Paeonia lactiflora Pall. regulates the NF-κB-NLRP3 inflammasome pathway to alleviate cholestasis in rats

Abstract

Objectives

Cholestasis is a critical risk factor for severe hepatic disease or cirrhosis. The anti-inflammatory effect of Paeonia lactiflora Pall. (PLP), named Chishao in traditional Chinese medicine (TCM), on alpha-naphthylisothiocyanate (ANIT)-induced cholestasis model was tried to be elucidated in this research.

Methods

Therapeutic effect indices on hepatic function, including ALT, AST, TBIL, DBIL, ALP, TBA and γ-GT, were measured. To further investigate the protective mechanism of PLP, the mRNA and protein expression levels of NF-κB-NLRP3 inflammasome pathway were detected.

Results

Our results showed that compared with the model group, PLP could significantly reduce the increased serum indices such as ALT, AST, TBIL, DBIL, ALP, TBA and γ-GT induced by ANIT in a dose-dependent way. Moreover, we found that PLP downregulated the mRNA expression levels including IKK, p65, NLRP3, caspase-1 and IL-1β, especially at the large dose. Furthermore, PLP also significantly inhibited NF-κB-NLRP3 inflammasome pathway by decreasing the protein levels of p65, p-p65, p-IKK, NLRP3, caspase-1 and IL-1β.

Conclusions

The results indicated that PLP could ameliorate ANIT-induced cholestasis in rats and the anti-inflammatory effect of PLP might be related to regulating NF-κB-NLRP3 inflammasome pathway. This study will provide scientific evidence for PLP as a potential drug candidate for cholestasis.

anti-inflammatory, cholestasis, NLRP3, nuclear factor-kappa B, Paeonia lactiflora Pall

Introduction

Cholestasis is one of the widespread clinical liver diseases all over the world. It is associated with high standardised morbidity and might ultimately develop into hepatic failure and biliary cirrhosis.^[1] In the United States, cholestasis is in the top 15 leading causes of death based on the statistics data from the Centers for Disease Control.^[2] In addition to these, cholestasis produces heavy patient and societal burdens in China.^[3] It is the condition that bile cannot flow from liver to duodenum, characterized by the reduction in bile flow and the excessive accumulation of bile acid as well as any other toxic compounds.^[4] A recent study shows that oxidative stress, inflammation injuries and the dysregulation of transporters are the potential pathological mechanisms related to the development of this disease.^[5] Inflammatory stimulators activate signalling pathways, leading to inhibiting the expression as well as function of pivotal hepatobiliary transporters, resulting in fast and profound reductions in terms of bile flow.^[6]

Nuclear factor-kappa B (NF-κB), serving as a key transcription factor, regulates the expression of different inflammatory genes in various infectious diseases.^[7] NF-κB is a p65/p50 heterodimer in its predominant form.^[8] IκBα is degraded upon activation, followed by the transcription of downstream genes and nuclear translocation of NF-κB, subsequent synthesis of pro-inflammatory cytokines such as interleukin-6 (IL-6), interleukin-1β (IL-1β) and tumour necrosis factor-α (TNF-α).^[9] Activated NF-κB can induce transcription of many genes to promote inflammatory and apoptotic responses.^[10] Several NLRs, including NLRP3, modulate IL-1β in response to delivery of microorganisms and endogenous danger signals.^[11,12] The nucleotide-binding domain in NLRP3 accompany with the leucine-rich repeat-containing family mediates the processing and maturation of IL-1β by activating caspase-1 via the cleavage of procaspase-1 into mature caspase-1.^[13,14] Extensive studies show that NLRP3 is composed of NLRP3, ASC and caspase-1.

Cholestasis treatments are regularly performed with nonspecific clinical practice.^[15] Due to some patients with cholestasis did not respond to the treatment of UDCA, it is a critical issue to a protective agent with high specific and efficacy for the treatment of cholestasis.^[16] Traditionally, Chishao is the dried root of Paeonia lactiflora Pall. (PLP), which has been widely used as herbal medicine for treating hepatic disease over thousands of years, especially in China.^[17] Nevertheless, the involving mechanism of PLP on cholestasis is still not comprehensively researched. Particularly, the anti-inflammatory effect associated with the treatment of cholestasis still remains vastly unclear. To fully address these critical issues, alpha-naphthylisothiocyanate (ANIT)-induced cholestasis was successfully established in rats’ model to character how PLP alleviated cholestasis via reducing inflammation. Besides, our data also provided scientific role of NF-κB-NLRP3 inflammasome pathway in PLP treatment.

Materials and Methods

Drugs and reagents

Paeonia lactiflora Pall. was purchased from Beijing Lvye Medicinal Materials Company (Beijing, China) and strictly authenticated according to the Chinese Pharmacopoeia (edition 2015, volume 1). The standard reference compound of paeoniflorin was obtained from the National Institutes for Food and Drug Control (Beijing, China). The standard reference compound of albiflorin was obtained from Chengdu Biopurify Phytochemicals Ltd. (Chengdu, China). ANIT was obtained from Sigma-Aldrich Company (St Louis, MO). ELISA kits, including total bilirubin (TBIL), direct bilirubin (DBIL), total bile acid (TBA), alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP) and γ-glutamyl transpeptidase (γ-GT), were obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Anti-IL-1β antibody, anti-GAPDH antibody and anti-β-actin antibody were from Abcam (ab150777, ab181602, ab8227, respectively). Anti-p-IKK antibody, anti-p65, anti-p-p65 antibody were obtained from Cell Signaling Technology (2697, 4764S and 3033, respectively). Anti-NLRP3 antibody was purchased from NOVUS (NBP2-12446). Moreover, anti-caspase-1 antibody was purchased from Biovision (3019-100). Anti-ASC polyclonal antibody (YT0365) was purchased from Immunoway. All the other chemicals and reagents at analytical grade were obtained from business sources.

Water extract of PLP preparation

In accordance with the Chinese pharmacopoeia (2015 Edition), the quality of PLP was identified. The decoction pieces of PLP were soaked into water (1/10 w/v) for 30 min and then extracted with water for twice, 2 h for the first time and 1.5 h for the second time. The water extract of PLP was merged together, filtered and evaporated until dry under negative pressure to prepare a freeze-dried powder with a weight ratio at 25.78%. The freeze-dried powder was dissolved in ethanol, and the final concentration of injection sample was 0.02 g/ml.

Identification of compounds and quantitative analysis

Identification of compounds and quantitative analysis was carried out on Waters 2695 system (Waters, Milford, MA, USA) equipped with 2998 detector and chemical workstation. The chromatographic separation was performed using Kinetex XB-C18 column and Welch Ultimate® XB-C18 column. The mobile phase consisting 0.1% formic acid (A) and acetonitrile (B) were used for identification of compounds and quantitative analysis. The mobile phase for compounds identification was listed in Table 1A. Triple TOF 4600 was used for the analysis. The major compounds of PLP were identified according to our pre-experiment. The mobile phase of fingerprint was listed in Table 1B. The mobile phase for quantitative analysis was 85%A and 15%B. Chromatograms were recorded at an absorbance of 230 nm and fingerprint at 254 nm. The mobile phase was eluted at a flow rate of 1 ml/min, and the final injection volume was 10 μl for quantitative analysis.

Table 1

(A) Mobile phase for compounds identification. (B) Mobile phase of fingerprint

(A)
t (min)	A (v/v)%	B (v/v)%
0	90	10
1	90	10
8	90–20	10–80
12	20	80
12.01	90	10
15	90	10

(B)
t (min)	A (v/v)%	B (v/v)%
0	85	15
15	85	15
20	80	20
30	80	20
50	60	40
60	60	40

Animal handling and ethics statement

Male Sprague-Dawley (SD) rats weighing 200 ± 20 g were provided by the laboratory animal centre of the Military Medical Science Academy of the PLA (Permission No. SCXK-(A) 2012-0004). This research was strictly conducted according to the recommendations of the Guidelines for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of China, and the experimental protocol was approved by the Ethics Committee of Animal Experiments of the 302 Military Hospital. Sixty rats were randomly and evenly divided into six experimental groups. The animals in control group were administered with normal saline for 5 days and olive oil (without 60 mg/kg ANIT) on the third day. The animals in model group were administered with normal saline for 5 days and 60 mg/kg ANIT (dissolved in olive oil) on the third day. In positive control group, animals were subjected to the same daily treatment with 60 mg/kg UDCA for 5 days and 60 mg/kg ANIT (dissolved in olive oil) on the third day. In three PLP-treated groups, different doses (20, 40 and 80 g/kg body weight, respectively) of PLP (dissolved in normal saline) were administered via intragastric gavage for five consecutive days and received 60 mg/kg ANIT on the third day. The doses of PLP used in this research were in line with previous experiments and were proved as no toxic reactions in rats.^[17]

Assessment of serum biochemical indicators and liver histopathology

Rats were anaesthetized by 20% ethyl carbamate after one hour of the last administration. Next, the animals were sacrificed for blood samples and liver tissues. Blood samples were collected from the abdominal aorta and centrifuged at 3000 × g for 10 min for separating serum for the analysis of AST, ALT, ALP, γ-GT, TBA, TBIL and DBIL. All the specific indicators were measured by Synergy Hybrid Reader (Biotek, Winooski, VT, USA) according to the manufacturer's instructions. In addition, liver samples were fixed in 10% neutral-buffered formalin and embedded in paraffin and stained with haematoxylin–eosin (HE). Then, liver sections were examined under Nikon microscope and analysed by NIS-Elements (version F 4.0) software.

Liver mRNA expression

Quantitative reverse-transcription polymerase chain reaction (RT-PCR) was performed to measure the effect of PLP on hepatic-specific mRNAs expression of NLRP3, IL-1β, p65, caspase-1 and IKK following the manufacturer's protocols. The primers’ sequences of IKK, p65, NLRP3, caspase-1 and IL-1β are shown in Table 2. The amplification reaction of RNA was performed by ABI Step One Plus (Applied Biosystems Inc, Carlsbad, CA, USA) PCR machine, including 40 cycles (5 s at 95°C and 60 s 60°C). Data were calculated for comparison using 2^−ΔΔCT method.

Table 2

Primers sequences for RT-PCR

Gene	Sense primer (5′–3′)	Antisense primer (5′–3′)
NLRP3	ACCTTCTCCCACTGTTTCTAAAGGCTTCT	AGCTTGCATCACTGTCAAAGGCGGACTAA
IL-1β	TCGTGCTGTCTGACCCATGT	ACAAAGCTCATGGAGAATACCACTT
p65	CCATCAGGGCAGATCTCAAACC	GCTGCTGAAATCTGAGTTGTC
caspase-1	CCAGAGCACAAGACTTCTGAC	TGGTGTTGAAGAGCAGAAAGC
IKK	AGCTCTGGAACCTCCTGAAGA	AGCTCCAGTCTAGGGTCGTGA
GAPDH	ACCACAGTCCATGCCATCAC	TCCACCACCCTGTTGCTGTA

Liver protein expression

The expressions of hepatic-specific protein in NF-κB-NLRP3 inflammasome pathway including p65, p-p65, NLRP3, ASC, caspase-1, p-IKK and IL-1β were assessed by Western blotting. The liver tissue (0.1 g) was homogenized and then lysed in the prepared ice-cold lysis buffer (including 1 mm phenylmethylsulfonyl fluoride and a protease inhibitor mixture). The sample was set to centrifuge at the condition of 4°C and 8000×g for 10 min to remove all debris. Immunodetection was carried out with the antibodies in the 5% of milk solution, tris-buffered saline (TBS) and 0.05% Tween-20. Then, the sample was incubated with the peroxidase-conjugated secondary antibodies (β-actin) and the membrane was completely washed with TBST for 60 min. The immune reactive bands’ vision was detected through chemiluminescence.

Statistical analysis

SPSS software programme (version 20.0; SPSS Inc., Chicago, USA) was used to perform the statistical analysis, and the data were presented as the mean ± SD. One-way analysis of variance was applied to calculate the differences between the different group means. P value less than 0.05 was considered to be statistically significant, and less than 0.01 was highly significant.

Results

Main compounds in PLP

Firstly, the main compounds existed in the aqueous extract of PLP were fully identified. Both positive ES mode and negative ES mode of the total ion chromatograms are illustrated in Figure 1. Ten chemical compounds, including oxypaeoniflorin, mudanpioside E, paeoniflorin, albiflorin, 6-O-galloylpaeoniflorin, benzoylpaeoniflorin, gallic acid, galloylalbiflorin, mudanpioside C and paeonol, were totally identified. The analysed and identified compounds are listed in Tables 3 and 4.

Figure 1

The positive and negative ES mode of LC–MS of PLP aqueous extract. Ten major compounds were identified. (a) The sequence of tR was oxypaeoniflorin, mudanpioside E, paeoniflorin or albiflorin, 6-O-galloylpaeoniflorin and benzoylpaeoniflorin. (b) The sequence of tR was gallic acid, oxypaeoniflorin, mudanpioside E, galloylpaeoniflorin, paeoniflorin or albiflorin, 6-O-galloylpaeoniflorin, mudanpioside C and paeonol.

Table 3

PLP aqueous extract sample ion fragment information at positive ES mode

Chemical formula	Positive ion mode (m/z)	Deviation (ppm)	MS/MS fragment	Assigned identification
C23H28O12	519.15 [M+ Na]+	6.7	408.83, 357.09, 219.06	Oxypaeoniflorin
C24H30O13	549.16 [M+ Na]+	7	549.16, 387.11	Mudanpioside E
C23H28O11	503.16 [M+ Na]+	7.4	381.12, 341.10, 219.06	Paeoniflorin
C23H28O11				Albiflorin
C30H32O15	655.17 [M+ Na]+	8.5	533.17, 337.05	6-O-Galloylpaeoniflorin
C30H32O12	607.18 [M+ Na]+	7.9	485.15, 375.11	Benzoylpaeoniflorin

Table 4

PLP aqueous extract sample ion fragment information at negative ES mode

Chemical formula	Positive ion mode (m/z)	Deviation (ppm)	MS/MS fragment	Assigned identification
C7H6O5	169.01 [M−H]−	2	125.02	Gallic acid
C23H28O12	495.16 [M−H]−	4	465.14, 137.02	Oxypaeoniflorin
C24H30O13	525.16 [M−H]−	4.4	449.15, 327.11, 309.10, 165.06, 121.03	Mudanpioside E
C30H32O15	631.17 [M−H]−	4.4	313.06	Galloylalbiflorin
C23H28O11	479.16 [M−H]−	2.4	327.16, 313.05, 177.06, 121.03	Paeoniflorin
C23H28O11				Albiflorin
C30H32O15	631.17 [M−H]−	4.4	613.16, 491.12, 399.09, 313.06, 271.05, 169.01	6-O-Galloylpaeoniflorin
C30H32O13	599.18 [M−H]−	5.1	551.16, 447.13, 431.14, 281.07, 137.02	Mudanpioside C
C9H10O3	165.06 [M−H]−	7.8	122.04	Paeonol

Fingerprint and quantitative of compounds in PLP

To standardize the fingerprint of PLP water aqueous, 10 samples were analysed. Similarity Evaluation System for Chromatographic Fingerprint of Traditional Chinese Medicine (Version 2004A) was applied to assess the chromatograms of PLP samples (Figure 2). Eight common peaks were confirmed for their relatively high intensity and better resolution that existed in all 10 PLP samples.

Figure 2

HPLC chromatographic fingerprints of 10 PLP samples.

To further guarantee the quality of PLP, high performance liquid chromatography (HPLC) method was used to assess the compounds of paeoniflorin and albiflorin in PLP water extract. The typical HPLC chromatograms of the blank solution (Figure 3a), the PLP injection samples (Figure 3b) and the paeoniflorin as well as albiflorin reference standards (Figure 3c and 3d) were identified. The contents of paeoniflorin and albiflorin were 8.47% and 0.095%, respectively.

Figure 3

HPLC chromatograms of PLP aqueous extract.

Different doses of PLP on serum biochemical indicators

To determine whether liver cholestasis and protective effect of PLP occurred, the sensitive indices including serum ALT, AST, TBIL, DBIL, ALP, TBA and γ-GT levels were detected by Synergy Hybrid Reader. The serum levels of ALT and AST in ANIT group were strongly higher than that of control group (P < 0.01, P < 0.01) (Figure 4a and 4b). Conversely, we found that serum ALT and AST levels with doses of 80 and 40 g/kg PLP were strongly decreased (P < 0.01, P < 0.05). Surprisingly, the effect of high dose PLP (80 g/kg) was more closed to the UDCA group. Notably, at lower doses of PLP (20 g/kg) contributed to alter the levels of ALT, but not AST. The crucial indices of cholestasis, specifically TBIL, DBIL, ALP, TBA and γ-GT serum levels, were strongly elevated in the ANIT-treated rats relative to controls (P < 0.01) (Figure 4c–g). Moreover, the serum levels of ALP, TBIL, γ-GT and TBA were exceedingly decreased in rats of three PLP groups (P < 0.01). In addition, the level of DBIL decreased remarkably in rats with doses of 80 and 40 g/kg PLP (P < 0.01, P < 0.05).

Figure 4

Different doses of PLP effect on serum biochemical indicators of liver function. Rats were treated with 60 mg/kg alpha-naphthylisothiocyanate (ANIT) with different doses of PLP. The following seven liver function markers in the serum were assayed: (a) ALT; (b) AST; (c) TBIL; (d) DBIL; (e) ALP; (f) TBA; and (g) γ-GT. Data are expressed as the mean ± SD. ^##P < 0.01 compared with control group; **P < 0.01 compared with ANIT group.

The enhancement of PLP for alleviating liver histological damage

Haematoxylin–eosin (HE)-stained liver sections were used to detect the histological changes among all the groups. Typical pathological changes were found in ANIT group (Figure 5b) compared with control group (Figure 5a), including hepatic lobules destruction, neutrophil infiltration in the portal area, sinus congestion and hepatic necrosis. Pathological changes in liver tissue were significantly relieved in the UDCA (Figure 5c) and high dose of PLP groups at 80 g/kg (Figure 5f) compared to ANIT-treated groups. Specifically, there was certain degree of bile duct epithelial damage and defined hepatocyte hydropic degeneration, accompanied by less hepatic neutrophil with infiltration in PLP groups at 20 and 40 g/kg (Figure 5d and 5e). Moreover, the liver damage at the dosage of 20 g/kg PLP group was similar to the ANIT group, which almost did not attenuate liver damage.

Figure 5

Effect of PLP on histological changes in the liver tissue of alpha-naphthylisothiocyanate (ANIT)-induced rats. Rats were treated with different doses of PLP. It represented different effects with histological changes. Damage to hepatocytes is pointed by black arrows. (a) Control; (b) ANIT; (c) UDCA; (d) PLP 20 g/kg; (e) PLP 40 g/kg and (f) PLP 80 g/kg. (HE stained, 200× magnification).

Expression of mRNAs involved in NF-κB/NLRP3 signalling pathway

To address the potential mechanism of PLP for the inhibition of inflammasome pathway, the effect of PLP on hepatic-specific mRNA expressions including IKK, p65, NLRP3, caspase-1 and IL-1β was further detected. The results indicated that mRNA expressions of IKK, p65, NLRP3, caspase-1 and IL-1β were remarkably increased by ANIT-treated groups (P < 0.01). Moreover, PLP at 80 g/kg could significantly reduce the increased mRNA levels of IKK, p65, NLRP3, caspase-1 and IL-1β induced by ANIT (P < 0.01) (Figure 6a-e). In addition, PLP at 40 and 20 g/kg have a weaker effect (P < 0.05). PLP at 40 and 20 g/kg was able to significantly reduce the increased mRNA levels of p65, NLRP3, caspase-1 and IL-1β (P < 0.01, P < 0.05). However, PLP at 20 g/kg could not decrease the IKK level compared with ANIT group.

Figure 6

Relative mRNA expressions of IKK, p-65, NLRP3, caspase-1 and IL-1β. Rats were treated with different doses of PLP. (a) IKK; (b) p65; (c) NLRP3; (d) caspase-1 and (e) IL-1β. Data are expressed as the mean ± SD. ^##P < 0.01 compared with control group; **P < 0.01 compared with ANIT group.

Regulation of PLP on proteins in NF-κB/NLRP3 signalling pathway

We detected the protein expression of p-p65/p65, p-IKK, NLRP3, ASC, procaspase-1, caspase-1 and IL-1β (mature form, 17kd). As expected, ANIT-treated groups showed markedly increased protein expression of p65, p-p65, p-IKK NLRP3, IL-1β and caspase-1 but not ASC and procaspase-1 compared with control group (P < 0.01, P < 0.05). PLP at 80 g/kg dose could decrease the protein expression of p65, p-p65, p-IKK NLRP3, IL-1β and caspase-1 and increase p-p65 compared with ANIT group (P < 0.01, P < 0.05). However, there was no difference in procaspase-1 and ASC between PLP at 80 g/kg dose group and ANIT group (P > 0.05). PLP at 40 and 20 g/kg doses was able to decrease p65, p-IKK, caspase-1 and IL-1β in moderate degree (P < 0.05, P < 0.01) (Figure 7a–c, f–h). However, there was no difference in NLRP3, ASC and procaspase-1 between lower doses of PLP groups and ANIT group (P > 0.05).

Figure 7

Western blot analysis of p65, NLRP3, procaspase-1, caspase-1, p-IKK, IL-1β, p-p65 and ASC. Rats were treated with different doses of PLP. (a) The Western blot images of p65, NLRP3, procaspase-1 and caspase-1; (b) the Western blot images of p-IKK and IL-1β; (c) relative p65 protein level in liver tissue; (d) relative NLRP3 protein level in liver tissue; (e) relative procaspase-1 protein level in liver tissue; (f) relative caspase-1 protein level in liver tissue; (g) relative p-IKK protein level in liver tissue; (h) relative IL-1β protein level in liver tissue; (i) the Western blot images of p-p65 and ASC; (j) relative p-p65 protein level in liver tissue; (k) relative ASC protein level in liver tissue.

Discussion

Cholestasis probably results from defective secretion of hepatocellular or cholangiocellular and bile ducts obstruction, including bile duct lesions, stones or tumours.^[18] Furthermore, cholestasis may lead to hepatocellular impairment, progressive liver fibrosis and even death due to liver failure in later development without proper treatment.^[19] A number of studies indicate that inflammation caused by hydrophobic bile acids is thought to be toxic. It plays an important role in the development of several kinds of liver diseases, such as cholestasis and liver fibrosis.^[20,21] More and more evidences show that inflammation is a pivotal factor in the pathogenesis of cholestatic damages. It will be beneficial to discover therapeutic strategies for cholestasis with the exploration of inflammatory response.

Therefore, in this study, rats with ANIT treatment were applied to mimic the cholestasis and explore the potential mechanism of cholestatic hepatitis. Previous studies showed PLP exhibited multiple pharmacological effects, such as liver protection,^[3] anti-oxidation,^[22] anti-allergic,^[23] vasodilatation of thoracic aorta^[22] and immune-regulation effects.^[24] Recent studies have highlighted that PLP exerts its pharmacological effects via anti-inflammation effect.^[25] Previous studies have demonstrated that paeoniflorin is the primary active ingredient of PLP, which has been reported to significantly ameliorate acute kidney injury via inhibiting liver inflammatory responses and renal cell apoptosis involving MAPK and NF-κB signalling pathway in vivo.^[26] Its anti-inflammatory effect is also reflected in that paeoniflorin prevents brain injury in rats via blocking MAPKs/NF-κB-mediated inflammatory responses.^[27] Other compound in PLP, such as paeonol, also exhibits anti-inflammation activity.^[28] A genomewide microarray analysis revealed that paeonol shows the anti-inflammation effects mediated by chemokine and cytokine signalling in LPS-treated RAW264.7 macrophages.^[29] According to our previous study, the aqueous extract of PLP was clinically effective to cholestatic hepatitis^[3] and suggested that PLP played its role against cholestasis by its anti-oxidation and free radical scavenger effect.^[17] That study also pointed out that the anticholestasis effect of PLP is closely associated with oxidative stress as well as other influencing factors, such as inflammation and imbalance of bile acid.

In this study, the results demonstrated that the increased serum biochemical indicators including ALT, AST and ALP, TBIL, DBIL, TBA and γ-GT in ANIT-treated groups were dose-dependently decreased after PLP treatment. The histological results also showed a significant therapeutic effect at the high dose of 80 g/kg and middle dose of 40 g/kg, whereas PLP only showed a weaker effect at the dose of 20 g/kg. From these results, PLP, especially at large dose, is effective on ANIT-induced cholestasis. Several researches indicated that many pro-inflammatory cytokines, such as IL-1β, IL-6 together with TNF-α, increase significantly in the liver tissue of ANIT-induced cholestasis. Among them, as a pivotal inflammatory mediator upstream of the IL-6 and TNF-α signalling cascades, IL-1β has been displayed to be associated with a numerous of acute and chronic liver damages.^[30,31] Increasing evidence shows that the inflammasome, such as NLRP1, NLRP3, NLRC4 and AIM2 family members, plays an important role in the production of IL-1β.^[13,32] Among them, NLRP3 is recognized to be the most fully characterized inflammasome. It assembles in the cytoplasm by recruiting apoptosis related to speck-like protein caspase-1 and ASC, and the activation of caspase-1 and further leads to the cleavage of pro-IL-1β, thus promoting the maturation and secretion of IL-1β.^[33,34] Research shows that UDCA, the only medicine approved by Food and Drug Administration (FDA) for the therapy of cholestasis, could efficiently inhibit the inflammatory gene expression in intrahepatic cholestasis of pregnancy (ICP).^[35] Recognizing the importance of IL-1β in inflammatory response, the effect of PLP at different doses on the protein expression of IL-1β was completely examined. As the results showed, PLP dose-dependently decreased both the mRNA and protein expressions of IL-1β, which were increased in ANIT-treated rats.

The activation of NF-κB has been well-recognized as the important event during inflammatory responses. P65 and p50 are the most common subunits of NF-κB. The inhibitor of NF-κB controls the activation of NF-κB and maintains it in an inactive state in the cytoplasm. IκBα is one of the inhibitors that inhibits p65/p50 dimers, which is phosphorylated by the IκB kinase (IKK) activation. Subsequently, IκBα is degraded from NF-κB and ubiquitinated, which enables the activation and the translocation of NF-κB to enter the nucleus to further activate gene transcription.^[36] Evidence shows that NF-κB is activated during the formation process of cholestasis.^[37] In our present study, the subunit of NF-κB is studied to determine whether PLP plays the regulation role in NF-κB and the results showed that PLP at high (80 g/kg) and middle (40 g/kg) dose significantly reduced the mRNA and protein expression levels of p65, whereas doses of 20 g/kg had a weaker effect. To further investigate the PLP effect on NF-κB pathway, we examined the upstream activators of the NF-κB, IKK level on mRNA expression and p-IKK level of protein expression. In our experiment, both IKK and p-IKK levels were reduced in different PLP groups, and the effect was observed in a dose-dependent manner. These results demonstrated that ANIT-induced cholestasis in rats was improved especially by a large dose of PLP.

In addition to the crucial role of NF-κB, IKK and p65 in inflammatory responses, activation of NLRP3 also plays a pivotal role in the maturation of IL-1β. Inflammasome activation of NLRP3 might result in overproduction of IL-1β. Indeed, it has been reported that pharmacological NLRP3 inflammasome activation plays an important role in producing inflammation and promoting liver pathologies such as alcoholic steatohepatitis (ASH) and nonalcoholic steatohepatitis (NASH).^[38] NLRP3 also mediates processing and maturation of IL-1β by the activation of caspase-1 via the cleavage of pro-caspase-1 into mature caspase-1.^[13,14] As shown in our results, we examined the mRNA expression levels of caspase-1 as well as the protein expression levels of caspase-1 and pro-caspase-1. Our results showed that the mRNA expression of NLRP3 and caspase-1 could be strongly reduced by all doses of PLP. Meanwhile, in protein levels, only caspase-1 at all doses and NLRP3 at 80 g/kg were affected. This result indicates that PLP improves ANIT-induced cholestasis through the NLRP3 pathway by impeding processing of the procaspase-1 form into casepase-1. All the evidence mentioned before indicates that PLP is capable of improving ANIT-induced cholestasis by downregulating inflammation via the NF-κB/NLRP3 signalling pathway (Figure 8).

Figure 8

The possible mechanism of PLP on cholestasis via regulating NF-κB and NLRP3 inflammasome.

Conclusion

In summary, various histological assessments and biochemical tests were used to reveal the mechanism of PLP. The study demonstrates that PLP is potent for downregulating NF-κB/NLRP3 signalling pathway thus protects rats against ANIT-induced cholestasis. Therefore, PLP might be a promising therapeutic agent for the treatment of cholestasis.

Declarations

Conflict of interest

The authors declare that they have no conflicts of interest to disclose.

Acknowledgements

The authors wish to thank reviewers for the critical comments provided during revision and wish to thank all authors of references. This work was financially supported by grants from National Natural Science Foundation of China (81874365, 81573631 and 81303120) and Sichuan Province Clinical Chinese Pharmacy Science and Technology Innovation Youth Team (2017TD0001).