survival under oxidative stress in Alzheimer and Parkinson diseases
.
CNS Neurol Disord Drug Targets
 
2007
;
6
:
411
23
12.
Dali-Youcef
N
Lagouge
M
Froelich
S
et al
.
Sirtuins: The “magnificent seven,” function, metabolism and longevity
.
Ann Med
 
2007
;
39
:
335
45
13.
Guarente
L
Picard
F
.
Calorie restriction-the SIR2 connection
.
Cell
 
2005
;
120
:
473
82
14.
Baur
JA
Pearson
KJ
Price
NL
et al
.
Resveratrol improves health and survival of mice on a high-calorie diet
.
Nature
 
2006
;
444
:
337
42
15.
Bordone
L
Cohen
D
Robinson
A
et al
.
SIRT1 transgenic mice show phenotypes resembling calorie restriction
.
Aging Cell
 
2007
;
6
:
759
67
16.
Cohen
HY
Miller
C
Bitterman
KJ
et al
.
Calorie restriction promotes mammalian cell survival by inducing the SIRT1 deacetylase
.
Science
 
2004
;
305
:
390
92
17.
Kaeberlein
M
McVey
M
Guarente
L
.
The SIR2/3/4 complex and SIR2 alone promote longevity in Saccharomyces cerevisiae by two different mechanisms
.
Genes Dev
 
1999
;
13
:
2570
80
18.
Picard
F
Kurtev
M
Chung
N
et al
.
Sirt1 promotes fat mobilization in white adipocytes by repressing PPAR-gamma
.
Nature
 
2004
;
429
:
771
76
19.
Halagappa
VKM
Guo
Z
Pearson
M
et al
.
Intermittent fasting and caloric restriction ameliorate age-related behavioral deficits in the triple-transgenic mouse model of Alzheimer's disease
.
Neurobiol Dis
 
2007
;
26
:
212
20
20.
Patel
NV
Gordon
MN
Connor
KE
et al
.
Caloric restriction attenuates Abeta-deposition in Alzheimer transgenic models
.
Neurobiol Aging
 
2005
;
26
:
995
1000
21.
Qin
W
Chachich
M
Lane
M
et al
.
Calorie restriction attenuates Alzheimer's disease type brain amyloidosis in Squirrel monkeys (Saimiri sciureus)
.
J Alzheimer's Dis
 
2006
;
10
:
417
22
22.
Wang
J
Ho
L
Qin
W
et al
.
Caloric restriction attenuates beta-amyloid neuropathology in a mouse model of Alzheimer's disease
.
FASEB J
 
2005
;
19
:
659
61
23.
Outeiro
TF
Marques
O
Kazantsev
A
.
Therapeutic role of sirtuins in neurodegenerative disease
.
Biochim Biophys Acta
 
2008
;
1782
:
363
69
24.
Qin
W
Yang
T
Ho
L
et al
.
Neuronal SIRT1 activation as a novel mechanism underlying the prevention of Alzheimer disease amyloid neuropathology by calorie restriction
.
J Biol Chem
 
2006
;
281
:
21745
54
25.
Julien
C
Tremblay
C
Bendjelloul
F
et al
.
Decreased drebrin mRNA expression in Alzheimer disease: Correlation with tau pathology
.
J Neurosci Res
 
2008
;
86
:
2292
302
26.
Mirra
SS
Gearing
M
McKeel
DW
et al
.
Interlaboratory comparison of neuropathology assessments in Alzheimer's disease: A study of the Consortium to Establish a Registry for Alzheimer's Disease (CERAD)
.
J Neuropathol Exp Neurol
 
1994
;
53
:
303
15
27.
Tremblay
C
Pilote
M
Phivilay
A
et al
.
Biochemical characterization of Abeta and tau pathologies in mild cognitive impairment and Alzheimer's disease
.
J Alzheimers Dis
 
2007
;
12
:
377
90
28.
Bennett
DA
Wilson
RS
Schneider
JA
et al
.
Natural history of mild cognitive impairment in older persons
.
Neurology
 
2002
;
59
:
198
205
29.
Bennett
DA
.
Postmortem indices linking risk factors to cognition: Results from the Religious Order Study and the Memory and Aging Project
.
Alzheimer Dis Assoc Disord
 
2006
;
20
:
S63
68
30.
Bennett
DA
Schneider
JA
Bienias
JL
et al
.
Mild cognitive impairment is related to Alzheimer disease pathology and cerebral infarctions
.
Neurology
 
2005
;
64
:
834
41
31.
Wilson
RS
Beckett
LA
Barnes
LL
et al
.
Individual differences in rates of change in cognitive abilities of older persons
.
Psychol Aging
 
2002
;
17
:
179
93
32.
Bennett
DA
Schneider
JA
Wilson
RS
et al
.
Neurofibrillary tangles mediate the association of amyloid load with clinical Alzheimer disease and level of cognitive function
.
Arch Neurol
 
2004
;
61
:
378
84
33.
Bennett
DA
Wilson
RS
Schneider
JA
et al
.
Apolipoprotein E epsilon4 allele, AD pathology, and the clinical expression of Alzheimer's disease
.
Neurology
 
2003
;
60
:
246
52
34.
Calon
F
Morissette
M
Rajput
AH
et al
.
Changes of GABA receptors and dopamine turnover in the postmortem brains of parkinsonians with levodopa-induced motor complications
.
Mov Disord
 
2003
;
18
:
241
53
35.
Kingsbury
AE
Foster
OJ
Nisbet
AP
et al
.
Tissue pH as an indicator of mRNA preservation in human post-mortem brain
.
Brain Res Mol Brain Res
 
1995
;
28
:
311
18
36.
Oddo
S
Caccamo
A
Shepherd
JD
et al
.
Triple-transgenic model of Alzheimer's disease with plaques and tangles: Intracellular Abeta and synaptic dysfunction
.
Neuron
 
2003
;
39
:
409
21
37.
Calon
F
Lim
GP
Yang
F
et al
.
Docosahexaenoic acid protects from dendritic pathology in an Alzheimer's disease mouse model
.
Neuron
 
2004
;
43
:
633
45
38.
Frye
RA
.
Characterization of five human cDNAs with homology to the yeast SIR2 gene: Sir2-like proteins (sirtuins) metabolize NAD and may have protein ADP-ribosyltransferase activity
.
Biochem Biophys Res Commun
 
1999
;
260
:
273
79
39.
Bousquet
M
Saint-Pierre
M
Julien
C
et al
.
Beneficial effects of dietary omega-3 polyunsaturated fatty acid on toxin-induced neuronal degeneration in an animal model of Parkinson's disease
.
FASEB J
 
2008
;
22
:
1213
25
40.
Masood
A
Stark
KD
Salem
N
.
A simplified and efficient method for the analysis of fatty acid methyl esters suitable for large clinical studies
.
J Lipid Res
 
2005
;
46
:
2299
305
41.
Folch
J
Lees
M
Sloane
Stanley GH
.
A simple method for the isolation and purification of total lipides from animal tissues
.
J Biol Chem
 
1957
;
226
:
497
509
42.
Sasaki
T
Maier
B
Bartke
A
et al
.
Progressive loss of SIRT1 with cell cycle withdrawal
.
Aging Cell
 
2006
;
5
:
413
22
43.
Terry
RD
Masliah
E
Salmon
DP
et al
.
Physical basis of cognitive alterations in Alzheimer's disease: Synapse loss is the major correlate of cognitive impairment
.
Ann Neurol
 
1991
;
30
:
572
80
44.
Zhao
L
Ma
QL
Calon
F
et al
.
Role of p21-activated kinase pathway defects in the cognitive deficits of Alzheimer disease
.
Nat Neurosci
 
2006
;
9
:
234
42
45.
Barberger-Gateau
P
Raffaitin
C
Letenneur
L
et al
.
Dietary patterns and risk of dementia: The Three-City cohort study
.
Neurology
 
2007
;
69
:
1921
30
46.
Calon
F
Cole
G
.
Neuroprotective action of omega-3 polyunsaturated fatty acids against neurodegenerative diseases: Evidence from animal studies
.
Prostaglandins Leukot Essent Fatty Acids
 
2007
;
77
:
287
93
47.
Morris
MC
Evans
DA
Bienias
JL
et al
.
Consumption of fish and n fatty acids and risk of incident Alzheimer disease
.
Arch Neurol
 
2003
;
60
:
940
46
48.
Schaefer
EJ
Bongard
V
Beiser
AS
et al
.
Plasma phosphatidylcholine docosahexaenoic acid content and risk of dementia and Alzheimer disease: The Framingham Heart Study
.
Arch Neurol
 
2006
;
63
:
1545
50
49.
Wu
A
Ying
Z
Gomez-Pinilla
F
.
Omega fatty acids supplementation restores mechanisms that maintain brain homeostasis in traumatic brain injury
.
J Neurotrauma
 
2007
;
24
:
1587
95
50.
Kitazawa
M
Oddo
S
Yamasaki
TR
et al
.
Lipopolysaccharide-induced inflammation exacerbates tau pathology by a cyclin-dependent kinase 5-mediated pathway in a transgenic model of Alzheimer's disease
.
J Neurosci
 
2005
;
25
:
8843
53
51.
Oddo
S
Caccamo
A
Cheng
D
et al
.
Genetically altering Abeta distribution from the brain to the vasculature ameliorates tau pathology
.
Brain Pathol
 
2008
(Jul 24; electronic publication ahead of print)
52.
Gómez-Isla
T
Price
JL
McKeel
DW
et al
.
Profound loss of layer II entorhinal cortex neurons occurs in very mild Alzheimer's disease
.
J Neurosci
 
1996
;
16
:
4491
500
53.
Hyman
BT
Van
Hoesen GW
Damasio
AR
et al
.
Alzheimer's disease: Cell-specific pathology isolates the hippocampal formation
.
Science
 
1984
;
225
:
1168
70
54.
Hyman
BT
Van
Hoesen GW
Kromer
LJ
et al
.
Perforant pathway changes and the memory impairment of Alzheimer's disease
.
Ann Neurol
 
1986
;
20
:
472
81
55.
Pallàs
M
Pizarro
JG
Gutierrez-Cuesta
J
et al
.
Modulation of SIRT1 expression in different neurodegenerative models and human pathologies
.
Neuroscience
 
2008
;
154
:
1388
97
56.
Chen
J
Zhou
Y
Mueller-Steiner
S
et al
.
SIRT1 protects against microglia-dependent amyloid-beta toxicity through inhibiting NF-kappaB signaling
.
J Biol Chem
 
2005
;
280
:
40364
74
57.
Prozorovski
T
Schulze-Topphoff
U
Glumm
R
et al
.
Sirt1 contributes critically to the redox-dependent fate of neural progenitors
.
Nat Cell Biol
 
2008
;
10
:
385
94
58.
Hallows
WC
Lee
S
Denu
JM
.
Sirtuins deacetylate and activate mammalian acetyl-CoA synthetases
.
Proc Natl Acad Sci U S A
 
2006
;
103
:
10230
35
59.
Araki
T
Sasaki
Y
Milbrandt
J
.
Increased nuclear NAD biosynthesis and SIRT1 activation prevent axonal degeneration
.
Science
 
2004
;
305
:
1010
13
60.
Kim
D
Nguyen
MD
Dobbin
MM
et al
.
SIRT1 deacetylase protects against neurodegeneration in models for Alzheimer's disease and amyotrophic lateral sclerosis
.
EMBO J
 
2007
;
26
:
3169
79
61.
Arriagada
PV
Growdon
JH
Hedley-Whyte
ET
et al
.
Neurofibrillary tangles but not senile plaques parallel duration and severity of Alzheimer's disease
.
Neurology
 
1992
;
42
:
631
39
62.
Giannakopoulos
P
Herrmann
FR
Bussière
T
et al
.
Tangle and neuron numbers, but not amyloid load, predict cognitive status in Alzheimer's disease
.
Neurology
 
2003
;
60
:
1495
500
63.
Nagy
Z
Esiri
MM
Jobst
KA
et al
.
Relative roles of plaques and tangles in the dementia of Alzheimer's disease: Correlations using three sets of neuropathological criteria
.
Dementia
 
1995
;
6
:
21
31
64.
Näslund
J
Haroutunian
V
Mohs
R
et al
.
Correlation between elevated levels of amyloid beta-peptide in the brain and cognitive decline
.
JAMA
 
2000
;
283
:
1571
77
65.
Brossard
N
Croset
M
Pachiaudi
C
et al
.
Retroconversion and metabolism of [13C]22:6n-3 in humans and rats after intake of a single dose of [13C]22:6n-3-triacylglycerols
.
Am J Clin Nutr
 
1996
;
64
:
577
86
66.
Grønn
M
Christensen
E
Hagve
TA
et al
.
Peroxisomal retroconversion of docosahexaenoic acid (22:6(n-3)) to eicosapentaenoic acid (20:5(n-3)) studied in isolated rat liver cells
.
Biochim Biophys Acta
 
1991
;
1081
:
85
91

Author notes

This work was supported by Grant MOP74443 from the Canadian Institutes of Health Research, by Grant ASC 0516 from the Alzheimer Society Canada, by Grant No. 10307 from the Canada Foundation for Innovation (to Frederic Calon), and by Grant No. P30AG10161 and R01AG15819 from the National Institute on Aging grants (to David Bennett). Carl Julien is supported by studentships from the Alzheimer Society Canada, Fonds de la Recherche en Santé du Québec, and Laval University “Fonds d'Enseignement et de Recherche.” The work of Frédéric Calon was supported by a New Investigator Award from the Clinical Research Initiative and the CIHR Institute of Aging (CAN-76833).