Identification of novel cyclin‐dependent kinases interacting with the CKS1 protein of Arabidopsis¹

Abstract

The SUC1/CKS1 proteins interact with cyclin‐dependent kinases (CDKs) and play an essential, but yet not entirely resolved, role in the regulation of the cell cycle. With the Arabidopsis thaliana CKS1At protein as bait in a two‐hybrid screen, two novel Arabidopsis CDKs, Arath;CDKB1;2 and Arath;CDKB2;1, were isolated. A closely related homologue of Arath;CDKB2;1 was discovered in the databases and was nominated Arath;CDKB2;2. Transcript analysis of the five known Arath;CDKA and Arath;CDKB genes revealed that they all had the highest expression in flowers and cell suspensions. Differences in the expression patterns in roots, leaves and stems suggest unique roles for each CDK.

Arabidopsis thaliana, cell cycle, CKS1At, cyclin‐dependent kinases, two hybrid.

The precise co‐ordination of cell division is achieved by the interplay of the cyclin‐dependent kinase (CDK) complexes (Lees, 1995). CDK complexes consist of a catalytic CDK subunit (CKS) and a positive regulatory partner, called cyclin. Genetic studies in yeast have revealed the existence of a third protein component of the CDK complexes called SUC1 (in fission yeast) or CKS1 (in budding yeast, humans, and Arabidopsis). Although the CKS1 proteins are essential for cell cycle progression in vivo, their precise biological function is still unclear.

Until now, four CDKs have been described in Arabidopsis thaliana (L.) Heynh., Arath;CDKA;1, Arath;CDKB1;1, Arath;CDKC;1, and Arath;CDKC;2 (according to the nomenclature of Joubès et al., 2000), of which only the first two have been described unequivocally to play a role in cell cycle regulation (Mironov et al., 1999). The Arabidopsis CKS1At protein interacts with Arath;CDKA;1 and Arath;CDKB1;1 (De Veylder et al., 1997). In order to identify whether other proteins interact with CKS1At, a two‐hybrid screen was performed as described earlier (De Veylder et al., 1999) using as bait a fusion protein between the GAL4 DNA‐binding domain and CKS1At. After sequential selection rounds, four different CKS1At‐specific interacting clones were identified. Two clones encoded Arath;CDKA;1 and Arath;CDKB1;1, whereas the two others coded for novel CDK‐related proteins and were designated Arath;CDKB1;2 and Arath;CDKB2;1 (according to the nomenclature of Joubès et al., 2000).

The missing 5′ end of the truncated Arath;CDKB2;1 cDNA was obtained by rapid amplification of cDNA ends (RACE) using the Marathon cDNA Amplification kit (Clontech, Palo Alto, CA) and mRNA prepared from cell suspensions as starting material and the AP1 (Clontech) and 5′‐gcaatatcccgtgaccatggcagaatgc‐3′ primers. The 5′ RACE product that was obtained was cloned into the pGEM‐T Easy vector (Promega, Madison, WI) and sequenced. The full‐length cDNA contained an open reading frame that encoded a protein of 313 amino acids with a calculated molecular mass of 35 kDa. Another closely related CDK that shared 88% identity and 93% similarity with Arath;CDK2;1 was identified by a sequence homology search of the expressed sequence tag (EST) database of Arabidopsis and was designated Arath;CDKB2;2 (accession number AAD30597) (Table 1). The two novel CDKs share most sequence identity (85%) and similarity (92%) with a CDK of alfalfa (Medsa;CDKB2;1). Medsa;CDKB2;1 has been identified as a G₂‐to‐M phase‐dependent CDK that contains a divergent PSTAIRE cyclin‐binding motif (Magyar et al., 1997). This domain is part of a conserved 16 amino‐acid domain involved in cyclin binding. So far, three classes of CDKs with a PSTAIRE‐divergent motif have been recognized: members of one class (Antma;CDKB1;1, Arath; CDKB1;1, Medsa;CDKB1;1, and Orysa;CDKB;1) contain a PPTALRE motif, whereas members of the second class (Antma;CDKB2;1 and Medsa;CDKB2;1) contain a PPTTLRE motif (Fobert et al., 1996; Segers et al., 1996; Magyar et al., 1997; Umeda et al., 1999) and one member of the last class (Dunte;CDKB;1) contains the PSTTLRE motif (Lin and Carpenter, 1999). Although Arath;CDKB2;1 and Arath;CDKB2;2 are very similar, they are members of two different classes, namely Arath;CDKB2;1 corresponds to the PSTTLRE‐containing class and Arath;CDKB2;2 belongs to the PPTTLRE class, suggesting that the two CDKs might associate with a specific subset of cyclins.

The second novel CKS1At‐interacting clone encodes the Arath; CDKB1;2 protein that shares 88% identity and 92% similarity with Arath;CDKB1;1 (Table 1). These two clones contain the same PPTALRE cyclin‐binding motif. Highly homologous CDK pairs (exhibiting 80–90% amino acid identities) have been identified from several plant species, including maize, rice, alfalfa, soybean, Antirrhinum, and pea (Colasanti et al., 1991; Hashimoto et al., 1992; Hirt et al., 1993; Miao et al., 1993; Fobert et al., 1994; Jacobs, 1995). Two very homologous CDK genes of alfalfa, designated Medsa;CDKA;1 and Medsa;CDKA;2 display different abilities to complement yeast cdc28 mutants blocked at the G₁‐to‐S and G₂‐to‐M phases, suggesting different roles in cell cycle regulation (Hirt et al., 1993). Therefore, it remains possible that the Arath;CDKB1;1 and Arath;CDKB1;2 genes fulfil different functions in the cell cycle.

In order to investigate a possible functional divergence, transcript profiles of the newly identified CDKs were compared with those of Arath;CDKA;1 and Arath;CDKB1;1 by semi‐quantitative RT‐PCR analysis in cell suspension cultures and in different plant organs, including root, leaf, inflorescence stem, and flower (Fig. 1). The RT‐PCR analysis was performed as already described (Magyar et al., 2000) with specific primer pairs for each CDK.

As published before, Arath;CDKA;1 transcripts were present in similar amounts in all examined tissues (Ferreira et al., 1991). The four Arath;CDKB genes were clearly upregulated in tissues with the highest mitotic activity, being flowers and actively dividing cell suspensions.

Remarkably, differences in spatial transcript accumulation were detected for closely related CDKs: for instance, transcripts of Arath; CDKB1;1, but not of Arath;CDKB1;2, can be seen in root tissue. Similarly, comparable amounts of Arath;CDKB2;1 and Arath;CDKB2;2 were detected in leaves and roots, but only Arath;CDKB2;1 transcripts were found in stems. Differential transcript distribution of closely related CDKs belonging to the same class reflects the existence of a fine regulatory mechanism of the cell cycle by different members of the multiple CDK family. Together with the enormous cyclin divergence (at least 26 different cyclin genes in the Arabidopsis genome; S Rombauts, personal communication), these results emphasize the complexity of the cell cycle control in plants.

Table 1.

Sequence similarity and identity (bold) between the different Arabidopsis CDKs

CDK	Arath;CDKA;1	Arath;CDKB1;1	Arath;CDKB1;2	Arath;CDKB2;1	Arath;CDKB2;2
Arath;CDKA;1	–	72	73	75	76
Arath;CDKB1;1	55	–	92	78	79
Arath;CDKB1;2	55	88	–	78	78
Arath;CDKB2;1	54	65	63	–	93
Arath;CDKB2;2	55	66	65	88	–

Fig. 1.

Transcriptional analysis of Arabidopsis CDKs. First‐strand cDNA of mRNA from flowers, leaves, roots, inflorescence stems, and cell suspension cultures was amplified by PCR using oligonucleotide primers that annealed specifically to members of each CDK class. Amplified DNAs were separated on a 1% agarose gel, blotted, and hybridized with CDK probes. Actin 2 served as an internal loading control for the RT‐PCR.

1

The sequences of the cDNAs reported here have been deposited in the EMBL database under the accession numbers AJ297936 (CDKB2;1) and AJ297937 (CDKB1;2).

2

To whom correspondence should be addressed. Fax: [phone]. E‐mail: [email protected]

The authors wish to thank Dr James Dat for critical reading of the manuscript and Martine De Cock for help in preparing it. This work was supported by grants from the Interuniversity Poles of Attraction Programme (Belgian State, Prime Minister's Office—Federal Office for Scientific, Technical and Cultural Affairs; P4/15) and the European Union (ECCO QLG2‐CT1999‐00454). VB and LDV are indebted to the Vlaams Instituut voor de Bevordering van het Wetenschappelijk‐Technologisch Onderzoek in de Industrie and the Research Fund of the Ghent University for a predoctoral and postdoctoral fellowship, respectively.