Abstract

Amino acids are the currency of nitrogen exchange between source and sink tissues in plants and constitute a major source of the components used for cellular growth and differentiation. The characterization of a new amino acid transporter belonging to the amino acid permease (AAP) family, AAP11, expressed in the perennial species Populus trichocarpa is reported here. PtAAP11 expression analysis was performed by semi-quantitative RT-PCR and GUS activity after poplar transformation. PtAAP11 function was studied in detail by heterologous expression in yeast. The poplar genome contains 14 putative AAPs which is quite similar to other species analysed except Arabidopsis. PtAAP11 was mostly expressed in differentiating xylem cells in different organs. Functional characterization demonstrated that PtAAP11 was a high affinity amino acid transporter, more particularly for proline. Compared with other plant amino acid transporters, PtAAP11 represents a novel high-affinity system for proline. Thus, the functional characterization and expression studies suggest that PtAAP11 may play a major role in xylogenesis by providing proline required for xylem cell wall proteins. The present study provides important information highlighting the role of a specific amino acid transporter in xylogenesis in poplar.

Introduction

Amino acids play fundamental roles in a multitude of processes, including protein synthesis, hormone metabolism, cell growth, production of metabolic energy, and nucleobase and urea biosynthesis (Coruzzi and Zhou, 2001). Moreover, amino acids represent the principal long-distance transport form of organic nitrogen (N) and are distributed through xylem and phloem to all plant organs (Wipf et al., 2002,a). On the basis of sequence homologies, amino acid transporter genes of plants can be classified into two majors groups: the amino acid transporter family (ATF) and the amino acid polyamine choline superfamily (APC) (Wipf et al., 2002,a). Most of the amino acid transporters from plants that have been functionally characterized belong to the ATF superfamily, with the amino acid permease (AAP) family being the subfamily that has been studied most. In Arabidopsis, AtAAP1 to AtAAP6 and AtAAP8 have been fully characterized using heterologous expression systems, and have been shown to transport neutral amino acids and glutamate (Fischer et al., 2002; Okumoto et al., 2002). AtAAP1 was expressed in the endosperm and the cotyledons whereas AtAAP2 was expressed in the vascular strands of siliques in funiculi (Hirner et al., 1998). AtAAP1 may import amino acids into root cells when they are supplied at ecologically relevant concentrations suggesting an important role of AtAAP1 for the efficient use of nitrogen sources present in the rhizosphere (Lee et al., 2007). Recently, it has been demonstrated that AtAAP1 regulates the import of amino acids into developing Arabidopsis embryos (Sanders et al., 2009). AtAAP2 might play important roles in the long-distance transport of amino acids (Hirner et al., 1998; Ortiz-Lopez et al., 2000). It has been suggested that AtAAP3 may be involved in amino acid uptake from the phloem or in retrieving amino acids from the soil (Fischer et al., 1998). Nevertheless, AtAAP3 expression was observed for a short period in the connective tissue of the stamen before dehiscence, although it was mainly expressed in the root vascular tissue (Okumoto et al., 2004). AtAAP5 might be involved in phloem loading of amino acids from source tissues (Fischer et al., 1995; Hirner et al., 1998) and in transporting amino acids into the developing embryo (Ortiz-Lopez et al., 2000). It was concluded that the activity of AtAAP5 was crucial for root uptake of cationic amino acids and that, together with AtLHT1, AtAAP5 may be the most important component of the root amino acid uptake system (Svennerstam et al., 2008). Expression of AtAAP6 was detected in roots, sink leaves, and cauline leaves (Fischer et al., 1995). AtAAP6 was found to be expressed in the xylem parenchyma, suggesting that AtAAP6 might function in amino acid uptake from the xylem because a high-affinity transporter may be required due to the low amino acid concentration in xylem sap (Okumoto et al., 2002). The most recently characterized member of this subfamily, AtAAP8, was notably expressed in young siliques and developing seeds (Okumoto et al., 2002) and was suggested to play a crucial role in amino acid uptake into the endosperm and supplying the developing embryo with amino acids during early embryogenesis (Schmidt et al., 2007). AAP members from Solanum tuberosum, Vicia faba, and Phaseolus vulgaris have also been studied (Miranda et al., 2001; Koch et al., 2003; Tan et al., 2008). StAAP1 was highly expressed in mature leaves and its antisense inhibition reduced the amino acid content in transgenic potato tubers (Koch et al., 2003). In Vicia faba, VfAAP1 and VfAAP3 transport a broad range of amino acids but VfAAP1 has a preference for cysteine and VfAAP3 for lysine and arginine (Miranda et al., 2001). PvAAP1 expression was detected in phloem throughout the plant, in xylem parenchyma cells of the stem and in the outer-epidermal cells of the developing cotyledons, and PvAAP1 could be involved in xylem–phloem transfer and phloem loading for amino acid transport to sink tissues (Tan et al., 2008).

Most publications have been devoted to the description of amino acid transporters in annual plants such as A. thaliana, but there is less information available concerning the molecular characterization of amino acid transport in other higher plants, particularly in perennial plants (Fischer et al., 2002; Su et al., 2004; Liu and Bush, 2006). Trees are unique amongst plants since they have extreme longevity and they are able to generate woody biomass. Lignin is one of the major components of the secondary walls of xylem cells, allowing mechanical support and efficient conduction of water and solutes over long distances within the vascular system. Cell walls of xylem cells also contain proline/hydroxyproline-rich glycoproteins and arabinogalactan proteins enriched in alanine, hydroxyproline, proline, and serine (Putoczki et al., 2007). The differentiation of xylem cells is a process that requires amino acids and sugars. It can be noticed that, in woody plant species, a large proportion of photosynthetically assimilated carbon is channelled to xylogenesis and, as a consequence, lignified secondary cell walls represent a major proportion of plant biomass and a huge reservoir of carbon stored within the polymers of lignocelluloses (Boudet et al., 2003).

In perennial plants, very little is known about the molecular mechanisms involved in amino acid transport between source tissues and sink tissues and notably in differentiating tissues such as the xylem. In this work, data are provided on a poplar AAP member that is strongly expressed in the early stages of shoot development, root elongation, and secondary growth. RT-PCR experiments and in situ promoter-GUS experiments were used successfully to show the specific expression of this transporter in meristematic and differentiating xylem cells. Functional characterization of this transporter reveals that it is a high affinity amino acid transporter for proline. Its specific expression and high affinity for some amino acids suggest that PtAAP11 may have an important function in nitrogen transfer during xylem differentiation.

Materials and methods

Plant material

Populus tremula×Populus alba (clone INRA 717 1B4) cuttings were cultivated in a growth chamber for 6 weeks with a photon flux of 80 μmol m−2 s−1 and a day–night temperature regime of 16 h at 24 °C at 80% relative humidity and 8 h at 18 °C at 60% relative humidity, respectively. These plants were then used for poplar transformation (see below).

Vegetative buds were taken from four different free-growing Populus trichocarpa at the University of Nancy campus. The buds were taken from the trees four times: in January to investigate the stage of dormancy, in early March to investigate stage 0 of bud-burst (bud swelling), in mid-March stage I of bud-burst (appearance of green leaf tips) and, one week later, in late March stage II (fall of bud scales). Each time, approximately 20 buds representative of the population within the trees were sampled at 14.00 h, frozen in liquid nitrogen, and stored at –80 °C.

All experiments were carried out using the P. tremula×P. alba poplar clone except when specific tissues were examined. As described for vegetative buds, fruits, stamens, female flowers, and wood (total wood cylinder of twigs including pith) were collected from trees grown outdoors under natural conditions at the University campus.

Roots tips were sampled from three independent transgenic poplar lines obtained after agrotransformation with the pBI101.3 plasmid bearing the AAP11 promoter sequence.

RT-PCR

Total RNA extraction was performed with the RNeasy Plant Mini kit (Qiagen, Darmstadt, Germany) from approximately 100 mg of frozen tissues of poplar. To remove contaminating genomic DNA, the samples were treated with DNAse I (Qiagen), as recommended by the manufacturer. To obtain cDNA, 500 ng of total RNA was annealed to oligo-dT primers (Promega, Madison, WI, USA) and reverse transcribed using Reverse Transcriptase (Eppendorf, Hamburg, Germany) at 42 °C for 90 min. Each reaction was set up in three replicates. For each PtAAP, the PCR program was as follows: 94 °C for 3 min and 35 cycles at 94 °C for 30 s, 58 °C for 45 s, and 72 °C for 1 min. PtAAP10, PtAAP11, PtAAP12, PtAAP13, and PtAAP14 genes were tested by RT-PCR in every experiment performed. A cDNA fragment corresponding to the constitutively expressed ubiquitin gene was amplified simultaneously (28 cycles) and used as a control. The ethidium bromide-stained agarose gels were imaged on a Bio-Rad GelDoc 2000 transilluminator, and quantitative data were determined using Quantity One software (Bio-Rad). The sequences of the gene-specific oligonucleotides located in the non-conserved regions of the genes were used for RT-PCR and are listed in Table 1.

Table 1.

Primers used for reverse transcriptase polymerase chain reaction

Name Sequence 
AAP10 f TCATGTGAATATGGGGACGCTATTT 
AAP10 r TACTGAACCATCCTTCCACAAATGC 
AAP11 f CCATGTAAACACAAGGACATTCCCA 
AAP11 r CTGAGAACCAACGTTCTGCGAACTC 
AAP12 f CCTTGTGAATACGTGTATACTCCGT 
AAP12 r TCGAGGACCAACGTTCTACAAACGT 
AAP13 f GGGATCGCAGGAGTCTCAGCTTAT 
AAP13 r GAAACACAATCTGAGGAGATTCAA 
AAP14 f AGCATCACTGGATCCTCAACTCAC 
AAP14 r GAGACAAAGCCTCGGGAGGTTGAT 
Ubq f GCACCTCTGGCAGACTACAA 
Ubq r TAACAGCCGCTCCAAACAGT 
Name Sequence 
AAP10 f TCATGTGAATATGGGGACGCTATTT 
AAP10 r TACTGAACCATCCTTCCACAAATGC 
AAP11 f CCATGTAAACACAAGGACATTCCCA 
AAP11 r CTGAGAACCAACGTTCTGCGAACTC 
AAP12 f CCTTGTGAATACGTGTATACTCCGT 
AAP12 r TCGAGGACCAACGTTCTACAAACGT 
AAP13 f GGGATCGCAGGAGTCTCAGCTTAT 
AAP13 r GAAACACAATCTGAGGAGATTCAA 
AAP14 f AGCATCACTGGATCCTCAACTCAC 
AAP14 r GAGACAAAGCCTCGGGAGGTTGAT 
Ubq f GCACCTCTGGCAGACTACAA 
Ubq r TAACAGCCGCTCCAAACAGT 

Amino acid extraction and analysis

Amino acids were extracted twice from 10–20 mg freeze-dried plant tissues with 300 μl 70% (v:v) cold ethanol. The samples were dried using a Reacti-Therm Heating Module (Pierce, Rockford, IL, USA) and resuspended in 400 μl 0.1 N HCl. Amino acids and standards were then purified on a Dowex 50WX-8 cation ion exchange column (Sigma-Aldrich, St Louis, MO, USA), and aliquots of purified samples were transferred to microvials, dried in a Reacti-Therm Heating Module (Pierce) and derivatized according to Javelle et al. (2003). Gas chromatography and mass spectrometry (GC-MS) analysis was performed as described previously (Javelle et al., 2003).

Histology of buds

Frozen buds were immersed into the chromic-acetic-formalin fixative, Craf I (Sass, 1958), and they were vacuum-infiltrated until they submerged. Fixation was completed in two days, but specimens could be preserved in this fixative until sectioning. Before cutting they were washed and the scales were removed. The resulting bud was superficially embedded in 6% agar-agar and sectioned longitudinally with a vibratome LeicaVT 1000S into 20–25 μm sections. The median sections were stained with the Wiesner reagent (Sass, 1958), which mainly indicates the cinnamaldehyde groups present in lignins (Monties, 1980; Vallet et al., 1996): fresh sections were left for 3 min in 1% phloroglucinol (Sigma-Aldrich, St Louis, MO, USA) in 95% ethanol and mounted in 18.5% HCl, and observed by standard light microscopy.

DNA constructs

The predicted coding sequence corresponding to PtAAP11 was amplified by the polymerase chain reaction (PCR) using cDNA generated from the tissues used for reverse transcriptase-polymerase chain reaction (RT-PCR) studies. The fidelity of PCR amplifications was verified by sequencing, and the amplification product was cloned into the yeast expression vector pYES2.

In silico analysis of the genomic sequence was carried out to identify the putative promoter sequence of AAP11. A 2000 bp fragment was amplified by PCR using genomic DNA of Populus trichocarpa Nisqually-1 (5′-AAAAAGCTTAGCAATAAAAACAAATAAAAA-3′, 5′-AAAGGATCCGTCGATCAAATTCAGGGGAGG-3′). The promoter fragment was cloned into the HindIII/BamHI site of the binary vector pBI101.3 (Jefferson et al., 1987) and sequenced to confirm that no modifications had occurred.

Poplar transformation

Agrobacterium-mediated transformation (Leplé et al., 1992) was used to transform poplar (P. tremula×P. alba, clone Institut National de la Recherche Agronomique no 717 1B4).

Histochemical localization of GUS activity

For histochemical localization of β-glucuronidase activity, plant material was infiltrated with GUS staining solution containing 50 mM phosphate buffer, pH 7.0, 1 mM K4Fe(CN)6, 1 mM K3Fe(CN)6, 0.1% (v:v) Triton X-100, 2 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid (X-Gluc). Staining was performed for 3-24 h at 37 °C. For sections, plant material was then fixed into the chromic-acetic-formalin fixative, Craf I (Sass, 1958), as described above. Plant material was embedded in 6% agar-agar and finally cut into 20–25 μm sections with a vibratome, LeicaVT 1000S.

Yeast transformation

The yeast strain 22Δ8AA (MATα, ura3-1, gap1-1, put4-1, uga4-1, can1::HisG, lyp1/alp1::HisG, hip1::HisG, dip5::HisG) (Fischer et al., 2002) and JA248 (MATα ura3Δ gap1Δ gnp1Δ agp1Δ) (Velasco et al., 2004) were transformed according to Gietz et al. (1992) with pYES2 harbouring the cDNA sequence of PtAAP11. Yeast transformants were selected on synthetic dextrose minimal medium. Yeast strain 22Δ8AA complementation tests were performed on nitrogen-free medium supplemented with 20 g l−1 of Gal and either 1, 3, and 6 mM L-proline, L-citrulline, L-aspartate or L-glutamate as the sole nitrogen source whereas yeast strain JA248 complementation tests were performed on nitrogen-free medium supplemented with 20 g l−1 of Gal and either 0.5, 1, 2, or 5 mM L-glutamine as the sole nitrogen source.

Transport measurements

Saccharomycescerevisiae uptake studies were conducted under previously described experimental conditions (Wipf et al., 2002b). Yeast cells were grown to logarithmic phase, harvested at an OD600 of 0.5, washed twice with water, and resuspended in buffer A (0.6 M sorbitol, 50 mM potassium phosphate, at the desired pH) to a final OD600 of 5. Prior to uptake measurements, cells were supplemented with 100 mM galactose and incubated for 5 min at 30 °C. To start the reaction, 110 μl of this cell suspension was added to 100 μl of the same buffer containing at least 18.5 kBq [14C]Pro with a specific activity of 8.58 GBq mmol−1 (Amersham) and unlabelled amino acids to the concentrations used in the experiments. Sample aliquots of 50 μl were removed after 30, 60, 120, and 240 s, transferred to 4 ml of ice-cold buffer A, filtered on glass fibre filters, and washed twice with 4 ml of buffer A. The uptake of carbon-14 was determined by liquid scintillation spectrometry. Competition for proline uptake was performed by adding a 5-fold molar excess of the respective competitors to 4 μM proline. For the analysis of pH dependence, incubations were performed in 100 mM potassium phosphate buffer adjusted to the different pH values, 100 mM galactose, and 4 μM proline.

Phylogenetic analyses

The AAP sequences were retrieved by text and BLAST searches from the P. trichocarpa whole genome database (version 1.1) at the US Department of Energy Joint Genome Institute (JGI) (http://genome.jgi-psf.org/Poptr1_1/Poptr1_1.home.html). The curated poplar amino acid sequences were used to search against four other genomes from photosynthetic organisms using BLASTP or TBLASTN. The genomes are available at the following websites, for A. thaliana (http://www.arabidopsis.org/), Oryza sativa (http://rice.plantbiology.msu.edu/), Vitis vinifera (http://www.genoscope.cns.fr/spip/Vitis-vinifera-whole-genome.html), and Sorghum bicolor (http://genome.jgi-psf.org/Sorbi1/Sorbi1.home.html). Amino acid sequences were aligned by CLUSTALW and imported into the Molecular Evolutionary Genetics Analysis (MEGA) package version 4.1 (Tamura et al., 2007). Phylogenetic analyses were conducted using the Neighbor–Joining (NJ) method implemented in MEGA, with the pairwise deletion option for handling alignment gaps, and with the Poisson correction model for distance computation. Bootstrap tests were conducted using 1000 replicates. Branch lengths are proportional to phylogenetic distances. Names of the species are abbreviated with a two-letter code (At, Arabidopsis thaliana; Pt, Populus trichocarpa; Os, Oryza sativa; Sb, Sorghum bicolor, and Vv, Vitis vinifera). All protein sequences and corresponding accession numbers can be found in the databases mentioned above and as supplementary material.

Results

In silico analysis of the AAP family

The first whole-genome sequence and assembly for a tree species, namely that of P. trichocarpa was recently reported by Tuskan et al. (2006). The JGI P. trichocarpa gene search mode revealed the existence of 14 AAP gene models. Populus thus possesses a number of AAP genes similar to Vitis vinifera (13 genes), but has a higher number of AAP genes than A. thaliana (8 genes). Moreover, poplar presents a lower number of AAP members than the two monocotyledons Oryza sativa and Sorghum bicolor, which have 16 and 18 AAP genes, respectively. As suggested by a phylogenetic tree based on protein multiple sequence alignment, the AAP family can be divided into four subgroups (Fig. 1). Subgroups 1 and 2 contain at least one AAP gene of each analysed plant genome. Subgroup 3 is restricted to AAP genes of the monocotyledons O. sativa and S. bicolor while subgroup 4 excludes Arabidopsis AAP members. Interestingly, one branch of subgroup 4 is formed by AAP members of the perennial plants poplar AAP10, AAP11, AAP12, AAP13, AAP14, and grape AAP10 and AAP13.

Fig. 1.

An unrooted, Neighbor–Joining (NJ)-based tree of the amino acid permease (AAP) family in plants. The analysis was performed as described in the ‘Materials and methods’ section and the tree was generated using MEGA version 4.1 (Tamura et al., 2007) after sequence alignment. Bootstrap values are indicated (1000 replicates). Branch lengths are proportional to phylogenetic distances. Names of the species are abbreviated with a two-letter code (At, Arabidopsis thaliana; Pt, Populus trichocarpa; Os, Oryza sativa; Sb, Sorghum bicolor; and Vv: Vitis vinifera). Accession numbers are provided as supplementary data at JXB online.

Fig. 1.

An unrooted, Neighbor–Joining (NJ)-based tree of the amino acid permease (AAP) family in plants. The analysis was performed as described in the ‘Materials and methods’ section and the tree was generated using MEGA version 4.1 (Tamura et al., 2007) after sequence alignment. Bootstrap values are indicated (1000 replicates). Branch lengths are proportional to phylogenetic distances. Names of the species are abbreviated with a two-letter code (At, Arabidopsis thaliana; Pt, Populus trichocarpa; Os, Oryza sativa; Sb, Sorghum bicolor; and Vv: Vitis vinifera). Accession numbers are provided as supplementary data at JXB online.

Analysis of the assembled genome revealed recent whole-genome duplication shared among all modern taxa in the Salicaceae. A second, older duplication appears to be shared with the Arabidopsis lineage (Tuskan et al., 2006). These duplicated genes originated through very small-scale gene duplications and one relatively recent large-scale gene duplication event (Sterck et al., 2005). A detailed analysis of duplication events for the AAP members revealed that PtAAP12 and PtAAP14 derived from a common ancestor through a recent duplication event (Tuskan et al., 2006). It is also worth noting that AAP genes are sporadically distributed across the poplar genome, except PtAAP10, PtAAP11, and PtAAP14 that are located on scaffold 140 whereas PtAAP5 and PtAAP7 are located on linkage group (LG) II (data not shown).

Expression analysis of poplar AAPs from subgroup 4

To investigate expression of AAP10, AAP11, AAP12, AAP13, and AAP14 in poplar, total RNAs were extracted from roots, leaf blades, stamens, female flowers, petioles, wood, and floral and vegetative buds. PtAAP genes showed contrasting expression patterns (Fig. 2). PtAAP10 was mostly expressed in wood and, to a smaller extent, in leaf blades, petioles, vegetative buds, and stamens (Fig. 2). PtAAP12 transcripts were slightly detected in aerial organs such as vegetative buds, female flowers, petioles, wood, and floral buds (Fig. 2). PtAAP14 was strongly expressed in leaf blades and vegetative buds. PtAAP14 transcripts were also detected in flower buds, but to a smaller extent (Fig. 2). PtAAP13 transcripts were not detected in any organs examined so far in poplar (Fig. 2). Interestingly, PtAAP11 transcripts were specifically detected in vegetative buds (Fig. 2).

Fig. 2.

Tissue-dependent expression of poplar AAPs belonging to subgroup 4. Expression of PtAAP10, PtAAP11, PtAAP12, PtAAP13, and PtAAP14 was analysed by reverse transcriptase polymerase chain reaction in tissues collected as described in the ‘Materials and methods’ section. Aliquots of 1 μg total RNAs were reverse-transcribed into cDNA. The ubiquitin gene (Ubq) was amplified and used as an internal control. Experiments were repeated three times, with identical results.

Fig. 2.

Tissue-dependent expression of poplar AAPs belonging to subgroup 4. Expression of PtAAP10, PtAAP11, PtAAP12, PtAAP13, and PtAAP14 was analysed by reverse transcriptase polymerase chain reaction in tissues collected as described in the ‘Materials and methods’ section. Aliquots of 1 μg total RNAs were reverse-transcribed into cDNA. The ubiquitin gene (Ubq) was amplified and used as an internal control. Experiments were repeated three times, with identical results.

An in silico analysis of poplar expressed sequence tags (ESTs) was carried out using the GenBank EST databases, from which 48 ESTs corresponding to AAPs from poplar could be retrieved. Considering the poplar AAPs from subgroup 4, 15 ESTs were retrieved. PtAAP13 transcripts were not detected by RT-PCR, although two ESTs were found in shoot and vascular tissue databases. However, these studies corresponded to specific conditions that were not tested in the present study. EST analysis confirmed the wood distribution of PtAAP10 transcripts and the leaf distribution of PtAAP14 transcripts (Fig. 2; Table 2). Expressed sequence tags corresponding to PtAAP12 were mostly found in leaf and mycorrhizal roots although AAP12 transcripts were mostly detected in shoot tissues (Fig. 2). Expressed sequence tags corresponding to PtAAP11 were only found in the EST database from cambium (Table 2).

Table 2.

In silico analysis of AAP genes in poplar

Gene name Number of occurrences in EST database EST tissue localization 
AAP10 2W 
AAP11 2C 
AAP12 2L, 1MR 
AAP13 1 Sh, 1VT 
AAP14 3L, 3 Sh 
Gene name Number of occurrences in EST database EST tissue localization 
AAP10 2W 
AAP11 2C 
AAP12 2L, 1MR 
AAP13 1 Sh, 1VT 
AAP14 3L, 3 Sh 

Occurrence and distribution of amino acid transporters ESTs retrieved from the EST Genbank database (Altschul et al., 1997). Tissues were classified as follows: C, cambium; L, leaf; MR, mycorrhizal root; Sh, shoot; VT, vascular tissues; W, wood.

Amino acid pools and PtAAP11 expression during bud development

The impact of bud development on the regulation of PtAAP11 transcript levels was investigated further. Total RNAs and amino acids were extracted from poplar buds sampled over a period ranging from winter to early spring, just after bud burst. Concentration of total amino acids, measured by GC-MS, increased by 27-fold between January and the last sampling date (Fig. 3A). In January, serine and glutamate were the predominant amino acids accounting for 32% and 24% of the total amino acid content, respectively. In March, just before bud burst, asparagine was the major amino acid accounting for 50% of the total amino acid content. During bud burst, asparagine concentration decreased by 3-fold and accounted for less than 5% of the total amino acid content at stage II (Fig. 3A). Conversely proline, aspartate, glutamate, and glutamine became the four predominant amino acids after bud burst (Fig. 3A). Proline was almost undetectable before bud break but accounted for 22% of the total amino acid pool at stage II (Fig. 3A). Confirming data from Fig. 2, PtAAP11 transcripts were detected in bud samples collected in January and March but became hardly detected after bud burst (Fig. 3B), suggesting a tight developmental stage-mediated regulation of PtAAP11.

Fig. 3.

Specific expression of AAP11 during bud-burst in poplar. (A) Quantification of amino acids by gas chromatography-mass spectrometry in buds of poplar during winter and spring until after bud-burst. Values are expressed as means ±SE of three replicate experiments. (B) Expression of PtAAP11 was analysed by reverse transcriptase polymerase chain reaction in bud during winter and spring until after bud burst. Aliquots of 500 ng total RNAs were reverse-transcribed into cDNA. The ubiquitin gene (Ubq) was amplified and used as an internal control. Signals were normalized to the constitutive expressed poplar ubiquitin gene. Experiments were repeated three times, with identical results.

Fig. 3.

Specific expression of AAP11 during bud-burst in poplar. (A) Quantification of amino acids by gas chromatography-mass spectrometry in buds of poplar during winter and spring until after bud-burst. Values are expressed as means ±SE of three replicate experiments. (B) Expression of PtAAP11 was analysed by reverse transcriptase polymerase chain reaction in bud during winter and spring until after bud burst. Aliquots of 500 ng total RNAs were reverse-transcribed into cDNA. The ubiquitin gene (Ubq) was amplified and used as an internal control. Signals were normalized to the constitutive expressed poplar ubiquitin gene. Experiments were repeated three times, with identical results.

Histology of winter buds

To investigate structural changes in buds during winter and early spring, median longitudinal sections of poplar buds sampled in January and March (stage 0) were stained with phloroglucinol-HCl. This treatment underlined the presence of lignin and enabled detection of the presence of xylem elements. Between January and March, the new shoot had elongated and the number of young leaves and leaf primordia increased (Fig. 4A, B). During that period, the length and number of xylem strands increased along both the axis and leaf primordia and its elements were characteristic of protoxylem (Fig. 4A–C). Underneath the bud scales, organogenesis and tissue differentiation were resumed prior to bud burst, notably primary xylogenesis (formation of protoxylem).

Fig. 4.

Median sections of poplar buds sampled in January (A) and March stage 0 (B) and details of the differentiated xylem elements (C). Longitudinal median sections stained with phloroglucinol-HCl; bars: 50 μm. (A) In January, a few strands of phloroglucinol–HCl positively reactive elements, i.e. primary xylem (X), were present within the bud, at the base of the next shoot (NS), young leaves (YL) included, but absent in the leaf primordia (LP) and the neighbourhood of the shoot apical meristem (M). (B) In March (stage 0), several strands of phloroglucinol-HCl positively reactive elements were found within the buds, in the elongated next shoot, new young leaves included, but still absent in the neighbourhood of the shoot apical meristem. (C) Detail of a phloroglucinol-HCl positively reactive strand of the young leaf observed in (A) showing four tracheids (T) typical of the protoxylem, with annular secondary walls next to the pith (Pi) and helical secondary wall next to the procambium (Pc). The pictures shown are representative of three separate experiments.

Fig. 4.

Median sections of poplar buds sampled in January (A) and March stage 0 (B) and details of the differentiated xylem elements (C). Longitudinal median sections stained with phloroglucinol-HCl; bars: 50 μm. (A) In January, a few strands of phloroglucinol–HCl positively reactive elements, i.e. primary xylem (X), were present within the bud, at the base of the next shoot (NS), young leaves (YL) included, but absent in the leaf primordia (LP) and the neighbourhood of the shoot apical meristem (M). (B) In March (stage 0), several strands of phloroglucinol-HCl positively reactive elements were found within the buds, in the elongated next shoot, new young leaves included, but still absent in the neighbourhood of the shoot apical meristem. (C) Detail of a phloroglucinol-HCl positively reactive strand of the young leaf observed in (A) showing four tracheids (T) typical of the protoxylem, with annular secondary walls next to the pith (Pi) and helical secondary wall next to the procambium (Pc). The pictures shown are representative of three separate experiments.

Histochemical analysis of PtAAP11 expression

In order to study tissue specificity of AAP11 expression during poplar development, the 5' upstream region of PtAAP11 ORF was isolated and fused to the β-glucuronidase (GUS; uidA) gene. Poplar was transformed and 10 independent transgenic lines were analysed for reporter gene activity. GUS activity was initially analysed in leaves, stems, and roots for independent lines, which showed identical patterns of expression, varying only in the intensity of GUS staining. Three representative lines were used to determine the expression pattern in more detail. Transgenic plants expressing the uidA gene under the control of the PtAAP11 promoter showed strong reporter gene activity restricted to specific tissues (Fig. 5). In aerial parts of the plants and in sections, GUS activity was detected in shoot tips (Fig. 5A), particularly in shoot apical meristem and differentiating protoxylem, as revealed by longitudinal sections (Fig. 5B, C). Moreover, cross-sections of stems in the basal region of older in vitro plants showed that GUS activity was mostly confined to differentiating secondary xylem, and secondarily to differentiating sclerenchyma (Fig. 5D). A strong GUS activity was also detected in root tips (Fig. 5E–G); it was restricted to vascular cylinder (Fig. 5E), to the junction between main and emerging lateral roots (Fig. 5F), and to the meristematic zone (Fig. 5G). In addition, PtAAP11 expression pattern in roots was analysed by semi-quantitative RT-PCR. The latter experiment confirmed that PtAAP11 was principally expressed in root tips, more particularly in the zone of root apical meristem (Fig. 6).

Fig. 5.

Expression of GUS under the control of the PtAAP11 promoter in 3-week-old (A–C) and 6-month-old (D–G) plants. (A) In the aerial part of plants, PtAAP11-GUS expression is restricted to the shoot tip: bud (Bu), young stem (St) and petiole (Pe). (B) Within the shoot apex (longitudinal section), PtAAP11-GUS expression is localized in the shoot apical meristem (M) and at the base of leaf primordia (LP), notably at the site of vascular strands (X) and in the differentiating xylem zone (dX). (C) The detail of protoxylem strand at the base of a leaf primordium (longitudinal section) shows that PtAAP11-GUS expression is restricted to differentiating tracheids (dT) close to the procambium (Pc). (D) In the basal part of stems, PtAAP11-GUS expression is high in the differentiating secondary xylem zone (dX) and weak in the neighbourhood of sclerenchyma cells (Sc). (E) In young roots, PtAAP11-GUS expression is very high at the root apex (RA) and slight in the vascular cylinder seen showing through in places (arrows). (F) When a lateral root (lR) emerges out of the parent root (pR), PtAAP11-GUS expression is also found at the junction of the two roots (black arrow), suggesting labelling of the parent root tissues which the lateral root has just broken through and/or of the lateral vascular cylinder which are differentiating or is going to be connected to the parent vascular cylinder. (G) This root tip shows that PtAAP11-GUS expression is high at the level of the root apical meristem (RM), but absent in the outermost part of the rootcap (Rc), the detached rootcap cells included (asterisk). Supplementary abbreviations: C, cortex; L1, L2, L3, leaves numbered in order of appearance; Ph, phloem; Pi, pith; T, tracheid; W, wood. Bars (A, D, F, G) 1 mm; (E) 0.5 mm; (B, C) 0.05 mm. Identical results were obtained with four independent transgenic lines.

Fig. 5.

Expression of GUS under the control of the PtAAP11 promoter in 3-week-old (A–C) and 6-month-old (D–G) plants. (A) In the aerial part of plants, PtAAP11-GUS expression is restricted to the shoot tip: bud (Bu), young stem (St) and petiole (Pe). (B) Within the shoot apex (longitudinal section), PtAAP11-GUS expression is localized in the shoot apical meristem (M) and at the base of leaf primordia (LP), notably at the site of vascular strands (X) and in the differentiating xylem zone (dX). (C) The detail of protoxylem strand at the base of a leaf primordium (longitudinal section) shows that PtAAP11-GUS expression is restricted to differentiating tracheids (dT) close to the procambium (Pc). (D) In the basal part of stems, PtAAP11-GUS expression is high in the differentiating secondary xylem zone (dX) and weak in the neighbourhood of sclerenchyma cells (Sc). (E) In young roots, PtAAP11-GUS expression is very high at the root apex (RA) and slight in the vascular cylinder seen showing through in places (arrows). (F) When a lateral root (lR) emerges out of the parent root (pR), PtAAP11-GUS expression is also found at the junction of the two roots (black arrow), suggesting labelling of the parent root tissues which the lateral root has just broken through and/or of the lateral vascular cylinder which are differentiating or is going to be connected to the parent vascular cylinder. (G) This root tip shows that PtAAP11-GUS expression is high at the level of the root apical meristem (RM), but absent in the outermost part of the rootcap (Rc), the detached rootcap cells included (asterisk). Supplementary abbreviations: C, cortex; L1, L2, L3, leaves numbered in order of appearance; Ph, phloem; Pi, pith; T, tracheid; W, wood. Bars (A, D, F, G) 1 mm; (E) 0.5 mm; (B, C) 0.05 mm. Identical results were obtained with four independent transgenic lines.

Fig. 6.

Differential expression of AAP11 in poplar root tissues. Expression of PtAAP11 was analysed by reverse transcriptase polymerase chain reaction in roots. Root tips were isolated and divided into three: meristematic zone, elongation zone, and the resting part. RNAs were then extracted and PtAAP11 expression was measured in the meristematic zone and elongation zone as well as in total roots. Aliquots of 300 ng total RNAs were reverse-transcribed into cDNA. The ubiquitin gene (Ubq) was amplified and used as an internal control. Signals were normalized to the constitutive expressed poplar ubiquitin gene. Experiments were repeated three times, with identical results.

Fig. 6.

Differential expression of AAP11 in poplar root tissues. Expression of PtAAP11 was analysed by reverse transcriptase polymerase chain reaction in roots. Root tips were isolated and divided into three: meristematic zone, elongation zone, and the resting part. RNAs were then extracted and PtAAP11 expression was measured in the meristematic zone and elongation zone as well as in total roots. Aliquots of 300 ng total RNAs were reverse-transcribed into cDNA. The ubiquitin gene (Ubq) was amplified and used as an internal control. Signals were normalized to the constitutive expressed poplar ubiquitin gene. Experiments were repeated three times, with identical results.

Functional characterization of PtAAP11 in yeast

Yeast complementation experiments were performed with the yeast mutant 22Δ8AA and JA248. The 22Δ8AA strain is unable to use arginine, aspartate, citrulline, γ-aminobutyric acid, glutamate, and proline efficiently as sole N sources (Fischer et al., 2002) and the JA248 strain is unable to use glutamine efficiently as sole N source (Velasco et al., 2004). As controls, strains 22Δ8AA and JA248 were transformed with the empty expression vector pYES2. Transformation of yeast with pYES2 bearing the PtAAP11 coding sequence under the control of the GAL1 promoter conferred the ability of strain 22Δ8AA to grow at 1 mM proline (Fig. 7A), 3 mM GABA and citrulline, but not on glutamate and aspartate (data not shown). Transformation with pYES2 bearing the PtAAP11 coding sequence did not restore growth of strain JA248 on glutamine (Fig. 7B).

Fig. 7.

Complementation of yeast mutant strains by poplar AAP11. (A) Yeast strain 22Δ8AA was transformed with the yeast expression vector pYES2 or pYES2 harboring the coding sequence of PtAAP11. Growth was assayed on nitrogen-free medium containing 20 g l−1 of Gal and either 1, 3, and 6 mM L-proline, as sole nitrogen source. Pictures were taken after 2 d of growth at 30 °C and are representative of three replicate experiments. (B) Yeast strain JA248 was transformed with the yeast expression vector pYES2 or pYES2 harbouring the coding sequence of PtAAP11. Growth was assayed on nitrogen-free medium containing 20 g l−1 of Gal and either 0.5, 1, 2, and 5 mM L-glutamine as sole nitrogen source. Pictures were taken after 2 d of growth at 30 °C and are representative of three replicate experiments.

Fig. 7.

Complementation of yeast mutant strains by poplar AAP11. (A) Yeast strain 22Δ8AA was transformed with the yeast expression vector pYES2 or pYES2 harboring the coding sequence of PtAAP11. Growth was assayed on nitrogen-free medium containing 20 g l−1 of Gal and either 1, 3, and 6 mM L-proline, as sole nitrogen source. Pictures were taken after 2 d of growth at 30 °C and are representative of three replicate experiments. (B) Yeast strain JA248 was transformed with the yeast expression vector pYES2 or pYES2 harbouring the coding sequence of PtAAP11. Growth was assayed on nitrogen-free medium containing 20 g l−1 of Gal and either 0.5, 1, 2, and 5 mM L-glutamine as sole nitrogen source. Pictures were taken after 2 d of growth at 30 °C and are representative of three replicate experiments.

To determine transport properties of PtAAP11, uptake of 14C-proline by yeast cells expressing PtAAP11 was quantified (Fig. 8). Expression of PtAAP11 protein in yeast mutant 22Δ8AA gave a 38-fold increase of 14C-proline over time compared to cells transformed with the vector (data not shown). Uptake of 14C-proline was pH-dependent, with an optimum ranging from pH 6 to 7 (Fig. 8A). PtAAP11-mediated 14C-proline uptake was concentration-dependent and showed saturable kinetics with an apparent Km value of 4.4±0.3 μM (Fig. 8B). Competition experiments for 14C-proline uptake in the presence of a 5-fold excess of unlabelled amino acids showed that eight amino acids, and, more particularly, proline and phenylalanine, reduce significantly proline uptake by PtAAP11 (Fig. 8C). Proline uptake was to a lesser extent reduced by tyrosine, threonine, serine, and histidine (Fig. 8C). These data suggest that proline, phenylalanine, methionine, isoleucine, alanine, valine, cysteine, and leucine are efficiently transported whereas other amino acids are only marginally transported by PtAAP11.

Fig. 8.

Kinetic analysis of poplar AAP11 in transformed yeast. (A) pH dependence of [14C] proline uptake. Proline uptake rates into the yeast 22Δ8AA expressing PtAAP11 were determined in media adjusted to different pH values. Values are expressed as means ±SE of three replicate experiments. (B) Concentration-dependent kinetics of [14C] proline uptake by yeast strain 22Δ8AA expressing PtAAP11. Uptake rates were measured at pH 6. The Michaelis–Menten constant for proline is 4.4 ±0.3 μM. Values are expressed as means ±SE of three replicate experiments. (C) Substrate specificity of PtAAP11. Competition of [14C] proline uptake into 22Δ8AA cells in the presence of a 5-fold excess of respective amino acid. Proline uptake without competitor was taken as 100%. Values are expressed as means ±SE of three replicate experiments.

Fig. 8.

Kinetic analysis of poplar AAP11 in transformed yeast. (A) pH dependence of [14C] proline uptake. Proline uptake rates into the yeast 22Δ8AA expressing PtAAP11 were determined in media adjusted to different pH values. Values are expressed as means ±SE of three replicate experiments. (B) Concentration-dependent kinetics of [14C] proline uptake by yeast strain 22Δ8AA expressing PtAAP11. Uptake rates were measured at pH 6. The Michaelis–Menten constant for proline is 4.4 ±0.3 μM. Values are expressed as means ±SE of three replicate experiments. (C) Substrate specificity of PtAAP11. Competition of [14C] proline uptake into 22Δ8AA cells in the presence of a 5-fold excess of respective amino acid. Proline uptake without competitor was taken as 100%. Values are expressed as means ±SE of three replicate experiments.

Discussion

An extended AAP family in the poplar genome

The AAP family is the best-studied subfamily of the ATF superfamily, particularly in Arabidopsis. In the poplar genome, 14 AAP genes were identified and five genes were grouped into a specific subgroup without Arabidopsis orthologues and with only two grape orthologues (Fig. 1). Taken with caution, a comparison of the number of AAP genes in different species might suggest that plant species from different environments or with different life styles organize amino acid transport with a fairly unequal number of amino acid transporters. In poplar, AAP10, AAP11, AAP12, AAP13, and AAP14 showed contrasting expression patterns and were mostly expressed in shoot tissues, notably in vegetative buds. PtAAP11 expression was the most interesting because it was restricted to vegetative buds (Fig. 2), suggesting a specific role of PtAAP11 in the buds and a putative role in bud development. Thus, it was decided to investigate the physiological function of PtAAP11 in buds but also in growing organs and tissues.

PtAAP11 expression was specifically associated with differentiating xylem cells

The specific RT-PCR expression pattern for PtAAP11 was confirmed in a time-course experiment, where poplar buds were sampled from winter to bud burst stages (Fig. 3). Surprisingly enough, PtAAP11 transcripts could hardly be detected after bud burst (Fig. 3B). Moreover, GUS activity under the control of the PtAAP11 promoter was restricted to shoot and root meristematic cells and differentiating xylem derivatives (Figs 5, 6). In addition, bud sections stained with phloroglucinol-HCl clearly showed that protoxylem formation occurred in vegetative buds during winter, just before bud burst (Fig. 4). It has already been shown for Picea abies buds that protoxylem elements are formed in embryonic shoots prior to bud burst and become functional shortly before the start of bud outgrowth (de Faÿ et al., 2000). According to these authors, differentiation of conducting elements in developing embryonic shoots is essential to bud burst. Indeed, bud burst occurs as a result of protoxylem functioning that allows mass hydratation of embryonic shoots and therefore rapid elongation (de Faÿ et al., 2000). It is also well known that xylem differentiation in young roots occurs at the root tip from the procambium (the central part of the root meristem), and thus in the young vascular cylinder. In more distal regions of the roots, there is also differentiation of xylem elements, which allows connection of the vascular cylinder of a lateral root to that of the parent root (Esau, 1977). It can be concluded that strong PtAAP11 expression in buds, shoots, and root apices, and in axes was mainly associated with the differentiation of xylem cells. Moreover, considering that PtAAP11 is expressed in differentiating xylem and not in ut differentiated xylem, it is not surprising that PtAAP11 message is abundant in (eco)dormant buds and disappears when bud-break occurs since, at this time, protoxylem is already differentiated.

At this time, it seems to be important to discuss the strong PtAAP10 expression in wood. As the wood sample, used for RT-PCR analyses, corresponds to mature xylem including the pith, the only cells susceptible to express the PtAAP10 gene, because they are the only living cells, are the parenchyma cells of wood (axial and radial parenchyma) and of pith. Moreover, the analyses showed that PtAAP10 is also expressed in various organs (leaf, petiole, stamen, female flower) that contain xylem in vascular bundles and much ground parenchyma. All this suggests that PtAAP10 could be more associated with parenchyma and/or differentiated xylem cells than with differentiating xylem cells. PtAAP11 thus appears to be the more interesting gene of the AAP family for the investigation of xylem differentiation in poplar.

PtAAP11 represents a new high-affinity amino acid transporter

Arabidopsis AAP family members have been extensively characterized by heterologous expression in yeast and Xenopus oocytes (Fischer et al., 1995, 2002; Boorer et al., 1996; Boorer and Fischer, 1997; Okumoto et al., 2002). AAPs transport a broad spectrum of amino acids and their apparent Km values indicate that they are low-affinity systems, except for AtAAP6 which has been found to transport acidic and neutral amino acids with a much higher affinity than other AtAAPs analysed (Fischer et al., 2002).

Determination of affinity parameters for 14C-proline uptake by PtAAP11 in yeast and transport competition by other amino acids revealed that it preferentially transports proline and phenylalanine. Moreover, these analyses demonstrated that PtAAP11 possesses an apparent Km value for proline of 4.4±0.3 μM (Fig. 8B). To date, these data represent the lowest Km value ever determined for a plant amino acid transporter (Table 3). For example, AtLHT1 possesses a Km value of around 10 μM and 14 μM for proline and glutamate, respectively (Hirner et al., 2006). AtLHT2 and AtAAP6 present a Km value of around 13 μM and 67 μM for proline, respectively (Lee and Tegeder, 2004). Compared with other plant amino acid transporters characterized so far, PtAAP11 represents a novel high-affinity system for proline.

Table 3.

Michaelis–Menten constants (Km) of amino acid transporters functionally characterized in Saccharomyces cerevisiae

Amino acids Amino acid transporter Apparent Km (μM) Reference 
Proline PtAAP11 4.4±0.3 This study 
 AtAAP1 60 Frommer et al. (1993) 
 AtAAP2 140±20 Kwart et al. (1993) 
 AtAAP3 250±25 Fischer (1997) 
 AtAAP4 134±25 Fischer (1997) 
 AtAAP5 500±25 Fischer (1997) 
 AtAAP6 67±21 Lee and Tegeder (2004) 
 AtLHT1 10±0.5 Hirner et al. (2006) 
 AtLHT2 13±3 Lee and Tegeder (2004) 
 AtProT1 427±17 Grallath et al. (2005) 
 AtProT2 500±5 Grallath et al. (2005) 
 AtProT3 999±36 Grallath et al. (2005) 
 AtCAT1 3 000 Frommer et al. (1995) 
 LeProT1 1 900±260 Schwacke et al. (1999) 
 HvProT 25 Ueda et al. (2001) 
Alanine AtAAP1 292±42 Hsu et al. (1993) 
Leucine AtANT1 163 Chen et al. (2001) 
 AtLHT1 11 000 Chen and Bush (1997) 
Tyrosine AtANT1 240 Chen et al. (2001) 
Aspartate AtAAP1 774 Okumoto et al. (2002) 
 AtAAP6 248 Okumoto et al. (2002) 
 AtAAP8 444 Okumoto et al. (2002) 
 AtLHT2 72±21 Lee and Tegeder (2004) 
Glutamate AtLHT1 13.6±0.7 Hirner et al. (2006) 
Arginine AtCAT5 12 Su et al. (2004) 
Histidine AtCAT1 35 Frommer et al. (1995) 
 AtLHT1 362±28 Hirner et al. (2006) 
Lysine AtLHT1 175 Chen and Bush (1997) 
GABA AtGAT1 10±3 Meyer et al. (2006) 
 AtProT1 4 500±260 Grallath et al. (2005) 
 AtProT2 4 010±640 Grallath et al. (2005) 
 AtProT3 5 120±120 Grallath et al. (2005) 
Amino acids Amino acid transporter Apparent Km (μM) Reference 
Proline PtAAP11 4.4±0.3 This study 
 AtAAP1 60 Frommer et al. (1993) 
 AtAAP2 140±20 Kwart et al. (1993) 
 AtAAP3 250±25 Fischer (1997) 
 AtAAP4 134±25 Fischer (1997) 
 AtAAP5 500±25 Fischer (1997) 
 AtAAP6 67±21 Lee and Tegeder (2004) 
 AtLHT1 10±0.5 Hirner et al. (2006) 
 AtLHT2 13±3 Lee and Tegeder (2004) 
 AtProT1 427±17 Grallath et al. (2005) 
 AtProT2 500±5 Grallath et al. (2005) 
 AtProT3 999±36 Grallath et al. (2005) 
 AtCAT1 3 000 Frommer et al. (1995) 
 LeProT1 1 900±260 Schwacke et al. (1999) 
 HvProT 25 Ueda et al. (2001) 
Alanine AtAAP1 292±42 Hsu et al. (1993) 
Leucine AtANT1 163 Chen et al. (2001) 
 AtLHT1 11 000 Chen and Bush (1997) 
Tyrosine AtANT1 240 Chen et al. (2001) 
Aspartate AtAAP1 774 Okumoto et al. (2002) 
 AtAAP6 248 Okumoto et al. (2002) 
 AtAAP8 444 Okumoto et al. (2002) 
 AtLHT2 72±21 Lee and Tegeder (2004) 
Glutamate AtLHT1 13.6±0.7 Hirner et al. (2006) 
Arginine AtCAT5 12 Su et al. (2004) 
Histidine AtCAT1 35 Frommer et al. (1995) 
 AtLHT1 362±28 Hirner et al. (2006) 
Lysine AtLHT1 175 Chen and Bush (1997) 
GABA AtGAT1 10±3 Meyer et al. (2006) 
 AtProT1 4 500±260 Grallath et al. (2005) 
 AtProT2 4 010±640 Grallath et al. (2005) 
 AtProT3 5 120±120 Grallath et al. (2005) 

As described above, PtAAP11 possesses the lowest Km value ever determined for a plant amino acid transporter and notably for proline. This property is all the more remarkable since plants possess ProT transporters, which mediate the transport of the compatible solutes proline, glycine betaine, and GABA (Rentsch et al., 1996; Schwacke et al., 1999; Ueda et al., 2001; Waditee et al., 2002; Grallath et al., 2005). Except for the homologue of barley, these transporters have a relatively low affinity for proline with a Km value comprised between 0.5 mM and 2 mM (Table 3). In A. thaliana, due to their differential expression patterns, the AtProTs fulfil different roles in planta although their intracellular localization, substrate specificity, and affinity are very similar (Grallath et al., 2005). Nevertheless, none of them has been shown to be expressed in differentiating xylem cells.

Physiological function of AAP11 in poplar

Histochemical analysis of PtAAP11 expression and PtAAP11 functional characterization demonstrated that PtAAP11 is a high-affinity amino acid transporter expressed in differentiating xylem and sclerenchyma cells. Lignified secondary cell walls are features shared between xylem and sclerenchyma and a major step in xylem and sclerenchyma differentiation processes is cell wall deposition and lignin biosynthesis. In this context, AAP11 might have an important and specific role in xylem and sclerenchyma development.

In addition to lignin, cell walls of xylem contain structural proteins that are ubiquitous and relatively abundant in land plants and green algae (Cassab, 1998). They are unusually rich in one or two amino acids, contain highly repetitive sequence domains, and are highly or poorly glycosylated. Among these proteins are found proline/hydroxyproline-rich glycoproteins or extensins, arabinogalactan proteins, glycine-rich proteins, proline-rich proteins, and chimeric proteins that contain extensin-like domains. With the exception of glycine-rich proteins, all are glycosylated and contain hydroxyproline (Cassab, 1998), which is formed from proline residues. To date, PtAAP11 is the plant amino acid transporter with the highest affinity for proline, suggesting that it preferentially mediates the transfer of proline residues. PtAAP11 may allow the entry of proline into differentiating xylem cells, providing proline residues required for the synthesis of proline- and hydroxyproline-rich proteins, components of the xylem cell walls. Xylogenesis can be divided in four major steps: cell expansion, ordered deposition of a thick multilayered secondary wall, lignification, and cell death (Plomion et al., 2001). Its specific expression in differentiating xylem cells and its high affinity for proline suggest that PtAAP11 may be involved in xylem differentiation by providing amino acids required for xylem cell wall formation.

Supplementary data

All protein sequences and corresponding accession numbers used for phylogenetic analyses are provided as supplementary data at JXB online.

Jérémy Couturier was supported by a PhD fellowship from the ‘Ministère délégué à l'Enseignement supérieur et à la Recherche’. This work was supported by ‘Ministère délégué à l'Enseignement supérieur et à la Recherche’. Aude Migeon and Frédéric Guinet are gratefully acknowledged for the help in sampling buds of poplar and technical assistance.

References

Altschul
SF
Madden
TL
Schaffer
AA
Zhang
J
Zhang
Z
Miller
W
Lipman
DJ
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs
Nucleic Acids Research
 , 
1997
, vol. 
25
 (pg. 
3389
-
3402
)
Boorer
KJ
Fischer
WN
Specificity and stoichiometry of the Arabidopsis H+/amino acid transporter AAP5
Journal of Biological Chemistry
 , 
1997
, vol. 
29
 (pg. 
13040
-
13046
)
Boorer
KJ
Frommer
WB
Bush
DR
Loo
DDF
Wright
EM
Kinetics and specificity of a H+/amino acid transporter from Arabidopsis thaliana
Journal of Biological Chemistry
 , 
1996
, vol. 
29
 (pg. 
2213
-
2220
)
Boudet
AM
Kajita
S
Grima-Pettenati
J
Goffner
D
Lignins and lignocellulosics: a better control of synthesis for new and improved uses
Trends in Plant Science
 , 
2003
, vol. 
8
 (pg. 
576
-
581
)
Cassab
GI
Plant cell wall proteins
Annual Review of Plant Physiology and Plant Molecular Biology
 , 
1998
, vol. 
49
 (pg. 
281
-
309
)
Chen
L
Bush
DR
LHT1, a lysine- and histidine-specific amino acid transporter in Arabidopsis
Plant Physiology
 , 
1997
, vol. 
115
 (pg. 
1127
-
1134
)
Chen
L
Ortiz-Lopez
A
Jung
A
Bush
DR
ANT1, an aromatic and neutral amino acid transporter in Arabidopsis
Plant Physiology
 , 
2001
, vol. 
125
 (pg. 
1813
-
1820
)
Coruzzi
GM
Zhou
L
Carbon and nitrogen sensing and signaling in plants: emerging ‘matrix effects’
Current Opinion Plant Biology
 , 
2001
, vol. 
4
 (pg. 
247
-
253
)
De Faÿ
E
Vacher
V
Humbert
F
Water-related phenomena in winter buds and twigs of Picea abies L. (Karst.) until bud-burst: a biological, histological and NMR study
Annals of Botany
 , 
2000
, vol. 
86
 (pg. 
1097
-
1107
)
Esau
K
Anatomy of seed plants
 , 
1977
2nd edn
New York
John Wiley & Sons, Inc
Fischer
WN
Substratspezifität und Transportmechanismus pflanzlicher Aminosäuren in Relation zu ihrer physiologischen Funktion. PhD thesis, Eberhard-Karls-Universtity, Tübingen
1997
(pg. 
1
-
135
)
Fischer
WN
Kwart
M
Hummel
S
Frommer
WB
Substrate specificity and expression profile of amino acid transporters (AAPs) in Arabidopsis
Journal of Biological Chemistry
 , 
1995
, vol. 
29
 (pg. 
16315
-
16320
)
Fischer
WN
Andrè
B
Rentsch
D
Krolkiewicz
S
Tegeder
M
Breitkreuz
K
Frommer
WB
Plant amino acid transport
Trends in Plant Science
 , 
1998
, vol. 
29
 (pg. 
188
-
195
)
Fischer
WN
Loo
DD
Koch
W
Ludewig
U
Boorer
KJ
Tegeder
M
Rentsch
D
Wright
EM
Frommer
WB
Low and high affinity amino acid H+-cotransporters for cellular import of neutral and charged amino acids
The Plant Journal
 , 
2002
, vol. 
29
 (pg. 
717
-
731
)
Frommer
WB
Hummel
S
Riesmeier
JW
Expression cloning in yeast of a cDNA encoding a broad specificity amino acid permease from Arabidopsis thaliana
Proceedings of the National Academy of Sciences, USA
 , 
1993
, vol. 
90
 (pg. 
5944
-
5948
)
Frommer
WB
Hummel
S
Unseld
M
Ninnemann
O
Seed and vascular expression of a high-affinity transporter for cationic amino acids in Arabidopsis
Proceedings of the National Academy of Sciences, USA
 , 
1995
, vol. 
92
 (pg. 
12036
-
12040
)
Grallath
S
Weimar
T
Meyer
A
Gumy
C
Suter-Grotemeyer
M
Neuhaus
JM
Rentsch
D
The AtProT family. Compatible solute transporters with similar substrate specificity but differential expression patterns
Plant Physiology
 , 
2005
, vol. 
137
 (pg. 
117
-
126
)
Gietz
D
St. Jean
A
Woods
RA
Schiestl
RH
Improved method for high efficiency transformation of intact yeast cells
Nucleic Acids Research
 , 
1992
, vol. 
20
 pg. 
1425
 
Hirner
B
Fischer
WN
Rentsch
D
Kwart
M
Frommer
WB
Developmental control of H+/amino acid permease gene expression during seed development of Arabidopsis
The Plant Journal
 , 
1998
, vol. 
14
 (pg. 
535
-
544
)
Hirner
A
Ladwig
F
Stransky
H
Okumoto
S
Keinath
M
Harms
A
Frommer
WB
Koch
W
Arabidopsis LHT1 is a high-affinity transporter for cellular amino acid uptake in both root epidermis and leaf mesophyll
The Plant Cell
 , 
2006
, vol. 
18
 (pg. 
1931
-
1946
)
Hsu
LC
Chiou
TJ
Chen
L
Bush
DR
Cloning a plant amino acid transporter by functional complementation of a yeast amino acid transport mutant
Proceedings of the National Academy of Sciences, USA
 , 
1993
, vol. 
90
 (pg. 
7441
-
7445
)
Javelle
A
Morel
M
Rodriguez-Pastrana
BR
Botton
B
Andre
B
Marini
AM
Brun
A
Chalot
M
Molecular characterization, function and regulation of ammonium transporters (Amt) and ammonium-metabolizing enzymes (GS, NADP-GDH) in the ectomycorrhizal fungus Hebeloma cylindrosporum
Molecular Microbiology
 , 
2003
, vol. 
47
 (pg. 
411
-
430
)
Jefferson
RA
Kavanagh
TA
Bevan
MW
GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants
EMBO Journal
 , 
1987
, vol. 
6
 (pg. 
3901
-
3907
)
Koch
W
Kwart
M
Laubner
M
Heineke
D
Stransky
H
Frommer
WB
Tegeder
M
Reduced amino acid content in transgenic potato tubers due to antisense inhibition of the leaf H+/amino acid symporter StAAP1
The Plant Journal
 , 
2003
, vol. 
33
 (pg. 
211
-
220
)
Kwart
M
Hirner
B
Hummel
S
Frommer
WB
Differential expression of two related amino acid transporters with differing substrate specificity in Arabidopsis thaliana
The Plant Journal
 , 
1993
, vol. 
4
 (pg. 
993
-
1002
)
Lee
YH
Foster
J
Chen
J
Voll
LM
Weber
APM
Tegeder
M
AAP1 transports uncharged amino acids into roots of Arabidopsis
The Plant Journal
 , 
2007
, vol. 
50
 (pg. 
305
-
319
)
Lee
YH
Tegeder
M
Selective expression of a novel high-affinity transport system for acidic and neutral amino acids in the tapetum cells of Arabidopsis flowers
The Plant Journal
 , 
2004
, vol. 
40
 (pg. 
60
-
74
)
Leplé
JC
Brasileiro
ACM
Michel
MF
Delmotte
F
Jouanin
L
Transgenic poplars: expression of chimeric genes using four different constructs
Plant Cell Reports
 , 
1992
, vol. 
11
 (pg. 
137
-
141
)
Liu
X
Bush
DR
Expression and transcriptional regulation of amino acid transporters in plants
Amino Acids
 , 
2006
, vol. 
30
 (pg. 
113
-
120
)
Meyer
A
Eskandari
S
Grallath
S
Rentsch
D
AtGAT1, a high affinity transporter for gamma-aminobutyric acid in Arabidopsis thaliana
Journal of Biological Chemistry
 , 
2006
, vol. 
281
 (pg. 
7197
-
7204
)
Miranda
M
Borisjuk
L
Tewes
A
Heim
U
Sauer
N
Wobus
U
Weber
H
Amino acid permeases in developing seeds of Vicia faba L.: expression precedes storage protein synthesis and is regulated by amino acid supply
The Plant Journal
 , 
2001
, vol. 
28
 (pg. 
61
-
71
)
Monties
B
Les polymères végétaux. Polymères pariétaux et alimentaires non azotés
 , 
1980
Paris
Bordas
Okumoto
S
Koch
W
Tegeder
M
Fischer
WN
Biehl
A
Leister
D
Stierhof
YD
Frommer
WB
Root phloem-specific expression of the plasma membrane amino acid proton co-transporter AAP3
Journal of Experimental Botany
 , 
2004
, vol. 
55
 (pg. 
2155
-
2168
)
Okumoto
S
Schmidt
R
Tegeder
M
Fischer
WN
Rentsch
D
Frommer
WB
Koch
W
High affinity amino acid transporters specifically expressed in xylem parenchyma and developing seeds of Arabidopsis
Journal of Biological Chemistry
 , 
2002
, vol. 
277
 (pg. 
45338
-
45346
)
Ortiz-Lopez
A
Chang
HC
Bush
DR
Amino acid transporters in plants
Biochimica et Biophysica Acta - Biomembranes
 , 
2000
, vol. 
1465
 (pg. 
275
-
280
)
Plomion
C
Leprovost
G
Stokes
A
Wood formation in trees
Plant Physiology
 , 
2001
, vol. 
127
 (pg. 
1513
-
1523
)
Putoczki
TL
Pettolino
F
Griffin
MD
Möller
R
Gerrard
JA
Bacic
A
Jackson
SL
Characterization of the structure, expression and function of Pinus radiata D. Don arabinogalactan-proteins
Planta
 , 
2007
, vol. 
226
 (pg. 
1131
-
1142
)
Rentsch
D
Hirner
B
Schmelzer
E
Frommer
WB
Salt stress-induced proline transporters and salt stress-repressed broad specificity amino acid permeases identified by suppression of a yeast amino acid permease-targeting mutant
The Plant Cell
 , 
1996
, vol. 
8
 (pg. 
1437
-
1446
)
Sanders
A
Collier
R
Trethewy
A
Gould
G
Sieker
R
Tegeder
M
AAP1 regulates import of amino acids into developing Arabidopsis embryos
The Plant Journal
 , 
2009
, vol. 
59
 (pg. 
540
-
552
)
Sass
JE
Botanical microtechnique
 , 
1958
3rd edn
Ames, Iowa
The Iowa State University Press
Schmidt
R
Stransky
H
Koch
W
The amino acid permease AAP8 is important for early seed development in Arabidopsis thaliana
Planta
 , 
2007
, vol. 
226
 (pg. 
805
-
813
)
Schwacke
R
Grallath
S
Breitkreuz
KE
Stransky
E
Stransky
H
Frommer
WB
Rentsch
D
LeProT1, a transporter for proline, glycine betaine, and gamma-amino butyric acid in tomato pollen
The Plant Cell
 , 
1999
, vol. 
11
 (pg. 
377
-
392
)
Sterck
L
Rombauts
S
Jansson
S
Sterky
F
Rouzé
P
Van de Peer
Y
EST data suggest that poplar is an ancient polyploid
New Phytologist
 , 
2005
, vol. 
167
 (pg. 
165
-
170
)
Su
YH
Frommer
WB
Ludewig
U
Molecular and functional characterization of a family of amino acid transporters from Arabidopsis
Plant Physiology
 , 
2004
, vol. 
136
 (pg. 
3104
-
3113
)
Svennerstam
H
Ganeteg
U
Näsholm
T
Root uptake of cationic amino acids by Arabidopsis depends on functional expression of amino acid permease 5
New Phytologist
 , 
2008
, vol. 
180
 (pg. 
620
-
630
)
Tamura
K
Dudley
J
Nei
M
Kumar
S
MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0
Molecular Biology and Evolution
 , 
2007
, vol. 
24
 (pg. 
1596
-
1599
)
Tan
Q
Grennan
AK
Pélissier
HC
Rentsch
D
Tegeder
M
Characterization and expression of French bean amino acid transporter PvAAP1
Plant Science
 , 
2008
, vol. 
174
 (pg. 
348
-
356
)
Tuskan
GA
Difazio
S
Jansson
S
, et al.  . 
The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)
Science
 , 
2006
, vol. 
313
 (pg. 
1596
-
1604
)
Ueda
A
Shi
W
Sanmiya
K
Shono
M
Takabe
T
Functional analysis of salt-inducible proline transporter of barley roots
Plant and Cell Physiology
 , 
2001
, vol. 
42
 (pg. 
1282
-
1289
)
Vallet
C
Chabbert
B
Czaninski
Y
Monties
B
Histochemistry of lignin deposition during sclerenchyma differentiation in alfafa stems
Annals of Botany
 , 
1996
, vol. 
78
 (pg. 
625
-
632
)
Velasco
I
Tenreiro
S
Calderon
IL
André
B
Saccharomyces cerevisiae Aqr1 is an internal-membrane transporter involved in excretion of amino acids
Eukaryotic Cell
 , 
2004
, vol. 
3
 (pg. 
1492
-
1503
)
Waditee
R
Hibino
T
Tanaka
Y
, et al.  . 
Functional characterization of betaine/proline transporters in betaine-accumulating mangrove
Journal of Biological Chemistry
 , 
2002
, vol. 
277
 (pg. 
18373
-
18382
)
Wipf
D
Ludewig
U
Tegeder
M
Rentsch
D
Koch
W
Frommer
WB
Conservation of amino acid transporters in fungi, plants and animals
Trends in Biochemical Science
 , 
2002
, vol. 
27
 (pg. 
139
-
147
)
Wipf
D
Benjdia
M
Tegeder
M
Frommer
WB
Characterization of a general amino acid permease from Hebeloma cylindrosporum
FEBS Letters
 , 
2002
, vol. 
528
 (pg. 
119
-
124
)

Comments

0 Comments