https://orcid.org/0000-0003-1607-5114
Abstract
This study was aimed to investigate the effects of garlic oil (GO), an important natural constituent used in alleviating diabetes and its complications, on the expression levels of irisin and related genes.
Thirty-two rats were divided into four groups: Control, Diabetes-Control, Diabetes+GO 100 mg/kg/day and Control+GO 100 mg/kg/day for 45 days. The measurements included: changes in liver Peroxisome proliferator-activated receptor-gamma-coactivator (PGC)-1α, Fibronectin Type-III-Domain-Containing5 (FNDC5), irisin expression, mRNA expression of p38 and TNF-α (Tumour necrosis factor-α), total-antioxidant-status (L-TAS; S-TAS), total-oxidant-status (L-TOS; S-TOS) in liver and serum, respectively.
There was a significant reduction in serum levels of irisin and S-TAS and expression of PGC-1α and FNDC5 in liver in Diabetes-control compared to Control-group, while a significant increase in serum levels of fasting blood glucose (FBG) and TOS, also p38 and TNF-α expressions in liver. In Diabetes+GO group, there was a significant increase in serum irisin and S-TAS, also expression of PGC-1α and FNDC5 in liver, while serum FBG, S-TOS levels, and mRNA expression of p38 and TNF-α in liver were decreased compared to Diabetes-control group (P < 0.05).
GO alleviated the diabetic liver injury by decreasing Oxidative-Stress parameters and regulation PGC-lα, FNDC5, irisin and P38, keeping the balance of TAS/TOS and TNF-α.
Introduction
Nutrition and form of nutrition play a significant role in progress of various diseases including diabetes and cardiovascular diseases. There are several in vitro and in vivo studies which reported the positive effects of garlic and its components on preventing and treating the metabolic diseases in diabetes, as well cardiovascular diseases, atherosclerosis, hyperlipidemia, thrombosis and hypertension. In addition to its long-term use in the over world, garlic has attracted the attention of modern medicine in recent years due to its relatively low cost and its positive effects on human and animal studies and is even recommended by many authorities as a medicine.[1] Based on many studies on experimental animals and humans regarding garlic, it is known to reduce blood sugar levels, be effective in protection against cardiovascular diseases and significantly decrease the levels of serum total cholesterol and LDL cholesterol.[2] In addition to this, the antioxidant potential of garlic oil (GO) has been associated with organosulfur compounds that regulate the activity of glutathione and glutathione S-transferases (GST) and the presence of S-allyl cysteine compounds.[3, 4] Moreover, lipid peroxides were ameliorated in diabetic rats, having GO treatment,[5] while GO suppressed the thiobarbituric reactive substances in liver. Likewise, treatment with garlic prevented the lipid peroxidation in the form of malondialdehydes.[6]
The number of people in the world with diabetes mellitus (DM) has increased about four times in the last three decades, and at this point, diabetes mellitus and its complications are a great global health threat as the ninth most frequent cause of death. The International Diabetes Federation indicated that 1 in every 11 adults at the ages of 20–79 (415 million adults) were exposed to this disease in 2015, and this number has a high likelihood of increasing up to approximately 642 million by the year 2040.[7] While increasing the number of cases with diabetes all over the world, important data related to diabetes disease are obtained. One of these is irisin, which was discovered in 2012 and is a proteolytic product of FNDC5 that contributes to several pathways related to the energy metabolism. FNDC5 gene expression increases via the PPARy and its coactivator (PGC1).[8] Due to its key role in the glucose metabolism, PGC-lα has been considered as an attractive gene region for antidiabetic treatment in recent years.[9] The expression of PGC-lα mRNA decreases especially in insulin resistance,[10] and this is thought to be closely related with diseases such as obesity, diabetes and cardiomyopathy. In addition to this, irisin is accepted as an antidiabetic hormone, while it was indicated to have an important role in the metabolism of liver, and its levels decrease in individuals with diabetes.[11] Meanwhile, it is known that there is a negative relationship between irisin and oxidative stress.[12] In addition antidiabetic effect, garlic and its compounds have reported to improve insulin secretion and have antioxidant properties that increase insulin sensitivity. It is also known that various structural and functional disorders affect the glycogen and lipid metabolism due to diabetes in the liver. For this reason, this study was carried out with the purpose of determining how GO affects the expression of irisin and related genes in liver which have a central and critical role in regulating the carbohydrate metabolism in diabetic rats, and this way, contributing to existing reports that explain the action mechanism of GO.
Material and Methods
Experimental animals
Totally, 32 adult (4 months; body weight 300–320 g), male Wistar albino rats (n = 8 in each group) were used in this study. Animals were treated according with the Guide for the Care and Use of Laboratory Animals (8th edition, National Academies Press). The experimental protocols on the committee’s meeting at 01/23/2020 was approved (Approval number: 2020/1–4) by the Animal Ethics Review Committee of Kahramanmaras Sutcu Imam University, Turkey. The animals were obtained from the animal breeding house at the Faculty of Medicine, Kahramanmaraş Sütçü imam University. All animals used in the study were healthy. The animals were preserved on commercial rat feed that contained 5% fat, 21% protein, 55% nitrogen free extract and 4% fibre (wt/wt) with adequate mineral and vitamin contents and had ad libitum access to water and food. They were kept under a photoperiod of 12 h of light and 12 h of darkness in controlled temperature conditions of (20–24°C).
Experimental procedure
Rats were established as diabetic when their fasting blood glucose (FBG) levels were >200 mg/dl 72 h after a single dose STZ administration (Sigma, St. Louis, MO, USA). The diabetic animals were randomly assigned to two groups and received commercial GO, an organoleptic (garlic; alliaceous; sulfurous) was purchased from Sigma-Aldrich Chemical Co., (St Louis, MO, USA; CAS Number: 8000-78-0; W250320) and GO was dissolved in physiological saline solution.[13–15] The control groups were divided into two groups of eight rats each as below. Dose of GO was administrated as in previous studies.[14, 16–18]
Control group (C): This group received saline solution (oral gavage; 6 weeks)
Control + garlic oil (Control+GO): This group received 100 mg/kg/day GO (oral gavage; 6 weeks)
Diabetes control group (DC): This group received 60 mg/kg streptozotocin (STZ; i.p)
Diabetes + Garlic oil group (Dibetes+GO): This group received 100 mg/kg/day GO (oral gavage; 6 weeks).
Tissue and serum preparation
At week 6, all of the live rats were weighed by using a weighing balance (EB-3200H balances, Shimadzu Corp., Japan), sensitivity of ±0.01 g, before they were sacrificed under anaesthesia using 10% ketamine (Alfamine; Alfasan IBV, Woerden, The Netherlands) and 2% xylazine (Alfazine; Alfasan IBV, Woerden, The Netherlands).
The blood samples of rats obtained were centrifuged at 4000 rpm for 8 min (Hettich ROTİNA 380/380R, Germany) and serum was collected. Serum samples were depoted at −80°C until the date of analysis. The liver tissues were carefully dissected free of surrounding connective tissue, removed, macroscopically examined. Immediately thereafter the liver was rinsed in ice cold sodium chloride (0.9% NaCl), frozen in liquid nitrogen and stored at −20°C until processed with biochemical assays.
Histological study
The separated liver tissue was associated to the general procedures for paraffin blocks embedding, sectioning, and staining. Paraffin edges of 5 μm were obtained and stained with haematoxylin and eosin (H&E) to demonstrate the histological details. For each rat, 20 seminiferous tubules were evaluated under a light microscope (Olympus, BX51, Japan) and analysis 5 Research (Olympus Soft Imaging Solution).
Immunohistochemical staining procedure
For irisin, the streptavidin-biotin-peroxidase complex method was applied. From the tissues that were blocked with this method, sections with thicknesses of 4–6 µm were taken and deparaffinized. A Thermo Scientific TP-015-HA commercial kit and antibody diluted by a rate of 1/200 were utilized (irisin Rabbit Polyclonal H-067-17, Phoenix Pharmaceuticals, Inc.). Positive and negative controls were formed in the way recommended by the manufacturers. Following AEC chromogen application, staining was carried out with Mayer haematoxylin, and the samples were investigated under a light microscope. The preparates that were prepared were analysed under a Leica DM500 microscope and photographed (Leica DFC295).
In the staining process, the prevalence (0.1: <25%, 0.4: 26–50%, 0.6: 51–75%, 0.9: 76–100%) and severity (0: none, +0.5: very mild, +1: mild, +2: moderate, +3: severe) of immunoreactivity were taken as a basis, and histoscores were created. Histoscore = prevalence × severity.
RNA isolation, cDNA synthesis and qRT-PCR analysis
Liver tissues were mixed at 6500 rpm for 35 s. Total RNA of the tissue was obtained using a High Pure RNA Isolation kit (Cat.No. 12033674001 Roche Applied Science, Mannheim, Germany) in accordance with the manufacturer’s instructions. The integrity and purity of RNA was evaluated using Nanodrop and then gel electrophoresis devices (DeNovix DS-11 FX, USA).
Complementary DNA (cDNA) was synthesized by Transcriptor High Fidelity cDNA Synthesis Kit (Cat.no.05091284001, Roche, Mannheim Germany) according to the manufacturer’s instructions.
Gene expression was implemented using the LightCycler 480 SYBR Green I Master reaction kit (Roche, Germany). The primer sequences were designed (5′→3′) as below
GAPDH forward:CAACAATGAGCCTGCGAACA and reverse TGAGGACCGCTAGCAAGTTTG, PGC-1α forward:CAACAATG AGCCTGCGAACA reverse:TGAGGACCGCTAGCAAGTTTG, FNDC5 forward: AGCTCAGAAGTAGAATGCGAGAG reverse: GGTGATAGGAGAAGATGGTGGTG, P38 forward: ACATCGT GTGGCAGTGAAGAAG reverse:CTTTTGGCGTGAATGATGGA and TNF-α forward:GCAGGTCTACTTTGGAGTCATT reverse: GGCTCTGAGGAGTAGACGATAA. Finally, 10 μl SYBR Green PCR Master mix, 1 μl forward and reverse primers (10 pmol) and 3 μl ddH2O were added to the 5 μl target cDNA. Twenty microlitres final volume put into the real-time PCR device (LightCycler 96, Germany). The relative mRNA expression of the inspected genes compared to that of GAHPD was calculated by using the 2−ΔCt methods. The –ΔCt (−ΔCt = Ct genes − Ct (GAPDH) was used to describe the gene expression levels.
Biochemical analysis
The activity of TAS and TOS (Product Code: RL0017 and Product Code: RL0024, Rel Assay Diagnostics Mega Tıp Ltd.) in serum, were identified according to the ELİSA kit providers’ instructions. Serum irisin levels were determined by Enzyme Linked Immunosorbent Assay (ELISA) kit (Cat.No.RAG018R, BioVendor-Laboratorni, USA).
Statistical analysis
The GraphPad (Version 5.0, GraphPad Prism Software Inc., San Diego, CA, USA) was used for the statistical analysis. Kruskal–Wallis test was used for the analysis of histological damage, followed by Dunn’s test as post-hoc test. All results are expressed as mean ± SEM. When statistical differences were analysed by one-way ANOVA followed by Tukey post-hoc Dunnett and Tukey test, P-value <0.05 was considered significant.
Results
As a result of the examination of haematoxylin & eosin staining under a light microscope: the liver of Control (Figure 1A) and GO (Figure 1B) groups were observed to have a normal appearance. In comparison to the Control group, the Diabetes control group (Figure 1C) revealed noticeable sinusoidal dilatation, oedema, haemorrhage (red arrow), degeneration in the hepatocytes (black arrow) and loss of normal architecture. In comparison to the Diabetes control group, the Diabetes+Garlic group (Figure 1D) showed a noticeable reduction in sinusoidal dilatation, oedema and haemorrhage (black star), while the hepatocytes appeared close to normal (black arrow).
Effect of GO on histological result in the liver of streptozotocin (STZ)-induced diabetic rats in various experimental groups. A: Control group; B: Control+GO, C: Diabetes group, D: Diabetes+GO. Red arrow: Haemorrhage, Black arrow: hepatocytes (haematoxylin and eosin were used for staining; scale bar: 50 μm).
As a result of examining the immunohistochemical staining process carried out for irisin immunoreactivity under a light microscope: irisin immunoreactivity was clearly seen in the hepatocytes (black arrow) in liver. The irisin immunoreactivity in liver was similar in the Control (Figure 2A) and the Control+GO (Figure 2B) groups. In comparison to the Control group, the irisin immunoreactivity in the Diabetes group (Figure 2C) was significantly reduced (P < 0.001). In comparison to the Diabetes group, the irisin immunoreactivity in Diabetes+Garlic group (Figure 2D) was significantly increased (P < 0.05). Histoscore of irisin immunoreactivity was shown in Figure 2E.
Irisin immunoreactivity in the liver tissues. A: Control group, B: Control+GO, C: Diabetes group, D: Diabetes+GO, the comparison of irisin (arrows, hepatocyte, and arrow heads sinusoidal cells, scale bar: 50 μm). aP < 0.001 Significant compared to the control group, b(P < 0.05) Significant compared to the diabetes control group.
p38 immunoreactivity was observed in the liver as shown in Figure 4. Upon intergroup comparison, similar p38 positivity was observed at liver from the Control and the Control+GO groups (P > 0.05). On the other hand, the statistically significant increase in p38 positivity in the diabetes group was remarkable compared with the control group (P < 0.01). In contrast to diabetes group, positivity of cleaved P38 decreased in the Control+GO group in a significant manner P < 0.05).
Effect of GO on PGC-1α, FNDC5, FBG, Irisin, TNF-α and p38. The results are expressed as means ± SDs. (A) PGC-1α mRNA levels in the liver; (B) FNDC5 mRNA levels in the liver; (C) FBG; (D) serum irisin concentration; (E) TNF-α mRNA levels in the liver and (F) p38 mRNA levels in the liver. a(P < 0.05) Significant compared to the control group, b(P < 0.05) Significant compared to the diabetes control group, c(P < 0.001) Significant compared to the control group, d(P < 0.01) Significant compared to the diabetes control group.
The STZ-induced diabetes caused by a significant decrease of FNDC5 (Figure 3A) and PGC-lα (Figure 3B) expression in liver by about 50.5% and 35% compared with that of the controls. In comparison to the Control group, FNDC5 (P < 0.001) and PGC-lα (P < 0.05) expression levels were significantly lower in the liver of the Diabetes. Meanwhile, the expression level of FNDC5 and PGC 1α was shown significantly higher in the Diabetes + Go group compared to the Diabetes control group (P < 0.05) (Figure 3A and B).
P38 immunoreactivity in the liver tissues. A: Control group, B: Control+GO, C: Diabetes group, D: Diabetes+GO; the comparison of p38 (arrows, hepatocyte, and arrow heads sinusoidal cells, scale bar: 50 μm). aP < 0.01 Significant compared to the control group, bP < 0.05 Significant compared to the diabetes control group.
The effect of GO on the levels of mRNA expression of the P38 and TNF-α in liver tissues of normal and experimental groups of rats was investigated. The levels of P38 and TNF-α were enhanced significantly in STZ-induced diabetic rats compared to the normal control (P < 0.001). However, treatment with GO significantly ameliorated these mRNA expressions to near normality, compared to diabetic group (P < 0.01; Figure 3E and F).
Furthermore, FBG was significantly increased (P < 0.001) at the diabetic groups, after 6 weeks of STZ injection (312.4 ± 24.61 mg/dl) compared to the Control group (101 ± 4.9 mg/dl). In addition, the diabetes control group demonstrated a significant reduction in the irisin levels compared to the Control group (P ˂ 0.001). FBG levels of rats in the Diabetes + GO group were lower than rats in the Diabetes group rat (P ˂ 0.01; Figure 3C). Meanwhile, the serum irisin levels in the Diabetes + GO group were significantly higher than in the Diabetes Control group (P < 0.05; Figure 3C).
Results indicated that S-TAS and L-TAS decreased significantly (P < 0.05) in Diabetes Control group, compared to the Control group (P < 0.05). However, there was no statistical (P > 0.05) difference observed between the S-TAS and L-TAS activities of the Control+GO and Control group rat. Treatment with GO significantly reversed the elevated TAS and decreased TOS content in both liver and serum (P < 0.05; Table 1).
Data of investigated parameters in various rat groups
| Groups | S-TAS (mmol/l) | S-TOS (mmol/l) | L-TAS (mmol/mg) | L-TOS (mol/mg) | Initial body weight (g) | Final body weight (g) |
|---|---|---|---|---|---|---|
| Control | 1.81 ± 0.043 | 15.58 ± 2.32 | 0.12 ± 0.02 | 0.45 ± 0.02 | 275.5 ± 15.1 | 300.5 ± 17.2 |
| Control +GO | 1.82 ± 0.071 | 16.33 ± 1.09 | 0.14 ± 0.04b | 0.44 ± 0.08 | 278.5 ± 15.7 | 306.7 ± 12.1 |
| Diabet control | 0.865 ± 0.091a | 21.33 ± 4.65a | 0.06 ± 0.01a | 0.68 ± 0.05a | 274.8 ± 18.3 | 210.8 ± 12.2c |
| Diabet+G0 | 1.270 ± 0.125b | 17.56 ± 1.93b | 0.09 ± 0.02b | 0.51 ± 0.04b | 272.7 ± 14.8 | 265.8 ± 13.8b |
| Groups | S-TAS (mmol/l) | S-TOS (mmol/l) | L-TAS (mmol/mg) | L-TOS (mol/mg) | Initial body weight (g) | Final body weight (g) |
|---|---|---|---|---|---|---|
| Control | 1.81 ± 0.043 | 15.58 ± 2.32 | 0.12 ± 0.02 | 0.45 ± 0.02 | 275.5 ± 15.1 | 300.5 ± 17.2 |
| Control +GO | 1.82 ± 0.071 | 16.33 ± 1.09 | 0.14 ± 0.04b | 0.44 ± 0.08 | 278.5 ± 15.7 | 306.7 ± 12.1 |
| Diabet control | 0.865 ± 0.091a | 21.33 ± 4.65a | 0.06 ± 0.01a | 0.68 ± 0.05a | 274.8 ± 18.3 | 210.8 ± 12.2c |
| Diabet+G0 | 1.270 ± 0.125b | 17.56 ± 1.93b | 0.09 ± 0.02b | 0.51 ± 0.04b | 272.7 ± 14.8 | 265.8 ± 13.8b |
a P < 0.05 Significant compared to the control group, bP < 0.05 Significant compared to the diabetes control group, cP < 0.001 Significant compared to the control group.
L-TAS, total antioxidant status in liver; L-TOS, total oxidant status in liver; S-TAS, serum total antioxidant status; S-TOS, serum total oxidant status.
Data of investigated parameters in various rat groups
| Groups | S-TAS (mmol/l) | S-TOS (mmol/l) | L-TAS (mmol/mg) | L-TOS (mol/mg) | Initial body weight (g) | Final body weight (g) |
|---|---|---|---|---|---|---|
| Control | 1.81 ± 0.043 | 15.58 ± 2.32 | 0.12 ± 0.02 | 0.45 ± 0.02 | 275.5 ± 15.1 | 300.5 ± 17.2 |
| Control +GO | 1.82 ± 0.071 | 16.33 ± 1.09 | 0.14 ± 0.04b | 0.44 ± 0.08 | 278.5 ± 15.7 | 306.7 ± 12.1 |
| Diabet control | 0.865 ± 0.091a | 21.33 ± 4.65a | 0.06 ± 0.01a | 0.68 ± 0.05a | 274.8 ± 18.3 | 210.8 ± 12.2c |
| Diabet+G0 | 1.270 ± 0.125b | 17.56 ± 1.93b | 0.09 ± 0.02b | 0.51 ± 0.04b | 272.7 ± 14.8 | 265.8 ± 13.8b |
| Groups | S-TAS (mmol/l) | S-TOS (mmol/l) | L-TAS (mmol/mg) | L-TOS (mol/mg) | Initial body weight (g) | Final body weight (g) |
|---|---|---|---|---|---|---|
| Control | 1.81 ± 0.043 | 15.58 ± 2.32 | 0.12 ± 0.02 | 0.45 ± 0.02 | 275.5 ± 15.1 | 300.5 ± 17.2 |
| Control +GO | 1.82 ± 0.071 | 16.33 ± 1.09 | 0.14 ± 0.04b | 0.44 ± 0.08 | 278.5 ± 15.7 | 306.7 ± 12.1 |
| Diabet control | 0.865 ± 0.091a | 21.33 ± 4.65a | 0.06 ± 0.01a | 0.68 ± 0.05a | 274.8 ± 18.3 | 210.8 ± 12.2c |
| Diabet+G0 | 1.270 ± 0.125b | 17.56 ± 1.93b | 0.09 ± 0.02b | 0.51 ± 0.04b | 272.7 ± 14.8 | 265.8 ± 13.8b |
a P < 0.05 Significant compared to the control group, bP < 0.05 Significant compared to the diabetes control group, cP < 0.001 Significant compared to the control group.
L-TAS, total antioxidant status in liver; L-TOS, total oxidant status in liver; S-TAS, serum total antioxidant status; S-TOS, serum total oxidant status.
Control group showed an important elevation in body weight at the end of 6 weeks (P < 0.001), as compared to the start of the experiment. A significant decrease in the body weight of rat in Diabetes Control group was observed from day 21 onwards.
The body weights of the Control+GO and the Diabetes+GO groups sustained unchanged (Table 1).
Discussion
STZ-induced hyperglycaemia in experimental animals is regarded as valid and successful model for a preliminary research of active natural components for diabetes and its complications. STZ enters into the cells through glucose transporter 2 (GLUT2) and it damages DNA due to the alkylation form of STZ. In addition, STZ binds to GLUT2 causes cell dysfunction by affecting cytotoxic on β-cells of pancreas. Based on all of these, both plasma insulin concentration and insulin secretion rate are significantly reduced depends on detention of insulin secretion, stimulated with glucose, and results in hyperglycaemia. Persistent hyperglycaemia causes diabetic complications that can affect all organs, including kidney, heart and liver, accelerating the generation and accumulation of reactive oxygen species (ROS) [19] (Figure 5).
Concept map showing diabetes mechanism and treatment strategies of GO on diabetic liver. The red arrows show how some important parameters change in diabetes. Blue arrows show how the treatment strategies of GO in diabetes. cAMP, cyclic adenosine monophosphate; MAPK, mitogen activated protein kinase; Nrf2, Nuclear factor erythroid 2-related factor 2; NF-κB, nuclear factor kappa B; TNF-α, tumour necrosis factor-α; GLUT4, Glucose transporter type 4; PGC-1, Peroxisome proliferator activated receptor γ coactivator; FNDC5, fibronectin type III domain containing 5; UCP 1, Uncoupling protein 1.
Liver is an important organ that constitutes approximately 2% of the body weight where several complicated metabolic events take place. Liver is responsible for the metabolism of carbohydrates, proteins, fats, steroids, toxins and drugs. Disruption of liver functions slows down the progress of these metabolic events and leads to several serious complications. In recent times, it has been known that liver dysfunctions increase the likelihood of diabetes. That is why protecting the health of the liver carries vital importance. Diabetes is a significant metabolic disease which affects several organs and tissues including the liver in addition to its complications such as neuropathy, nephropathy and retinopathy. While there are several underlying causes of diabetes, the general mechanism of action of diabetes include insulin resistance causing hyperglycaemia, in which way it may lead to non-alcoholic fatty liver disease by affecting the lipid, carbohydrate and protein metabolism. This in turn may lead to disorders that may go as far as non-alcoholic steatohepatitis and finally hepatocellular carcinomas.[20] In addition to this, the diabetes mechanism that conduces to liver damage is the integration of elevated oxidative stress and abnormal inflammatory response, and this activates the proapoptotic genes transcription and harms the hepatocytes (Figure 5).
While the World Health Organization[21] reported that some plants such as fenugreek, Ginseng species, bitter squash, onion and garlic may be used in alternative therapy for this health problem; there are several gaps that need explanation regarding the nature of the effect mechanisms of these plants. The most prominent ones among these plants are garlic and its extracts. Garlic is known to have a hepatoprotective effect by elevating the efficiency of antioxidant enzymes and decreasing the concentration of liver enzymes and ROS in studies on both human and animals. Furthermore, anti-inflammatory, immunomodulatory and liver regeneration capacities, the GO suppresses apoptosis in hepatocytes and the secretion of liver enzymes (ALT, AST and ALP).[22] It is proposed that the hypoglycaemic effect of garlic may originate from release of bonded insulin from β-cells or an increase in insulin sensitivity.[3] In another view, it was suggested that the allicin contained by garlic may increase insulin by bonding with compounds like cysteine that can separate insulin from -SH group reactions.[23] As another mechanism, it was reported that garlic, which contains compounds with antioxidant effects such as S-Allyl cysteine sulfoxide (allicin), increases the glutathione peroxidase and catalase amounts, while SACS (S-Allyl Cysteine Sulfoxide) increases the amount of insulin by stimulating its secretion from β-cells.[17]
The decrease in body weight is an indicator of the impairment of the health status of the rat. In this study, STZ-induced diabetic rats demonstrated an important reduction in body weight compared to control rats. Many studies show that the reason may be dehydration due to the excretion of increased blood sugar in the blood because of insulin deficiency, which prevents glucose entry into the cell and thus increases the percentage of glucose in the blood. On the other hand, in the STZ-induced diabetic rat, garlic has been demonstrated to prevent muscle mass loss, increase GLUT4 expression and improve glucose tolerance, insulin sensitivity.[24] Our results show that GO significantly improved health status and body weight in rats treated with GO as previous reports.[24, 25]
In this study, we observed that diabetes control group significantly increased the FBG levels compared with the control group. GO treatment caused a significant decrease in FBG level comparing with diabetic control group. In previous studies, it was reported that in the STZ-induced diabetes rat model, containing most of the Allyl methyl sulfide components, it stimulates the secretion of insulin in GO pancreatic β cells and increases glucose uptake by increasing insulin sensitivity. It has also been reported that the high levels of blood glucose in STZ-induced diabetic rats is due not only to low glucose utilization but also to increased hepatic glucose. In parallel with the present study, it has been reported in studies that GO and its Allyl methyl sulfide components have been healed after administration to experimental diabetic rats, and the cells, preserved insulin levels in the circulatory system and reduced diabetes-induced hyperglycaemia.[3, 25]
The potential antioxidant effect of GO is accredited to the existence of organo-sulfur components that regulate GST and glutathione. Diallyl trisulfide, allyl methyl sulfur (cathryli), organosulfur compound S-allyl cysteine found in GO have an ameliorative effect on ROS activity in diabetic liver.[25–27] In addition, important findings were obtained in the experimental diabetes model such as normalization of lipid peroxides and inhibition of thiobarbituric reagents in liver tissue, and reduction of lipid peroxidation as malondialdehydes.[6] As previously reported in many studies,[3, 22, 28–31] in this study, GO has been found to regulate TAS/TOS balance that impaired due to diabetes in both serum and liver tissue. This result is in accordance with previous reports in which the administration of GO reduced hepatic damage by restoring the activities of enzyme and scavenging free radicals in oxidative stress.
It was reported that in cells exposed to stress, JNK, ERK1/2 and p38 MAPK and MAPK inhibitors activated MAPK pathways eliminated cytotoxicity and decreased ROS activity. Thus, induced apoptosis may effectuate MAPK activation through ROS production.[32] Potential antidiabetic, antioxidant and anti-apoptotic components or agents have a therapeutic effect by suppressing ERK and p38 phosphorylation with their hypoglycaemic effect.[33, 34] In furtherance to the present study, Je-Won et al. showed that GO reduces ROS-mediated hepatocellular apoptotic changes by inhibiting the phosphorylation of Erk1/2.[35]
NF-кB, Erk and p38, MAPK (mitogen-activated protein kinase) family associates, mediate extracellular signal transduction in mammalian cells and phosphorylation of MAPKs are central integrators in the development of hepatotoxicity, induced by inflammation, cytokines, apoptosis and oxidative stress.[32, 33] Considerable involvement of IL-1β, IL-6 and tumour necrosis factor-α (TNF-α), pro-inflammatory cytokines, causes more accumulation of oxidative damage products in liver.[36, 37] P38 and ERK (extracellular signal-regulated kinases) pathway are TNF-activated MAP kinase pathways.[38] TNF-α plays a crucial role in managing apoptosis and inflammatory processes in diabetes and hepatic injury.[39] In addition, the main factor of persistence of proinflammatory cytokines in diabetic models is oxidative stress caused by hyperglycaemia.
Previous studies have indicated that GO and its components have an anti-inflammatory activity by suppressing IL-6 and TNF-α, increased with diabetes.[25, 40, 41] In this study, it was seen that GO is a very successful agent in inflammation that develops with diabetes.
On the other hand, it was demonstrated that FNDC5 deficiency reduced AMPK phosphorylation and consequently caused activation of mTOR and inhibition of fatty acid oxidation. Besides, the studies emphasized that there is a significant relationship between FNDC5 and TNF. For example, it has been stated that FNDC5 deficiency in obese mice increases the signalling of JNK and NF-κB and causes a high phosphorylation of ERK and p38 MAPK and MAPK signals may play an important act in mediating the useful effects of FNDC5 on insulin resistance of obese mice. Meanwhile, it has been reported that phosphorylation of p38-MAPK and NF-κBp65 is suppressed by FNDC5 in LPS-induced cell lines, and TNF-α and IL-1–5 production is reduced by FNDC5.[42] In our study, we are of the opinion that the diabetes-induced increased P38 and TNF-α expressions may be suppressed by GO, which contributes to the regulation of FNDC5.
Besides its role in adaptive thermogenesis, PGC-1α is a main promoter of mitochondrial biogenesis, including OXPHOS and ROS detoxification. Furthermore, PGC-1α is related with many inflammatory and metabolic diseases, and also it has been proved crucial role in regulating mitochondrial function, metabolic and oxidative stress pathways in many tissues and organs. Oxidative stress developing in relation to diabetes leads to disruption in the PGC-1α expression, regulates gene transcription, mitochondrial biogenesis and protein expression in the tissue such as muscles,[43] and liver tissue.[44, 45] It was also emphasized that the expression of this gene increases in population, has a family history of diabetes in comparison to those who do not, and it may be accepted as an indicator of tendency towards diabetes.[46] Although there are conflicting reports about the level of PGC-1α expression in the diabetic liver,[8] many studies on diabetes have indicated that PGC-1α mRNA in liver tissue was decreased in STZ-induced diabetic rat models [11, 44, 45, 47, 48] and OVE26 and the Akt2-KO transgenic diabetic mouse models,[49] as in this study. In addition to mild exercise,[8] the components from plants such as morin,[50] silibin,[51] metorfin[48] and also the extracts of Silymarin,[11]Spirulina platensis[48] and Mulberry leaf[52] have been found to have positive effects on PGC-1α mRNA expression in liver of rats with diabetes. In this study, it was seen that GO contributed significantly to the regulation of diabetes-induced PGC-1α mRNA expression in liver.
One of the significant finding in this study was the alteration in FNDC5 and irisin expression in the liver tissue. Irisin is a proteolytic product of the fibronectin type III domain 5 (FNDC5) molecule. The expression of the FNDC5 gene is increased with peroxisome proliferator-active receptor-y (PPARy) and its coactivator (PGC1). PPARy is known to be induced with exercise and form a crucial part of the muscle lamina that facilitates energy consumption. Meanwhile, it was reported that the irisin hormone derived out of FNDC5 phosphorylated intracellular p38 mitosis-activating kinases and activated extracellular signal-regulated kinases (ERK), therefore preventing obesity and Type 2 diabetes.[37, 43] And also, it was suggested that there is an adverse relationship between the levels of FNDC5/irisin and insulin sensitivity, and impairment in this balance can cause diabetes,[53] and low irisin levels in circulation lead to chronic kidney diseases [54] and non-alcoholic fatty liver.[55] Furthermore, a significant reduction in levels of FNDC5 has been indicated in both liver tissue [11] and serum [56] of diabetic rats. Additionally, it was reported that some plant extracts reversed the decrease in the FNDC5 gene expression in diabetic rat model [11, 56] and both healthy and high-fatty diet-induced obese mice.[57] In parallel to previous findings, also in this study, FNDC5 expression in the liver observed to decrease with diabetes. On the other hand, GO was seen to significantly regulate decreased irisin, FNDC5 levels. Futhermore, studies have shown that circulating irisin have been found low level in individuals with type-2 diabetes.[53] Zhang et al. showed that irisin induced the phosphorylation of ERK and P38 was gradually inhibited with rising concentrations the inhibitors of p38 and ERK and they concluded that the signalling pathways of p38 and ERK play a significant role in the irisin-stimulated occurrence of brown adipocytes.[37] Moreover, Chang et al. indicated that GO decreased the activated MAPKs (ERK1/2 and p38) pathway significantly in the diabetic rat heart.[35] We also investigated P38 expression in liver to confirm the irisin and MAPK relationship. The results have been supported the previous studies; GO, through many pathways, strengthens the belief that it regulates P38, increased due to diabetes, thus, the balance of FNDC5 and irisin will be provided.
In conclusion, the results of this study strongly suggest that GO provides p38, PGC-l α, FNDC5 and irisin regulation by maintaining the TAS/TOS and TNF-α balance and thus may be very useful to alleviate the complications of diabetic rat.
Acknowledgements
We would like to thank Dr. Akin Yigin (Harran university, department of genetic) to support us for evaluating the PCR analysis.
Author Contributions
N.E. and A.Y. designed the project studies and set the experimental animal models. A.T. and A.Y. conducted and analysed histopathological examinations and the results. A.K.Y. conducted the PCR analyses and M.C. analysed the biochemical data. This article was written by N.E., and all authors reviewed the manuscript. All authors approved the final manuscript.
Compliance With Ethical Standards
In this study, the animal research committee of Kahramanmaraş Sütçü Imam University approved the experimental protocols (2020/1–4).
Funding
This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.
Conflict of Interest
The authors declare no conflict of interest.
References
