Umbelliferone ameliorates oxidative stress and testicular injury, improves steroidogenesis and upregulates peroxisome proliferator-activated receptor gamma in type 2 diabetic rats

Abstract

Objectives

Diabetes mellitus (DM) is a chronic disease associated with serious complications, including male infertility. Umbelliferone (UMB) is a coumarin with promising antioxidant, anti-inflammatory and other beneficial effects. This study investigated the ameliorative effect of UMB against testicular injury, oxidative stress and altered steroidogenesis in rats with type 2 DM.

Methods

Rats received a high fat diet for 4 weeks followed by a single injection of streptozotocin. Diabetic rats were treated with UMB or pioglitazone (PIO) for 6 weeks and samples were collected for analysis.

Key findings

Diabetic rats exhibited hyperglycemia, insulin resistance and dyslipidemia associated with increased serum pro-inflammatory cytokines, and decreased gonadotropins and testosterone. UMB significantly ameliorated metabolic alterations, decreased pro-inflammatory cytokines, and increased gonadotropins and testosterone levels. UMB prevented testicular injury, suppressed lipid peroxidation and nitric oxide and increased antioxidants in diabetic rats. In addition, UMB upregulated testicular gonadotropins receptors, steroidogenesis markers (steroidogenic acute regulatory protein, cytochrome P450 family 17 subfamily A member 1 [CYP17A1], 3β-hydroxysteroid dehydrogenase [3ß-HSD] and 17ß-hydroxysteroid dehydrogenase [17ß-HSD]), and peroxisome proliferator-activated receptor gamma (PPARγ) expression.

Conclusions

UMB prevents testicular injury by preventing metabolic alterations, suppressing oxidative damage and inflammation, and boosting antioxidant defenses in diabetic rats. UMB enhanced pituitary-gonadal axis and steroidogenesis and upregulated testicular PPARγ in diabetic rats. Thus, UMB may represent a protective agent against testicular injury and sexual dysfunction associated with chronic hyperglycemia.

hyperglycemia, insulin resistance, testosterone, gonadotropins, oxidative stress, PPARs

Introduction

Diabetes mellitus (DM) is a metabolic disease characterized by chronic hyperglycemia. Type 2 DM is the most prevalent form of the disease and the number of diabetic patients is expected to reach 693 million by 2045.^[1] According to the International Diabetes Federation (IDF), type 2 DM is a fast-growing health problem in Egypt and the prevalence is around 15.2 % in adults.^[2] Insulin resistance, as well as hyperglycemia resulted from the progressive loss of pancreatic β-cell function, represent the main features of T2DM.^[3] Uncontrolled hyperglycemia can cause several complications and organ damage, including impaired male fertility and sexual function.^[4–6] In diabetic men, erectile dysfunction is a common but underestimated complication and its global prevalence has been estimated to reach 322 million by 2025.^[7] The negative impact of T2DM on the pituitary-gonadal axis has been previously demonstrated in animal models^[8] and patients with T2DM showed reduced serum gonadotropins and testosterone.^[9] In addition, several studies have shown testicular injury, reproductive impairment, altered spermatogenesis and DNA damage in diabetic animals.^{[8, 10–13]} The role of hyperglycemia-mediated oxidative stress and inflammation in provoking testicular injury and dysfunction has been well-acknowledged.^[10–13] The testicular tissue has a high metabolic rate and is therefore vulnerable to the deleterious effects of reactive oxygen species (ROS) and oxidative stress.^[14] Besides excessive ROS, inflammation is implicated in chronic hyperglycemia-mediated tissue injury and pro-inflammatory cytokines have been reported to increase diabetes and insulin resistance.^[15–17] Therefore, management of hyperglycemia and its associated oxidative stress and inflammatory responses can attenuate testicular dysfunction and ameliorate tissue injury.

Peroxisome proliferator-activated receptor gamma (PPARγ), a transcription factor that belongs to the steroid receptor superfamily, is highly expressed in adipose tissue. PPARγ is involved in a variety of cellular functions such as adipocyte differentiation and plays a role in modulating glucose and lipid metabolism.^[18] Activation of PPARγ improved insulin sensitivity, ameliorated hyperglycemia and dyslipidemia, decreased lipid accumulation, and suppressed oxidative stress and inflammation.^[19–22] In animal models of hepatotoxicity, fibrosis and carcinogenesis, upregulation of PPARγ has been shown to attenuate ROS generation and ameliorate oxidative tissue damage.^[23–25] Treatment of diabetic rats with the PPARγ agonist pioglitazone (PIO) increased serum gonadotropins and testosterone and prevented testicular oxidative stress and DNA fragmentation.^[8] PPARγ has been demonstrated to link reproduction and energy metabolism in obesity/insulin resistance-associated male infertility.^[26] In the testis, PPARγ is expressed in Sertoli cells^[27] where it upregulates lipid metabolic target genes and provide energy for spermatogenesis.^[28] These findings support the beneficial role of PPARγ activation in ameliorating, not only insulin resistance, hyperglycemia and dyslipidemia, but also testicular dysfunction and altered steroidogenesis and spermatogenesis.

Umbelliferone (UMB), also known as 7-hydroxycoumarin, is a natural coumarin that occurs widely in plants belonging to the family Umbelliferae such as cumin, fennel, celery, angelica, asafoetida, parsley alexanders and giant hogweed.^[29] UMB possesses a variety of pharmacological activities, including in vivo antioxidant and anti-inflammatory effects.^{[30, 31]} Our previous work has demonstrated the ability of UMB to attenuate cellular oxidative stress and inflammation induced by different toxic compounds.^{[23, 25, 32]} UMB boosted the antioxidant defensive mechanisms and upregulated hepatic PPARγ expression.^{[23, 25]} Naowaboot et al have reported an increase in adipose tissue PPARγ in diabetic rats treated with UMB.^[33] Therefore, UMB possesses antioxidant and anti-inflammatory activities that could help to attenuate testicular injury in diabetes. The beneficial effect of UMB on testicular injury in diabetic rats has not been investigated yet. The current study investigated the protective effect of UMB against testicular oxidative stress, and pituitary-gonadal axis and steroidogenesis impairment in T2DM induced by high fat diet (HFD) and streptozotocin (STZ) in rats, pointing to the possible involvement of PPARγ.

Materials and Methods

Chemicals and reagents

STZ and UMB with purity of over 98% were purchased from Sigma (USA). trichloroacetic acid (TCA), pyrogallol, reduced glutathione (GSH), 5,5′-dithiobis-2-nitrobenzoic acid (DTNB), Griess reagent, malondialdehyde (MDA) and hydrogen peroxide (H₂O₂) of purity over 98% were supplied by Sigma (USA). All other chemicals, assay kits and antibodies were purchased either from Sigma or other standard commercial suppliers.

Experimental animals and induction of T2DM

Age matched male Wistar rats, weighing 150–160 g, obtained from Vacsera (Giza, Egypt), were housed under standard conditions for one week before starting the experiment. All animal experiments and procedures were approved by the local Animal Care and Use Committee of Beni-Suef University (2016/6/120). The animals were housed in standard cages (four rats/cage) under standard laboratory conditions. After acclimatization, the animals were allocated into two dietary regimens consisting of a normal pellet diet (NPD) and HFD (58% fat, 17% carbohydrate and 25% protein)^[34]ad libitum. After 4 weeks, NPD-fed rats received a single intraperitoneal (i.p.) injection of citrate buffer (pH 4.5) whereas the HFD-fed rats received 35 mg/kg STZ dissolved in citrate buffer.^[34] The animals were fasted overnight an day 7 and received 3 g/kg glucose orally. Blood was collected from the tail vein for glucose determination using Spinreact reagent kit (Spain),^[35] and rats having levels ≥250 mg/dl were selected for further investigations. The control and HFD/STZ-induced rats were allocated into 4 groups (n = 6) as follows:

Group I (Control): received 0.5% carboxymethylcellulose (CMC) orally for 6 weeks.

Group II (Diabetic): received 0.5% CMC orally for 6 weeks.

Group III (Diabetic + PIO): received 10 mg/kg PIO.^[8]

Group IV (Diabetic + 50 mg/kg UMB): received 50 mg/kg UMB.^[25]

UMB and PIO were dissolved in 0.5% CMC and supplemented orally for 6 weeks. Groups I and II received 0.5% CMC orally for 6 weeks. Thereafter, overnight fasted rats have sacrificed under thiopental (Eipico, Egypt) anaesthesia. Blood samples were collected on EDTA for glycated haemoglobin (HbA1c) assay and others were used for serum preparation. The testes were excised, washed in ice-cold phosphate-buffered saline (PBS) and samples were stored at −80°C whereas others were fixed in Bouin’s solution overnight.

Assessment of insulin sensitivity

Serum insulin was assayed using a specific ELISA kit (RayBiotech, USA) and homeostasis model of insulin resistance (HOMA-IR)^[36] and quantitative insulin sensitivity check index (QUICKI) was calculated according to the equations:

$${\displaystyle \begin{array}{l}{\displaystyle \mathrm{H}\mathrm{O}\mathrm{M}\mathrm{A}-\mathrm{I}\mathrm{R}=\frac{\mathrm{F}\mathrm{a}\mathrm{s}\mathrm{t}\mathrm{i}\mathrm{n}\mathrm{g}\mathrm{i}\mathrm{n}\mathrm{s}\mathrm{u}\mathrm{l}\mathrm{i}\mathrm{n}\left(\frac{\mu \mathrm{U}}{\mathrm{m}\mathrm{l}}\right)\times \mathrm{F}\mathrm{a}\mathrm{s}\mathrm{t}\mathrm{i}\mathrm{n}\mathrm{g}\mathrm{g}\mathrm{l}\mathrm{u}\mathrm{c}\mathrm{o}\mathrm{s}\mathrm{e}\left(\frac{\mathrm{m}\mathrm{m}\mathrm{o}\mathrm{l}}{\mathrm{L}}\right)}{22.5}}\end{array}}$$

$${\displaystyle \begin{array}{l}{\displaystyle \mathrm{Q}\mathrm{U}\mathrm{I}\mathrm{C}\mathrm{K}\mathrm{I}=\frac{1}{\mathrm{l}\mathrm{o}\mathrm{g}\mathrm{f}\mathrm{a}\mathrm{s}\mathrm{t}\mathrm{i}\mathrm{n}\mathrm{g}\mathrm{i}\mathrm{n}\mathrm{s}\mathrm{u}\mathrm{l}\mathrm{i}\mathrm{n}(\mu U/\mathrm{m}\mathrm{l})+\mathrm{l}\mathrm{o}\mathrm{g}\mathrm{f}\mathrm{a}\mathrm{s}\mathrm{t}\mathrm{i}\mathrm{n}\mathrm{g}\mathrm{g}\mathrm{l}\mathrm{u}\mathrm{c}\mathrm{o}\mathrm{s}\mathrm{e}(\mathrm{m}\mathrm{m}\mathrm{o}\mathrm{l}/\mathrm{L})}}\end{array}}$$

Determination of haemoglobin, sex hormones and cytokines

Blood HbA1c% was determined using Biosystems (Spain) kit, and serum TNF-α and IL-6 were assayed using R&D Systems (USA) ELISA kits. Testosterone and gonadotropins (luteinizing hormone (LH) and follicle-stimulating hormone (FSH)) were determined in serum using Cusabio (China) and Novus Biologicals (USA) ELISA kits, respectively.

Determination of serum lipids

Triglycerides (TG), total cholesterol (TC) and high-density lipoprotein (HDL) cholesterol were determined following the instructions of Spinreact (Spain). Very low-density lipoprotein cholesterol (vLDL-C) and LDL-C were determined using the equations:

$${\displaystyle \begin{array}{l}{\displaystyle \mathrm{v}\mathrm{L}\mathrm{D}\mathrm{L}.\mathrm{C}=\mathrm{T}\mathrm{G}/5}\end{array}}$$

$${\displaystyle \begin{array}{l}{\displaystyle \mathrm{L}\mathrm{D}\mathrm{L}.\mathrm{C}=\mathrm{T}\mathrm{C}-(\mathrm{H}\mathrm{D}\mathrm{L}.\mathrm{C}+\mathrm{v}\mathrm{L}\mathrm{D}\mathrm{L}.\mathrm{C})}\end{array}}$$

Determination of lipid peroxidation, NO and antioxidants

Samples from the testis were homogenized (10% w/v) in Tris–HCl buffer (pH 7.4), centrifuged and the clear supernatant was used for the assay of lipid peroxidation (LPO),^[37] NO,^[38] reduced glutathione (GSH),^[39] superoxide dismutase (SOD)^[40] and glutathione peroxidase (GPx).^[41]

Histopathological examination

Samples from the testis were fixed overnight in Bouin’s solution, dehydrated and processed for paraffin wax embedding. Five-μm sections were cut from the paraffin blocks using microtomy and then stained with hematoxylin and eosin (H&E).

Gene expression analysis

The gene expression levels of PPARγ, FSH receptor (FSHR), LH receptor (LHR), 3β-hydroxysteroid dehydrogenase (3β-HSD), 17β-HSD, steroidogenic acute regulatory protein (StAR) and cytochrome P450 family 17 subfamily A member 1 (CYP17A1) were determined using qRT-PCR. In brief, RNA was extracted from the frozen testicular tissue samples using TRIzol (Invitrogen, USA) and its quantity was determined by measuring the absorbance at 260 nm. RNA samples with A260/A280 nm ≥1.8 were selected for the synthesis of cDNA which was then amplified using QuantiFast SYBR Green RT-PCR kit (Qiagen, Germany) and primers in Table 1. The obtained results were analyzed using the 2^ΔΔCt method^[42] and normalized to β-actin.

Table 1

Primers used for qRT-PCR

Gene	GenBank accession number	Forward primer (5′-3′)	Reverse primer (5′-3′)
StAR	XM_032918521.1	CCCAGATAGAGTTCGCCAGC	TGGTGGGCAGTCCTTAACAC
CYP17A1	XM_006231434.3	TCAGTGACTGTGACCTGGGA	GTGGAGCGGAGCAACTTCAA
3β-HSD	XM_032897642.1	TGTGCCAGCCTTCATCTAC	CTTCTCGGCCATCCTTTT
17β-HSD	NM_054007.1	GACCGCCGATGAGTTTGT	TTTGGGTGGTGCTGCTGT
FSHR	XM_032908630.1	ATTCTTGGGCACGGGATCTG	CGGTCGGAATCTCTGTCACC
LHR	NM_012978.1	GGCACACCATCACCTATGCT	AAAAGAGCCATCCTCCGAGC
PPARγ	NM_001145367.1	GGACGCTGAAGAAGAGACCTG	CCGGGTCCTGTCTGAGTATG
β-actin	XM_032887061.1	AGGAGTACGATGAGTCCGGC	CGCAGCTCAGTAACAGTCCG

StAR: steroidogenic acute regulatory protein. CYP17A1: cytochrome P450 family 17 subfamily A member 1. 3β-HSD: 3β-hydroxysteroid dehydrogenase. 17β-HSD: 17β-hydroxysteroid dehydrogenase.

Western blotting

The expression of PPARγ was determined in testicular tissue as we previously reported.^[43] Protein concentration was measured in tissue samples homogenized in RIPA buffer using Bradford reagent.^[44] Fifty µg protein was subjected to 10% SDS/PAGE and transferred to a nitrocellulose membrane which was blocked for 1 h at room temperature in 5% skimmed milk dissolved in tris-buffered saline/tween 20 (TBST). The membrane was incubated with primary antibodies toward PPARγ and β-actin (Novus Biologicals, USA). After overnight incubation, the membrane was washed with TBST and incubated with the secondary antibodies, washed with TBST and then developed using an enhanced chemiluminescence detection kit (BIO-RAD, USA). The protein bands were scanned, and the band intensity was measured using ImageJ (NIH, USA).

Statistical analysis

The results were represented as mean ± standard error of the mean (SEM). The normality of the data was verified using Shapiro–Wilk normality test and one-way ANOVA and Tukey’s test were applied to compare groups using GraphPad Prism 7 (GraphPad Software, USA). A P value less than 0.05 was considered significant.

Results

Umbelliferone ameliorates hyperglycemia and insulin resistance in diabetic rats

Fasting and postprandial glucose levels and HbA1c% were assayed to evaluate the antihyperglycemic effect of UMB. HFD/STZ-induced rats exhibited significantly elevated fasting and postprandial blood glucose levels (Figure 1A; P < 0.001) and HbA1c% (Figure 1B; P < 0.001) when compared with the control rats. Treatment of the diabetic rats with UMB and PIO for 6 weeks significantly ameliorated hyperglycemia and HbA1c% (P < 0.001).

Figure 1

UMB ameliorates hyperglycemia and insulin resistance in diabetic rats. UMB and PIO decreased fasting and postprandial blood glucose (A), HbA1c% (B) and HOMA-IR (D), and increased serum insulin (C) and QUICKI (E). Data are mean ± SEM, (n = 6). *P < 0.05, **P < 0.01 and ***P < 0.001 versus control, and ^###P < 0.001 versus diabetic.

To assess the effect of UMB on insulin sensitivity, serum insulin was determined and HOMA-IR and QUICKI were calculated. HFD/STZ-induced rats showed a decrease in serum insulin (Figure 1C; P < 0.001), increased HOMA-IR value (Figure 1D; P < 0.001) whereas QUICKI (Figure 1E; P < 0.001) was decreased, indicating the development of insulin resistance. UMB and PIO significantly increased serum insulin and ameliorated insulin resistance in HFD/STZ diabetic rats (P < 0.001).

Umbelliferone attenuates dyslipidemia in diabetic rats

Diabetic rats exhibited dyslipidemia manifested by the markedly (P < 0.001) increased circulating TG, TC, LDL and vLDL, whereas HDL was significantly (P < 0.05) decreased when compared with the control rats as depicted in Figures 2A-E. Treatment with either UMB or PIO ameliorated TG, TC, LDL-C and vLDL-C levels and enhanced serum HDL-C.

Figure 2

UMB attenuates dyslipidemia in diabetic rats. UMB and PIO decreased serum triglycerides (A), total cholesterol (B), LDL-cholesterol (C) and vLDL-cholesterol (D) and increased HDL-cholesterol (E). Data are mean ± SEM, (n = 6). *P < 0.05, **P < 0.01 and ***P < 0.001 versus control, and ^#P < 0.05, ^##P < 0.01 and ^###P < 0.001 versus diabetic.

Umbelliferone alleviates pituitary-testicular axis and steroidogenesis in diabetic rats

To investigate the protective effect of UMB on diabetes-associated alterations in the pituitary-testicular axis and steroidogenesis, we determined serum levels of gonadotropins and testosterone (Figure 3), and the expression levels of FSH and LH receptors and the key enzymes involved in steroid hormone synthesis in the testis (Figure 3).

Figure 3

UMB alleviates pituitary-testicular axis in diabetic rats. UMB and PIO increased serum FSH (A), LH (B) and testosterone (C) in diabetic rats. Data are mean ± SEM, (n = 6). **P < 0.01 and ***P < 0.001 versus control, and ^#P < 0.05 and ^##P < 0.01 versus diabetic.

Serum levels of the gonadotropins FSH (Figure 3A) and LH (Figure 3B) as well as testosterone (Figure 3C) were significantly declined in HFD/STZ-induced rats when compared with the control rats (P < 0.001, P < 0.01 and P < 0.001, respectively). Treatment with UMB or PIO for 6 weeks increased serum gonadotropins and testosterone significantly.

Given the role of LH and FSH in steroid hormone synthesis and spermatogenesis,^[45] respectively, we evaluated the effect of diabetes on their receptors in the testis and the role of UMB (Figure 4). Both FSH-R (Figure 4A) and LH-R (Figure 4B) were down-regulated in diabetic rats (P < 0.001). UMB and PIO significantly increased the mRNA abundance of both receptors (P < 0.001). Similarly, diabetic rats exhibited a decrease in the expression of StAR (Figure 4C; P < 0.05), 3β-HSD (Figure 4D; P < 0.001), CYP17A1 (Figure 4E; P < 0.001) and 17β-HSD (Figure 4F; P < 0.001). Treatment with either UMB or PIO markedly increased the expression levels of these enzymes.

Figure 4

UMB enhances steroidogenesis in diabetic rats. UMB and PIO upregulated testicular FSHR (A), LHR (B), StAR (C), 3β-HSD (D), CYP17A1 (E) and 17β-HSD (F) in diabetic rats. Data are mean ± SEM, (n = 6). *P < 0.05 and ***P < 0.001 versus control, and ^#P < 0.05, ^##P < 0.01 and ^###P < 0.001 versus diabetic.

Umbelliferone prevents testicular injury in diabetic rats

Sections from the testicular tissue were examined to investigate the histological alterations in diabetic rats and the ameliorative effect of UMB and PIO. The control rats exhibited normal structure of the seminiferous tubules and spermatogonia (Figure 5A), whereas the diabetic rats exhibited degenerative changes and damage to spermatogonia (Figure 5B). Oral supplementation of PIO (Figure 5C) and UMB (Figure 5D) produced significant improvement in the histological architecture of the seminiferous tubules.

Figure 5

UMB prevents testicular injury in diabetic rats. Photomicrographs of testicular tissue sections of (A) control showing the normal structure of the seminiferous tubules, (B) diabetic rats revealing degenerative changes (arrows), and (C&D) diabetic rats treated with PIO (C) and UMB (D) showing remarkable improvement of the histological architecture of seminiferous tubules. (H&E, X400) (Scale bar = 100 µm).

Umbelliferone suppresses testicular oxidative stress in diabetic rats

The ameliorative effect of UMB on hyperglycemia-mediated oxidative stress was assessed by measuring MDA (Figure 6A), NO (Figure 6B) and the antioxidants GSH (Figure 6C), SOD (Figure 6D) and GPx (Figure 6E). Testicular MDA and NO were increased in diabetic rats, whereas GSH, SOD and GPx were significantly decreased when compared with the control rats (P < 0.001). Both treatment agents (PIO and UMB) ameliorated testicular MDA and NO, and boosted antioxidant defences.

Figure 6

UMB suppresses testicular oxidative stress in diabetic rats. UMB and PIO decreased testicular LPO (assayed as malondialdehyde (MDA)) (A) and NO (B), and increased GSH content (C), SOD (D) and GPx (E) in diabetic rats. Data are mean ± SEM, (n = 6). *P < 0.05 and ***P < 0.001 versus control, and ^#P < 0.05, ^##P < 0.01 and ^###P < 0.001 versus diabetic.

Umbelliferone attenuates inflammatory cytokines production in diabetic rats

Given the role of inflammation in provoking insulin resistance and tissue injury under hyperglycemia,^{[16, 46]} serum TNF-α (Figure 7A) and IL-6 (Figure 7B) were determined to evaluate the ameliorative effect of UMB. Diabetic rats showed significant elevation in TNF-α and IL-6 (P < 0.001) when compared with the control rats, an effect that was reversed by UMB and PIO (P < 0.001).

Figure 7

UMB attenuates inflammation in diabetic rats. UMB and PIO decreased serum TNF-α (A) and IL-6 (B) in diabetic rats. Data are mean ± SEM, (n = 6). ***P < 0.001 versus control and ^###P < 0.001 versus diabetic.

Umbelliferone upregulates testicular peroxisome proliferator-activated receptor gamma in diabetic rats

Both mRNA and protein expression of testicular PPARγ showed a significant decrease in diabetic rats when compared with the non-diabetic animals (P < 0.001) as represented in Figure 8. UMB and PIO significantly upregulated testicular PPARγ gene and protein levels (P < 0.001).

Figure 8

UMB upregulates testicular PPARγ in diabetic rats. UMB and PIO increased testicular PPARγ gene (A) and protein (B) expression in diabetic rats. Data are mean ± SEM, (n = 6). **P < 0.01 and ***P < 0.001 versus control, and ^###P < 0.001 versus diabetic.

Discussion

Reproductive impairment is one of the deleterious complications of diabetes and many studies have demonstrated deteriorated sexual function and spermatogenesis in both diabetic humans and animals.^[4–6] Chronic hyperglycemia-mediated oxidative stress has been implicated in reproductive impairment, altered spermatogenesis and DNA damage.^{[8, 11]} Therefore, the management of hyperglycemia and oxidative stress could represent an effective strategy against sexual dysfunction in diabetes. In this context, UMB has shown an anti-hyperglycemic effect in type 1^{[47, 48]} and type 2 diabetic rats.^[33] We have previously reported the protective effect of UMB against hepatic and cerebral oxidative stress^{[23, 25, 32]} and testicular ischemia/reperfusion (I/R) injury.^[49] However, the effect of UMB on testicular injury and steroidogenesis in diabetic rats has not been reported yet. Herein, we evaluated the beneficial effect of UMB against testicular injury, oxidative stress and pituitary-testicular axis and steroidogenesis impairment, pointing to the possible role of PPARγ in diabetic rats.

HFD feeding followed by STZ administration resulted in hyperglycemia and insulin resistance, the main characteristic features of T2DM.^{[15, 43, 50]} Hyperglycemia was manifested by elevated fasting and postprandial blood glucose along with increased HbA1c%. HFD induces insulin resistance and several metabolic alterations,^[51] and STZ reduces insulin secretion by damaging β cells in the pancreatic islets.^[52] Accordingly, serum insulin and QUICKI value were decreased, whereas HOMA-IR was increased, demonstrating the development of insulin resistance and consequently hyperglycemia. Treatment with UMB ameliorated hyperglycemia and insulin resistance in diabetic rats. In type 1 diabetic rats, UMB exerted anti-hyperglycemic effects evidenced by decreased HbA1c levels, gluconeogenesis and glycogenolysis, and increased regeneration of the β cells, insulin release and liver glycogen.^{[47, 48]} In type 2 diabetic rats, treatment with UMB for 8 weeks reduced hyperglycemia and increased insulin secretion and the expression of hepatic glucose transporter (GLUT) 4 and adiponectin.^[33] Our findings added support to the potent anti-hyperglycemic and insulin-sensitizing activities of UMB. Additionally, UMB exerted an anti-dyslipidemic effect in HFD/STZ-induced rats in the present study. Dyslipidemia in diabetes is characterized mainly by hypertriglyceridemia along with elevated serum TC, LDL-C and vLDL-C.^{[53, 54]} Irrespective of insulin resistance or deficiency, hyperlipidemia and decreased HDL-C occur commonly in diabetes.^[55] UMB effectively ameliorated hyperlipidemia and enhanced HDL-C, effects that could be directly attributed to increased insulin secretion and sensitivity which promotes the storage of lipids in adipocytes. PPARγ upregulation might also have a key role in the anti-hyperlipidemic activity of UMB. Amelioration of lipid profile in diabetic rats treated with the PPARγ agonist PIO supported this notion. PIO increases insulin sensitivity, HDL-C and vLDL-TG clearance.^{[19, 20]} Moreover, UMB increased PPARγ expression in the liver of diabetic,^[33] and cyclophosphamide- and carbon tetrachloride (CCl₄)-intoxicated rats.^{[23, 25]}

Chronic hyperglycemia can disrupt hormones of the pituitary-testicular axis. Consistent with our previous observations,^[8] serum FSH, LH and testosterone levels were reduced and the mRNA transcripts of FSHR and LHR were declined. In patients with T2DM, serum gonadotropins and testosterone were decreased significantly,^[9] and similar findings were reported in STZ-induced T1DM in rodents.^{[13, 56]} The decreased testosterone levels in diabetic rats could be attributed to insufficient secretion of LH and/or reduced responsiveness of Leydig cells to LH which is supported by the downregulation of LHR. In addition, diabetes has been described to decrease the number of Leydig cells^{[11, 12]} through provoking oxidative stress and apoptosis.^[10] Accordingly, we have conducted a histological investigation and the data revealed damage to the testicular tissue in diabetic rats. UMB improved the pituitary-testicular axis as shown by increased serum gonadotropins and testosterone levels, upregulated LHR and FSHR mRNA transcripts, and ameliorated testicular histological architecture. Given the role of chronic hyperglycemia in sexual dysfunction, the beneficial effects of UMB could be explained as a direct consequence of the improved glycemia.

To further elucidate the mechanism underlying the improved steroidogenesis following treatment with UMB, we investigated the mRNA abundance of the key enzymes involved in testosterone synthesis. The expression of testicular StAR, CYP17A1, 3ß-HSD and 17ß-hydroxysteroid dehydrogenase (17ß-HSD) genes were downregulated in HFD/STZ diabetic rats. Besides the impaired release of gonadotropins both release and receptors, these findings demonstrate the negative impact of diabetes on male sexual function. StAR is a protein function to transport cholesterol into the inner mitochondrial membrane where steroidogenesis begins. The physiological rapid upsurge of steroidogenesis in response to the copious release of LH is mediated via StAR-promoted cholesterol transport.^[57] CYP17A1, 3ß-HSD and 17ß-HSD catalyze the downstream steps in the synthesis of testosterone from pregnenolone.^[57] Therefore, the suppression of StAR and enzymes controlling the rate-limiting steps of steroidogenesis represent the main culprit behind reduced testosterone in diabetic rats. UMB and PIO significantly upregulated testicular StAR, CYP17A1, 3ß-HSD and 17ß-HSD expression in diabetic rats, demonstrating their beneficial effects on steroidogenesis. In addition to the improvement of gonadotropins release and responsiveness, it is noteworthy mentioning that the insulin sensitizing effects of UMB and PIO play a key role in alleviating steroidogenesis in diabetic rats. Insulin has been reported to directly regulate steroidogenesis in testicular Leydig cells,^[58] whereas insulin resistance decreases testosterone secretion.^[59] However, the lack of data showing the effect of UMB on sperm motility in diabetic rats is considered a limitation of this study.

Oxidative stress and inflammation have been implicated in the pathogenesis of diabetes complications.^{[60, 61]} Therefore, we assumed that the antioxidant activity of UMB contributed to attenuating testicular dysfunction in diabetic rats. In this study, T2DM in rats was associated with increased testicular LPO and NO levels, and decreased GSH and enzymatic antioxidants. Similar findings have been reported in STZ-induced T1DM,^{[11, 13]} demonstrating that oxidative stress plays a role in diabetes-associated testicular injury. Although the cells are equipped with endogenous defences to neutralize ROS, these antioxidant defences have been reported to decline in chronic hyperglycemia. Excess ROS provoke LPO and increase NO generation via eliciting the expression of NF-κB-induced iNOS upregulation. NO can react with superoxide anions producing peroxynitrite that causes DNA fragmentation and exacerbates inflammation.^[62] Accordingly, DNA fragmentation has been demonstrated in the sperms collected from diabetic rats.^[11] NF-κB activation under oxidative stress conditions stimulates the expression and release of pro-inflammatory cytokines. Here, TNF-α and IL-6 were elevated in type 2 diabetic rats as we previously reported.^{[15, 43, 50]} Notably, inflammation has a negative impact on the male reproductive system of diabetic rodents.^{[8, 63]} HFD/STZ diabetic rats who received UMB exhibited a decrease in LPO, NO and inflammatory mediators, and enhanced testicular antioxidant defences. The antioxidant activity of UMB has been demonstrated in rat models of hepatotoxicity, hyperammonemia, lead-induced testicular injury^[64] and fibrosis.^{[23, 25, 32]} In the same studies, UMB suppressed NF-κB, iNOS and pro-inflammatory cytokines.^{[23, 25, 32]} The antioxidative and anti-inflammatory efficacies of UMB could be directly attributed to its ability to activate the nuclear factor erythroid-derived 2-like 2 (Nrf2),^[23] a transcription factor with a pivotal role in protecting the cells against oxidative stress.^[65] In addition, Nrf2 can suppress the activation of NF-ĸB and subsequently the release of pro-inflammatory cytokines.^{[66, 67]} Furthermore, we assumed that PPARγ activation might be involved in the protective effect of UMB against testicular injury in diabetes. This assumption was based on our previous work showing the ability of the PPARγ agonist PIO to ameliorate testicular injury in STZ/nicotinamide-induced diabetic rats^[8] and activation of PPARγ accompanied with suppressed oxidative damage and inflammation in rat models of hepatic injury and fibrosis treated with UMB.^{[23, 25]} Other investigators have shown increased expression of PPARγ in the adipose tissue of diabetic rats.^[33] The present study introduced new information that UMB can upregulate the gene and protein expression of testicular PPARγ. These findings demonstrated that activation of PPARγ is a central mechanism underlying the protective effect of UMB against testicular injury in diabetes. Activation of PPARγ increases insulin sensitivity and attenuates hyperglycemia and hyperlipidemia,^{[19, 20]} conferring protection against the deleterious effects of diabetes on the reproductive system. In Sertoli cells, PPARγ regulates the expression of key genes involved in lipid metabolism, thereby providing energy for spermatogenesis.^[28] Activation of PPARγ can also suppress oxidative stress and inflammation by inhibiting NF-κB activation and transcriptional control, IκBα degradation,^{[68, 69]} and NADPH oxidase-dependent ROS production,^[70] and increasing the expression of antioxidants.^[71]

In conclusion, this study introduces new information that UMB protects against testicular injury in T2DM. UMB ameliorated hyperglycemia, dyslipidemia and insulin resistance, and prevented testicular injury in HFD/STZ-induced diabetic rats. Treatment with UMB improved the pituitary-gonadal axis and steroidogenesis, and enhanced antioxidant defences. These beneficial effects are mediated via the antioxidant and anti-inflammatory activities of UMB along with upregulation of PPARγ and the rate-limiting steps of steroidogenesis. Therefore, UMB is a potentially beneficial agent in preventing testicular injury in diabetes, pending further investigations to explore other involved mechanisms. In addition, the similar mode of action of PIO and UMB holds a strong promise in the future use of the compound in the therapeutic management; however, further studies investigating the exact role of PPARγ in mediating the pharmacologic effects of UMB are needed.

Author contribution

Conceptualization, A.M.M.; methodology, A.M.M. and M.A.M.A.; validation, A.M.M.; formal analysis, A.M.M.; investigation, A.M.M. and M.A.M.A.; resources, A.A.K. and S.E.; data curation, A.M.M. and M.A.M.A.; writing—original draft preparation, A.M.M.; writing—review and editing, A.M.M.; visualization, A.M.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.

Conflict of interest

The authors declare that there are no conflicts of interest.

Data Availability

Data analyzed or generated during this study are included in this manuscript.