-
PDF
- Split View
-
Views
-
Cite
Cite
Alice Trivellini, Antonio Ferrante, Paolo Vernieri, Giovanni Serra, Effects of abscisic acid on ethylene biosynthesis and perception in Hibiscus rosa-sinensis L. flower development, Journal of Experimental Botany, Volume 62, Issue 15, November 2011, Pages 5437–5452, https://doi.org/10.1093/jxb/err218
- Share Icon Share
Abstract
The effect of the complex relationship between ethylene and abscisic acid (ABA) on flower development and senescence in Hibiscus rosa-sinensis L. was investigated. Ethylene biosynthetic (HrsACS and HrsACO) and receptor (HrsETR and HrsERS) genes were isolated and their expression evaluated in three different floral tissues (petals, style–stigma plus stamens, and ovaries) of detached buds and open flowers. This was achieved through treatment with 0.1 mM 1-aminocyclopropane-1-carboxylic acid (ACC) solution, 500 nl l−1 methylcyclopropene (1-MCP), and 0.1 mM ABA solution. Treatment with ACC and 1-MCP confirmed that flower senescence in hibiscus is ethylene dependent, and treatment with exogenous ABA suggested that ABA may play a role in this process. The 1-MCP impeded petal in-rolling and decreased ABA content in detached open flowers after 9 h. This was preceded by an earlier and sequential increase in ABA content in 1-MCP-treated petals and style–stigma plus stamens between 1 h and 6 h. ACC treatment markedly accelerated flower senescence and increased ethylene production after 6 h and 9 h, particularly in style–stigma plus stamens. Ethylene evolution was positively correlated in these floral tissues with the induction of the gene expression of ethylene biosynthetic and receptor genes. Finally, ABA negatively affected the ethylene biosynthetic pathway and tissue sensitivity in all flower tissues. Transcript abundance of HrsACS, HrsACO, HrsETR, and HrsERS was reduced by exogenous ABA treatment. This research underlines the regulatory effect of ABA on the ethylene biosynthetic and perception machinery at a physiological and molecular level when inhibitors or promoters of senescence are exogenously applied.
Introduction
The senescence of many flowers is controlled by the plant hormone ethylene. The induction and production of ethylene vary during the development of the flower, but its effect, as a trigger of flower senescence, occurs during full anthesis (Manning, 1985; Peiser, 1986; Woodson et al., 1992). Studies of ethylene biosynthetic pathways have led to the identification of the main enzymes involved, such as 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) and oxidase (ACO). In addition, the availability of inhibitors acting at different levels in the ethylene signalling pathway could lead to a better understanding of its regulation (Wang et al., 2002).
A flower organ is made up of several different tissues, which have a differential rate of ageing. In carnation flowers it has been observed that an increase in ethylene production occurs first in the ovaries, followed by the styles, the receptacle, and then the petals (Jones and Woodson, 1997, 1999). Therefore, the coordination of the senescence process in flowers is due to intraorgan signals. The subsequent production of ethylene by different tissues is thought to be the signal that triggers the corolla senescence in response to pollination (Nichols, 1977).
With the isolation of genes coding for enzymes involved in the biosynthetic pathway of ethylene, a differential expression of these genes in various floral tissues was observed (O'Neill et al., 1993; ten Have and Woltering, 1997; Jones, 2003). Unlike ethylene production, the gene expression is initially high in the styles and then in other tissues in the presence of exogenous ethylene (Jones, 2003). However, in carnation flower, it has been demonstrated that the driving force for the activation of senescence, and the genes involved in it, is determined by the ovary (Shybuya et al., 2000; Nukui et al., 2004). An over-regulation has been reported for ACS and ACO genes, which are the direct precursors for the synthesis of ethylene. The involvement of ethylene in flower senescence and the role of different floral tissues have been clearly demonstrated.
Although ethylene plays an important role, which is necessary for senescence, the presence of ethylene is not enough to cause it. In fact, the presence of ethylene receptors and how these are expressed in different floral tissues are also essential to carry on the ageing process. Ethylene receptors have been described for ornamental plants such as carnation (Shibuya et al., 2002), rose (Müller et al., 2000a), and geranium (Dervinis et al., 2000). To date, five ethylene receptors have been identified in Arabidopsis: ETR1 (Chang et al. 1993), ERS1 (Hua et al., 1995), ETR2 (Sakai et al., 1998), EIN4, and ERS2 (Hua and Meyerowitz, 1998). Hua and Meyerowitz (1998) classified the receptors into two subfamilies based on sequence similarities and the structural features of proteins.
The regulation of the expression of receptor genes may has the purpose of increasing tissue sensitivity to ethylene by reducing the number of receptors, or decreasing the sensitivity by increasing expression of the receptor (Bleecker, 1999). However, some studies have also shown an induction of receptor gene expression in response to stress during senescence or in response to exogenous ethylene (Lashbrook et al., 1998; Tieman and Klee, 1999; Müller et al., 2000a, b). Indeed, the results obtained by studying the genes involved in ethylene perception can sometimes be in conflict, which is why this issue needs to be clarified.
In addition to ethylene, abscisic acid (ABA) accumulation also accelerates the senescence of cut flowers, as has been seen in carnation, rose, narcissus, and daylily, and thus is generally considered as a promoter of flower senescence (Mayak and Halevy, 1972; Mayak and Dilley, 1976; Eze et al., 1986; Le Page-Degivry et al., 1991; Panavas et al., 1998; Hunter et al., 2004). Flowering potted plants treated with exogenous ABA quickly lose their ornamental value. Potted roses treated with ABA shed their leaves and the senescence of flowers is accelerated. After ABA treatment some cultivars have shown an uncommonly early bud abscission, premature flowers, and leaf senescence (Müller et al., 1999). The ABA appears to increase the sensitivity of flowers to ethylene, as the gene expression of some ethylene receptors increased after exogenous ABA treatment (Müller et al., 2000a). Therefore, ABA may accelerate senescence by increasing the sensitivity of the flower, acting at the level of ethylene receptors.
Hibiscus rosa-sinensis provides a good model system for studying the developmental process of senescence, as previously reported by Woodson et al. (1985). In the ephemeral flowers of H. rosa-sinensis L., the flower life is limited to 24 h from corolla opening to corolla senescence; thus, the process that leads the flower to senesce is fast and dramatic.
In this work, the hormonal changes of ethylene and ABA, and the isolation and characterization of two putative ethylene receptor genes (HrsETR1 and HrsERS1) and two putative ethylene biosynthetic genes (HrsACS and HrsACO) were carried out in three different floral tissues during two distinct developmental stages (buds and fully opened flowers) of H. rosa-sinensis cv LaFrance, upon ACC, 1-MCP, and ABA treatment. The aim of this research was to elucidate the complex interplay among different effectors involved in the flower senescence process.
Materials and methods
Plant materials and growth conditions
Hibiscus rosa-sinensis L. ‘La France’ plants were used in all experiments. The plants were grown in a greenhouse under natural environmental conditions. Detached flowers were used as experimental material. All experiments were performed between 15 May and 30 September. Flowers were harvested between 07:30 h and 08:00 h either on the morning of flower opening (fully opened flowers) or on the morning of the day before opening (bud flowers). The lengths between the receptacles and the top of the curly corolla were recorded daily at (08.00 h) and were used to define the stages of bud development. The development and opening of buds to open flower is reported in Fig. 1. The bud stage (stage –1) used in these experiments referred to buds that were ready to open, meaning 24 h before opening. The open flowers (stage 0) were harvested when the anthers had not yet opened. The cut flowers were immediately placed in a controlled growth chamber under the following environmental conditions: cool-white fluorescent light (100 μmol m−2 s−1) at 22±2 °C and ∼60% relative humidity.

Stages of H. rosa-sinensis flower development. Stage –4, sepals cover petals in length with an initial separation of sepals showing dark red coloured petals. Stage –3 and stage –2, petals are dark red, tightly curled within sepals. Stage –1, petals reach their full length with an initial petal unrolling. Stage 0, flower fully open. Petals are bright red. Stigmas are dark pink and soft in appearance. Multiple stamens are visible and the anthers are all undehisced, positioned below the stigma. Stage +1, corolla is in-rolled, petals are wilted, and the flower appearance has deteriorated. The stigma is not as soft as previously. All the anthers are dehisced and are discoloured with dark pink areas.
Treatment of flowers with chemicals
Whole detached flowers (bud and opened flowers), derived from the developmental stages described above and trimmed to 5 cm in stem length, were placed in 20 ml of distilled water for the control, in 20 ml of 0.1 mM ACC (Sigma, Italy) solution, or in a 0.1 mM ABA (Sigma, Italy) solution. For the 1-MCP treatment, the flowers were placed in 20 ml of distilled water and treated with 500 nl l−1 1-MCP (AgroFresh, Italy), by sealing them in a glass chamber and releasing the gas from the calculated weight of bound 1-MCP. Petals, style–stigma plus stamens, and ovaries were then carefully isolated from each treated flower and used in the subsequent molecular and physiological analysis.
Determination of endogenous ABA and ethylene production
ABA was determined by an indirect enzyme linked immunosorbent assay (ELISA) based on the use of DBPA1 monoclonal antibody, raised against S(+)-ABA (Vernieri et al., 1989). The ELISA was performed according to the method described by Walker-Simmons (1987), with minor modifications. Petals, style–stigma plus stamens, and ovary samples [100 mg fresh weight (FW)] were collected, weighed, frozen in liquid nitrogen, and then stored at –80 °C until analysis. ABA was measured after extraction in distilled water (water:tissue ratio=10:1 v/w) overnight at 4 °C. Plates were coated with 200 μl per well of ABA–4'-bovine serum albumin (BSA) conjugate and incubated overnight at 4 °C, then washed three times with 75 mM phosphate-buffered saline (PBS) buffer, pH 7.0, containing 1 g l−1 BSA and 1 ml l−1 Tween-20, keeping the third washing solution for 30 min at 37 °C. Next a 100 μl ABA standard solution or sample and, subsequently, 100 μl of DBPA1 solution (lyophilized cell culture medium diluted in PBS buffer containing 10 g l−1 BSA and 0.5 ml l−1 Tween-20, at a final concentration of 50 μg ml−1) were added to each well, and competition was allowed to occur at 37 °C for 30 min.
Plates were then washed again as described above and 200 μl per well of secondary antibody (alkaline phosphatase-conjugated rabbit anti-mouse; Sigma, Italy) in PBS buffer containing 10 g l−1 BSA and 0.5 ml l−1 Tween-20, at a final dilution of 1:2000) was added and incubated for 30 min at 37 °C. Plates were washed again and 200 μl per well of p-nitrophenyl phosphate were added and incubated for 30 min at 37 °C. Absorbance readings at 415 nm were obtained using an MDL 680 Perkin-Elmer microplate reader.
For each treatment, three independent samples were assayed in triplicate. Ethylene production was measured by enclosing petals or style–stigma plus stamens in 30 ml air-tight containers, whereas the ovaries, given their small dimension, were enclosed in 3 ml air-tight containers. Gas samples (2 ml) were taken from the headspace of the containers after 1 h incubation at 22±2 °C. The ethylene concentration in the sample was measured by a gas chromatograph (HP5890, Hewlett-Packard, Menlo Park, CA, USA) using a flame ionization detector (FID), a stainless steel column (150×0.4 cm i.d. packed with Hysep T), column and detector temperatures of 70 °C and 350 °C, respectively, and a nitrogen carrier gas at a flow rate of 30 ml min−1. Quantification was performed against an external standard and results were expressed on a fresh weight basis (pl h−1 g−1 FW).
Cloning of putative ethylene receptor and biosynthetic genes
Hibiscus rosa-sinensis genomic DNA was used as a template for PCR. Total DNA was isolated from leaves with a DNeasy plant mini kit (Qiagen, Italy), using 100 mg of ground plant material. A sequence comparison was made between the known ETR1, ERS1, ACS, and ACO sequences of different plant species from the NCBI gene bank (http://www.ncbi.nlm.nih.gov/). Degenerate primers for ETR/ERS were designed on highly conserved regions across plant species using multialignment software. The degenerate primers for ETR/ERS were designed on the amino acid conserved region ECALWMP/QFGAFIVLCGATH for forward primers and VVADQVAVAL/SHAAILE for reverse primers, while ACS primers were designed on IQMGLAENQL for forward and on MSSFGLVS for reverse primers. Finally the ACO degenerate primers were designed on the conserved regions DWESTF for forward and NLGDQLEVITNG for reverse primers (Table 1). Degenerate primer sequences and the consensus region corresponding to the relative amino acid residues of already known Arabidopsis ethylene receptors and biosynthetic genes are listed in Table 1. PCR was performed using a GoTaq Green Master Mix (Promega, Italy). PCR conditions for HrsETR, HrsERS, HrsACS, and HrsACO were: 2 min at 95 °C (initial denaturation), then 40 cycles consisting of 40 s at 95 °C (denaturation), 40 s at 40 °C (10 cycles), 45 °C (10 cycles), 50 °C (10 cycles), or 55°C (10 cycles) (annealing), and 50 s at 72 °C (extension), 5 min at 72 °C (final extension). The specific PCR product of 747 bp in size was amplified from a Hibiscus gene termed HrsETR, another PCR product of 724 bp was amplified from another gene termed HrsERS, a third PCR product of 920 bp was amplified from a Hibiscus gene called HrsACS, and a fourth of 179 bp was amplified from another gene called HrsACO. Fragments were purified using Wizard SV Gel and a PCR Clean-Up System (Promega) and cloned in a Topo-TA Cloning Kit (Invitrogen, Italy) for sequencing. Sequencing was performed using external facilities.
Primer pair used for the isolation of HrsETR, HrsERS, HrsACS, and HrsACO, and real-time PCR
Sequences 5'→3' | bp | |
Degenerate primers | 19 | |
ETR for | ARTGTGCHYTDTGGATGCC | |
ETR rev | CAGCATGWGAVAGWGCWACDGC | 22 |
ERS for | CAGTTTGGTGCTTTYATHGTTCTKTG | 26 |
ERS rev | TCYARDATDGCAGCATGWGAVAG | 23 |
ACS for | ATHCARATGGGTCTXGCXGARAATCA | 26 |
ACS rev | GANACCAADCCRAARCTNGACAT | 23 |
ACO for | TSGAYTTGGGAAAGYACHTTT | 21 |
ACO rev | CTTGAGGTGATCACCAATGG | 20 |
Real-time primers | ||
HrsETR for | TGCGGTCATGGTCCTTATTCTCC | 23 |
HrsETR rev | TCGGCGAGCCAAGTCTAAGTCA | 22 |
HrsERS for | CAGACCAGGTCGCCGTTGCT | 20 |
HrsERS rev | GCCTCTCGACGAGCCAAGTCC | 21 |
HrsACS for | GGCCTCCCTTTGCACTCCTGA | 21 |
HrsACS rev | TTCACCAGGATCAGCCAAGCAAAAG | 25 |
HrsACO for | CTGGACACGGTGGAAAGATTGAC | 23 |
HrsACO rev | CTTGGCTCCTTGCACGTCTTGTAA | 24 |
18S rRNA for | CATGGCCGTTCTTAGTTGGTG | 21 |
18S rRNA rev | CAATGATCTCCCCATCACG | 19 |
Sequences 5'→3' | bp | |
Degenerate primers | 19 | |
ETR for | ARTGTGCHYTDTGGATGCC | |
ETR rev | CAGCATGWGAVAGWGCWACDGC | 22 |
ERS for | CAGTTTGGTGCTTTYATHGTTCTKTG | 26 |
ERS rev | TCYARDATDGCAGCATGWGAVAG | 23 |
ACS for | ATHCARATGGGTCTXGCXGARAATCA | 26 |
ACS rev | GANACCAADCCRAARCTNGACAT | 23 |
ACO for | TSGAYTTGGGAAAGYACHTTT | 21 |
ACO rev | CTTGAGGTGATCACCAATGG | 20 |
Real-time primers | ||
HrsETR for | TGCGGTCATGGTCCTTATTCTCC | 23 |
HrsETR rev | TCGGCGAGCCAAGTCTAAGTCA | 22 |
HrsERS for | CAGACCAGGTCGCCGTTGCT | 20 |
HrsERS rev | GCCTCTCGACGAGCCAAGTCC | 21 |
HrsACS for | GGCCTCCCTTTGCACTCCTGA | 21 |
HrsACS rev | TTCACCAGGATCAGCCAAGCAAAAG | 25 |
HrsACO for | CTGGACACGGTGGAAAGATTGAC | 23 |
HrsACO rev | CTTGGCTCCTTGCACGTCTTGTAA | 24 |
18S rRNA for | CATGGCCGTTCTTAGTTGGTG | 21 |
18S rRNA rev | CAATGATCTCCCCATCACG | 19 |
All primers were designed using primer select software (Lasergene) or Primer3 online software (http://fokker.wi.mit.edu/primer3/input.htm).
Primer pair used for the isolation of HrsETR, HrsERS, HrsACS, and HrsACO, and real-time PCR
Sequences 5'→3' | bp | |
Degenerate primers | 19 | |
ETR for | ARTGTGCHYTDTGGATGCC | |
ETR rev | CAGCATGWGAVAGWGCWACDGC | 22 |
ERS for | CAGTTTGGTGCTTTYATHGTTCTKTG | 26 |
ERS rev | TCYARDATDGCAGCATGWGAVAG | 23 |
ACS for | ATHCARATGGGTCTXGCXGARAATCA | 26 |
ACS rev | GANACCAADCCRAARCTNGACAT | 23 |
ACO for | TSGAYTTGGGAAAGYACHTTT | 21 |
ACO rev | CTTGAGGTGATCACCAATGG | 20 |
Real-time primers | ||
HrsETR for | TGCGGTCATGGTCCTTATTCTCC | 23 |
HrsETR rev | TCGGCGAGCCAAGTCTAAGTCA | 22 |
HrsERS for | CAGACCAGGTCGCCGTTGCT | 20 |
HrsERS rev | GCCTCTCGACGAGCCAAGTCC | 21 |
HrsACS for | GGCCTCCCTTTGCACTCCTGA | 21 |
HrsACS rev | TTCACCAGGATCAGCCAAGCAAAAG | 25 |
HrsACO for | CTGGACACGGTGGAAAGATTGAC | 23 |
HrsACO rev | CTTGGCTCCTTGCACGTCTTGTAA | 24 |
18S rRNA for | CATGGCCGTTCTTAGTTGGTG | 21 |
18S rRNA rev | CAATGATCTCCCCATCACG | 19 |
Sequences 5'→3' | bp | |
Degenerate primers | 19 | |
ETR for | ARTGTGCHYTDTGGATGCC | |
ETR rev | CAGCATGWGAVAGWGCWACDGC | 22 |
ERS for | CAGTTTGGTGCTTTYATHGTTCTKTG | 26 |
ERS rev | TCYARDATDGCAGCATGWGAVAG | 23 |
ACS for | ATHCARATGGGTCTXGCXGARAATCA | 26 |
ACS rev | GANACCAADCCRAARCTNGACAT | 23 |
ACO for | TSGAYTTGGGAAAGYACHTTT | 21 |
ACO rev | CTTGAGGTGATCACCAATGG | 20 |
Real-time primers | ||
HrsETR for | TGCGGTCATGGTCCTTATTCTCC | 23 |
HrsETR rev | TCGGCGAGCCAAGTCTAAGTCA | 22 |
HrsERS for | CAGACCAGGTCGCCGTTGCT | 20 |
HrsERS rev | GCCTCTCGACGAGCCAAGTCC | 21 |
HrsACS for | GGCCTCCCTTTGCACTCCTGA | 21 |
HrsACS rev | TTCACCAGGATCAGCCAAGCAAAAG | 25 |
HrsACO for | CTGGACACGGTGGAAAGATTGAC | 23 |
HrsACO rev | CTTGGCTCCTTGCACGTCTTGTAA | 24 |
18S rRNA for | CATGGCCGTTCTTAGTTGGTG | 21 |
18S rRNA rev | CAATGATCTCCCCATCACG | 19 |
All primers were designed using primer select software (Lasergene) or Primer3 online software (http://fokker.wi.mit.edu/primer3/input.htm).
RNA extraction in floral tissues
Total RNA from petals, style–stigma plus stamens, and ovaries was extracted using a phenol–chloroform method. The extraction buffer contained 100 mM LiCl, 100 mM Tris–HCl, 10 mM EDTA, and 1% SDS (pH 8), and the RNA was extracted by phenol/chloroform (1:1 v/v) and then precipitated by 4 M LiCl overnight at –20 °C. The precipitate was washed twice with 70% and 100% ethanol, respectively. The pellet was then dissolved in 1.5 ml of water, and 1/10 vol. of 3 M Na-acetate and 2.5 vols of 100% ethanol were added and incubated overnight at –20 °C. The precipitate was washed twice with 70% and 100% ethanol, respectively, and then dissolved in RNase- and DNase-free water.
Quantitative reverse transcription-PCR (qRT-PCR) analysis
Genes expression was determined by qRT-PCR (ABI 7300, Applied Biosystem, Italy) using specific primers. Reverse transcription was performed with Superscript III (Invitrogen, Italy) using 1 μg of total RNA and a mix of random primers and oligo(dT). In order to avoid genomic DNA amplification, total RNA was treated with DNase I (Invitrogen, Italy) and the specific forward primer was designed across an intron-splicing zone. The SYBR green chemistry was used for gene expression analyses. Dissociation curves were performed to check for the absence of primer dimers and other amplification by-products. The amplification program was set to: one cycle at 50 °C for 2 min, then at 95 °C for 2 min; 40 cycles at 95 °C for 30 s; 55 °C for 1 min and 72 °C for 30 s (signal acquisition stage); 72°C, 10 min, and dissociation curve. The 18S rRNA was used as an internal control (Table 1). Specific primer pairs were designed across the splicing regions.
Results
Hibiscus rosa-sinensis flower development.
One H. rosa-sinensis flower takes 6 d to complete its development from bud sepal opening (showing colour) to full petal in-rolling (Fig. 1). In this work, two stages were considered, stage –1 and stage 0. Stage –1 was defined as a bud flower (on the morning of the day before opening) and stage 0 as a fully open flower (on the morning of flower opening). No differences in morphology or in the rate of development were noted for the flowers at different times during the flowering period. Moreover, in H. rosa-sinensis, detached flowers harvested at both stage –1 and stage 0 senesced over the same period as attached flowers, with full senescence symptoms at 24 h.
Cloning of two putative ethylene receptor gene fragments and two putative ethylene biosynthetic gene fragments
Isolation of putative ethylene receptors and enzymes involved in the biosynthesis of ethylene was performed using degenerate primers designed on highly conserved regions (Table 1). All PCR amplifications were performed using genomic DNA extracted from young leaves. PCRs yielded different fragments, which were isolated and cloned. Sequencing and BLAST analyses showed that partial genomic amplified DNAs had a high similarity to receptor genes and ethylene biosynthesis enzymes of other species. Amino acid multiple alignments of putative H. rosa-sinensis ethylene receptors was very similar to those of both ETR and ERS genes of other plant species. Blast analyses of HrsETR (accession no. EF190514) cDNA showed an identity of 83, 80, and 84%, respectively with ETR1 of Arabidopsis thaliana, Solanum lycopersicum (formerly Lycopersicon esculentum), and Prunus persica. HrsETR1 was 747 bp long with an internal intron of 217 bp detected with the splicing-specific sequence GT and AG.
The DNA fragment that had a high similarity to the ERS1 of other plant species, HrsERS1 (accession no. EF190113), belonged to subfamily 1 of ethylene receptors. The sequenced fragment was 747 bp in length and contained one intron with a size of 190 bp. At the nucleotide level, the HrsERS1 partial cDNA showed a 76, 73, 79, and 82% similarity to the ERS genes of A. thaliana, S. lycopersicum, Glycine max, and Pisum sativum, respectively.
PCR amplifications with ACS degenerate primers yielded a DNA fragment of 920 bp. Blast analyses showed a high similarity with ACS genes of other plant species. A multiple alignment of HrsACS (accession no. EU370930) showed that the amino acids were very similar to those of ACS genes of A. thaliana, Gossypium hirsutum, and Nicotiana tabacum with an identity of 69, 84, and 76%, respectively (Fig. 1B). The DNA fragment of 920 bp contained three introns with a total size of 428 bp. The DNA fragments amplified with ACO degenerate primers were 179 bp long. The blast analysis showed a similarity with the ACO gene family. A multiple alignment of HrsACO (accession no. GU233512) showed a similarity with that of other ACS genes of A. thaliana, G. hirsutum, and Lactuca sativa with an identity of 77, 83, and 78%, respectively.
Transcript accumulation of HrsACS, HrsACO, HrsETR, and HrsERS genes in different stages and flower tissues
The gene expression of enzymes involved in ethylene biosynthesis and perception was studied in different flower development stages and tissues. Spatial (flower tissues) and temporal (developmental stages) expression profiles are important in order to understand the initial signals of ethylene evolution and tissue sensitivity. The results should give a better overview of senescence initiation and the mechanisms of interorgan developmental regulation in H. rosa-sinensis flowers.
The transcript abundance of each gene was compared with the expression levels in different flowers at 1 h (see Supplementary Tables S1, S2, S7 available at JXB online). The gene expression of HrsACS in buds during the 9 h after detachment changed significantly in the three flower tissues (Fig. 2; Supplemetary Table S8).

Time-dependent expression of ethylene biosynthetic genes (HrsACS and HrsACO) and ethylene perception genes (HrsETR1 and HrsERS1) in Hibiscus rosa-sinensis after flower bud removal from the plant at stage –1. The relative expression level for all genes in petal (p), style–stigma plus stamens (s), and ovary (o) is expressed as fold changes in the expression level of all genes at 1 h, which is defined as 1.0. Values are the means of three biological replicates, and data were subjected to a one-way analysis of variance. Different colours for each floral tissue examined indicate significant differences (Tukey test, P <0.05). Grey indicates no change in gene expression, yellow indicates significant up-regulation of gene expression, and blue indicates significant down-regulation of gene expression, relative to controls at 1 h.
An up-regulation of HrsACS was detected after 6 h and declined at 9 h in petals. In style–stigma plus stamen tissues the transcripts only increased after 3 h. Instead in the ovaries the HrsACS gene expression was statistically higher at 3 h and 9 h. HrsACO, the enzyme in the last ethylene biosynthesis step, showed the same trend in the petals, with an up-regulation at 6 h. In style–stigma plus stamens, on the other hand, the HrsACO expression level was higher only at 9 h, while in the ovaries it was only higher at 3 h.
The ethylene perception genes and, in particular, HrsETR showed no change in the petals at the bud stage. The transcript abundance only increased after 3 h in style–stigma plus stamen tissues. The HrsETR expression level was significantly (P <0.05) lower in the ovaries after 6 h. HrsERS showed higher variations compared with HrsETR; in the petals the HrsERS expression level increased after 6 h and in style–stigma plus stamens it was significantly higher after 3 h and 9 h. In the ovaries HrsERS strongly increased after 3 h.
In the open flower stage HrsACS changed in expression only in the ovaries and was down-regulated after 3 h and 9 h compared with the flowers at 1 h (Fig. 3; Supplementary Table S9 at JXB online). No differences were found in petals and style–stigma plus stamen tissues. The HrsACO gene expression changed in all flower tissues. In petals, HrsACO transcripts were higher after 3 h and 9 h. The highest expression level was observed after 9 h in petals. In style–stigma plus stamen tissues the HrsACO expression level oscillated, decreasing after 3 h and 9 h with an increase at 6 h. On the other hand in the ovaries the expression of HrsACO increased only after 6 h.

Time-dependent expression of the ethylene biosynthetic genes (HrsACS and HrsACO) and ethylene perception genes (HrsETR1 and HrsERS1) in Hibiscus rosa-sinensis opened flowers removed from the plant at stage 0. The relative expression level for all genes in petal (p), style–stigma plus stamens (s), and ovary (o) is expressed as fold changes to the expression level of all genes at 1 h, which is defined as 1.0. Values are the means of three biological replicates, and data were subjected to a one-way analysis of variance. Different colours for each floral tissue examined indicate significant differences (Tukey test, P <0.05). Grey indicates no change in gene expression, yellow indicates significant up-regulation of gene expression, and blue indicates significant down-regulation of gene expression, relative to controls at 1 h.
HrsETR expression levels in open flowers were only lower in petals after 6 h. No differences were observed in style–stigma plus stamen and ovary tissues. The HrsERS expression profiles changed after 3 h and 9 h. In petals, HrsERS significantly decreased after 3 h and increased after 9 h. In style–stigma plus stamen tissues this ethylene receptor only increased after 3 h, while in the ovaries it was repressed at the same sampling time.
Temporal and spatial distribution of ethylene production and ABA content in bud and open flowers
Ethylene and ABA are the most important plant hormones involved in flower senescence. The relationship between them is not completely clear. Ethylene production and endogenous ABA content were determined during flower senescence (Table 2).
Changes in ethylene production and endogenous ABA content for each stage of H. rosa-sinensis flower development (B, bud; OF, open flower) and senescence
Stage | Timing (h) | Petals | S–S+S | Ovaries |
Ethylene (pl g −1 h −1 FW) | ||||
B | 1 | 683 a | 1698 a | 3747 a |
3 | 723 a | 1874 a | 2630 a | |
6 | 1231 b | 6488 b | 5625 b | |
9 | 1438 b | 9160 c | 15 322 c | |
OF | 1 | 598 a | 819 a | 950 a |
3 | 436 a | 1049 a | 4995 b | |
6 | 2010 b | 6644 b | 9672 c | |
9 | 3750 c | 6683 b | 16842 d | |
ABA content (ng g −1 FW) | ||||
B | 1 | 83 a | 173 a | 48 a |
3 | 179 b | 167 a | 101 a | |
6 | 239 c | 198 a | 87 a | |
9 | 164 b | 238 a | 284 b | |
OF | 1 | 347 a | 104 a | 85 a |
3 | 125 b | 208 b | 139 b | |
6 | 196 c | 163 c | 73 a | |
9 | 313 a | 51 d | 164 b |
Stage | Timing (h) | Petals | S–S+S | Ovaries |
Ethylene (pl g −1 h −1 FW) | ||||
B | 1 | 683 a | 1698 a | 3747 a |
3 | 723 a | 1874 a | 2630 a | |
6 | 1231 b | 6488 b | 5625 b | |
9 | 1438 b | 9160 c | 15 322 c | |
OF | 1 | 598 a | 819 a | 950 a |
3 | 436 a | 1049 a | 4995 b | |
6 | 2010 b | 6644 b | 9672 c | |
9 | 3750 c | 6683 b | 16842 d | |
ABA content (ng g −1 FW) | ||||
B | 1 | 83 a | 173 a | 48 a |
3 | 179 b | 167 a | 101 a | |
6 | 239 c | 198 a | 87 a | |
9 | 164 b | 238 a | 284 b | |
OF | 1 | 347 a | 104 a | 85 a |
3 | 125 b | 208 b | 139 b | |
6 | 196 c | 163 c | 73 a | |
9 | 313 a | 51 d | 164 b |
The flowers were held for 1, 3, 6, and 9 h in water solution. Data were subjected to a one-way analysis of variance and differences between developmental stages were analysed by a Bonferroni post-test. Different letters within columns denote significant differences at P ≤ 0.05.
Changes in ethylene production and endogenous ABA content for each stage of H. rosa-sinensis flower development (B, bud; OF, open flower) and senescence
Stage | Timing (h) | Petals | S–S+S | Ovaries |
Ethylene (pl g −1 h −1 FW) | ||||
B | 1 | 683 a | 1698 a | 3747 a |
3 | 723 a | 1874 a | 2630 a | |
6 | 1231 b | 6488 b | 5625 b | |
9 | 1438 b | 9160 c | 15 322 c | |
OF | 1 | 598 a | 819 a | 950 a |
3 | 436 a | 1049 a | 4995 b | |
6 | 2010 b | 6644 b | 9672 c | |
9 | 3750 c | 6683 b | 16842 d | |
ABA content (ng g −1 FW) | ||||
B | 1 | 83 a | 173 a | 48 a |
3 | 179 b | 167 a | 101 a | |
6 | 239 c | 198 a | 87 a | |
9 | 164 b | 238 a | 284 b | |
OF | 1 | 347 a | 104 a | 85 a |
3 | 125 b | 208 b | 139 b | |
6 | 196 c | 163 c | 73 a | |
9 | 313 a | 51 d | 164 b |
Stage | Timing (h) | Petals | S–S+S | Ovaries |
Ethylene (pl g −1 h −1 FW) | ||||
B | 1 | 683 a | 1698 a | 3747 a |
3 | 723 a | 1874 a | 2630 a | |
6 | 1231 b | 6488 b | 5625 b | |
9 | 1438 b | 9160 c | 15 322 c | |
OF | 1 | 598 a | 819 a | 950 a |
3 | 436 a | 1049 a | 4995 b | |
6 | 2010 b | 6644 b | 9672 c | |
9 | 3750 c | 6683 b | 16842 d | |
ABA content (ng g −1 FW) | ||||
B | 1 | 83 a | 173 a | 48 a |
3 | 179 b | 167 a | 101 a | |
6 | 239 c | 198 a | 87 a | |
9 | 164 b | 238 a | 284 b | |
OF | 1 | 347 a | 104 a | 85 a |
3 | 125 b | 208 b | 139 b | |
6 | 196 c | 163 c | 73 a | |
9 | 313 a | 51 d | 164 b |
The flowers were held for 1, 3, 6, and 9 h in water solution. Data were subjected to a one-way analysis of variance and differences between developmental stages were analysed by a Bonferroni post-test. Different letters within columns denote significant differences at P ≤ 0.05.
Ethylene production was higher in the ovaries and lower in petals, while intermediate ethylene production was shown in style–stigma plus stamen tissues. In the ovaries ethylene declined during the first 3 h and progressively increased after 6 h and 9 h, reaching on average the highest values of 15 nl g−1 h−1 (Table 2). Ethylene production in petals and style–stigma plus stamens increased during the time frame of the experiment. Compared with the values obtained at 9 h and 1 h, ethylene production increased by 2.1-fold in petals, 5.4-fold in style–stigma plus stamens, and 4.1-fold in ovaries.
In open flowers the ethylene evolution in the different organ tissues had the same trend as observed in buds. The highest values were observed in the ovaries, intermediate values were found in style–stigma plus stamens, and the lowest values were in petals. Ethylene production increased over time: from 1 h to 9 h by 6.3-fold in petals, 8.2-fold in style–stigma plus stamens, and 17.7 fold in ovaries (Table 2).
The endogenous ABA measured in the different flower organs of the bud stage was higher in petals and style–stigma plus stamens in the first 6 h. In these tissues, the ABA content increased over time. In the ovaries, ABA content oscillated but without significant differences, while after 9 h it increased significantly, reaching the highest values among flower organs at the bud stage.
In the open flowers the ABA content was higher in petals compared with style–stigma plus stamens and ovaries. In petals, ABA decreased during the intermediate data points (3 h and 6 h) and the highest values were found after 1 h and 9 h. In style–stigma plus stamens the ABA content increased after 3 h and progressively declined to its lowest values of 51 ng g−1 FW. In the ovaries endogenous ABA oscillated, with an increase after 3 h and 9 h (Table 2).
Effects of exogenous ACC, 1-MCP, and ABA on H. rosa-sinensis flowers
To better understand the specific temporal/tissue ethylene production and endogenous ABA accumulation, the morphological changes of buds (stage –1) and flowers (stage 0) were first monitored after removal from the plant and following ACC, 1-MCP, and ABA treatments. The application of treatment for 9 h did not cause any visible morphological alteration in Hibiscus bud flowers (data not shown). In open flowers (Fig. 4), ACC treatment significantly promoted flower senescence; in fact, the characteristic petal in-rolling that accompanies Hibiscus flower senescence was accelerated under ACC treatment compared with the control. In addition, exogenously applied ABA accelerated flower senescence, and the effect was slightly less pronounced compared with the ACC application. In contrast to the ACC and ABA treatments, 1-MCP significantly impeded in-rolling of the petals.

Effects of ACC, 1-MCP, and ABA on opened flowers (stage 0). Flowers were treated with 0.1 mM ACC, 500 ppb 1-MCP, and 0.1 mM ABA for 9 h.
Effects of exogenous ACC, 1-MCP, and ABA on the ethylene biosynthesis of H. rosa-sinensis flowers
The interaction between ethylene and ABA in Hibiscus flower development was investigated using an ethylene inhibitor (1-MCP) or promoter (ACC) and the hormone ABA.
In petals from ACC-treated bud flowers, ethylene production increased after 1 h and 9 h of treatment. The ethylene evolution increased after 9 h of 1-MCP treatment, showing the highest value (Fig. 5A). The ABA-treated flowers significantly decreased ethylene production after 6 h and 9 h. In style–stigma plus stamens from ACC-treated bud flowers, ethylene production increased after 3 h, but the highest values were found after 6 h and 9 h (Fig. 5B). Ethylene production in style–stigma plus stamens from 1-MCP-treated buds increased for 6 h then decreased to the initial values.

Effects of exogenous ACC, 1-MCP, and ABA treatments on ethylene production in flower buds and open flowers of H. rosa-sinensis at four different time points. The flowers were treated with 0.1 mM ACC (filled squares), 500 ppb 1-MCP (filled upright triangles), 0.1 mM ABA (filled inverted triangles), or untreated (open circles). Data were subjected to a two-way analysis of variance. The *, #, and § symbols above each data point indicate a significant difference (Bonferroni post-test, P <0.05) of ethylene production after ACC, 1-MCP, and ABA treatment (related to the control), respectively. S–S+S: style–stigma plus stamens. Error bars indicate the standard deviation.
Ethylene production in ABA-treated buds was similar to that in the controls. Ethylene production in ovaries of bud flowers (Fig. 5C) responded early to ACC and 1-MCP treatments. After 1 h the production increased by almost 1- and 2-fold, in ovaries from ACC- and 1-MCP-treated buds, respectively. Ethylene production in 1-MCP-treated ovaries peaked at 3 h and decreased at the termination point. ACC treatment increased the ethylene evolution, by ∼2-fold at 6 h, and then remained at a constant level. The ovaries from ABA-treated bud flowers showed an increase in ethylene production after 6 h.
In petals of opened flowers ethylene production (Fig. 5D) was clearly enhanced, by ∼3-fold, after 3 h of ACC treatment, but after 6 h and 9 h it did not increase. Petals from ABA-treated open flowers showed an appreciable reduction in ethylene evolution after 9 h of treatment. The style–stigma plus stamen tissues in ACC-treated open flowers (Fig. 5E), responded by considerably enhancing ethylene production, which peaked at 6 h, and was then maintained at a constant level. The style–stigma plus stamens from 1-MCP-treated open flowers showed a doubled ethylene production after 6 h, but ABA treatment, on the other hand, reduced the evolution after 6 h and 9 h. Ethylene production of ovaries from ACC-treated flowers (Fig. 5F) showed an increase after 3 h, reached its maximum value at 6 h, and was then constant. After 3 h, 1-MCP treatment significantly enhanced ethylene production in the ovary tissues, but after 9 h ethylene production was reduced. The ovary tissues of open flowers responded to ABA treatment by diminishing ethylene production after 6 h and 9 h.
A particularly interesting finding was that ovary tissues in the early stage of development initially responded to ACC and 1-MCP treatments. The results show that generally ABA suppressed ethylene evolution at the late time points; however, ABA treatment was found to be effective in accelerating senescence in H. rosa-sinensis flowers.
ABA content in different floral tissues treated with ACC and 1-MCP
The changes in ABA content, in bud and open flowers, after treatment with ACC and 1-MCP were monitored throughout the experiment. The ethylene receptor inhibitor increased the ABA content in petals of buds immediately after 1 h of treatment and remained constant throughout the experiment (Fig. 6A). The ACC treatment showed the same trend as the controls for 3 h then decreased and reached the lowest values after 9 h. The ABA in style–stigma plus stamen tissues rapidly increased in ACC-treated flowers. reaching the highest values, 340 ng g−1 FW, after 6 h (Fig. 6B). The 1-MCP lowered the ABA content in style–stigma plus stamens throughout the whole experimental period although there were no significant differences. In the ovaries (Fig. 6C) the exogenously applied ACC on bud flowers prevented ABA accumulation, with values ranging from 180 ng g−1 FW to 90 ng g−1 FW. The ovaries from 1-MCP-treated flowers showed the same ABA trend as the controls but with higher values, which almost doubled for the first 6 h.

Effects of exogenous ACC and 1-MCP treatments on endogenous ABA content in flower buds and open flowers of H. rosa-sinensis at four different time points. The flowers were treated with 0.1 mM ACC (filled squares) or 500 ppb 1-MCP (filled triangles), or untreated (open circles). Data were subjected to a two-way analysis of variance. The * and # symbols above each data point indicate a significant difference (Bonferroni post-test, P <0.05) of ethylene production upon ACC or 1-MCP treatment (related to the control), respectively. S–S+S: style–stigma plus stamens. Error bars indicate the standard deviation.
In the open flowers the effects of treatments were similar to those observed in the bud stage. The ABA content in petals (Fig. 6D) from flowers treated with ACC did not increase and showed the same trends as the controls for the first 6 h, but then significantly decreased. In 1-MCP-treated flowers the ABA content was similar for 3 h then sharply increased, reaching the highest value of 400 ng g−1 FW. After 9 h the ABA content was <200 ng g−1 FW. In the style–stigma plus stamens (Fig. 6E) in ACC-treated flowers, the ABA content did not change significantly for the first 6 h, while after 9 h it was higher compared with the controls. In contrast, 1-MCP stimulated ABA biosynthesis and doubled it for the first 3 h, and then declined, showing values <100 ng g−1 FW after 6 h and 9 h. In the ovaries the ABA content in ACC-treated flowers showed the same trends as the controls for 6 h, and then was significantly lower. In the ovaries from 1-MCP-treated flowers the ABA content increased after 1 h then declined until it reached the same concentrations as those found in the ACC treatments (Fig. 6F).
Expression of HrsACS, HrsACO, HrsETR, and HrsERS genes in bud flowers after ACC, 1-MCP, and ABA treatments
The ethylene biosynthetic and perception pathway was also investigated at a molecular level in bud flowers (Fig. 7; Supplementary Tables S1, S3, S5 at JXB online). The HrsACS expression in petals from ACC-treated flowers was up-regulated at the bud stage. During the experimental period the HrsACS expression declined and no differences were observed after 9 h. In petals from 1-MCP-treated buds, the HrsACS expression did not differ from the controls for 3 h, while it was strongly down-regulated after 6 h. In ABA-treated flowers, HrsACS was up-regulated after 1 h and down-regulated after 6 h, while no differences were observed after 3 h and 9 h. In the style–stigma plus stamen tissues of flower buds, the HrsACS transcripts were affected by treatments only after 3 h. They were down-regulated by ACC and 1-MCP, while they were up-regulated in the ABA treatment. In the ovaries of buds HrsACS was significantly down-regulated in the ACC treatment after 3 h and 9 h. After 1-MCP was exogenously applied, HrsACS expression was strongly induced within 1 h and 3 h, and was then down-regulated at 6 h and 9 h. In the ABA-treated flowers the HrsACS transcripts increased after 1 h and 6 h, while they were significantly lower after 3 h.

Effects of ACC, 1-MCP, and ABA treatments on the expression of genes involved in ethylene biosynthesis and perception. Bud flowers were treated with 0.1 mM ACC, 500 ppb 1-MCP, and 0.1 mM ABA. Gene expression levels were determined by qRT-PCR, and are expressed as fold change relative to the transcript abundance in the control flowers. The flower tissues examined were: petals, style–stigma plus stamens (S–S+S), and ovaries. Values are the means of three biological replicates and are displayed as a row of coloured boxes. Each timing treatment is represented by a row of coloured boxes, and each exogenous treatment is represented by a single column. Effects of chemicals shown as red to brighter red and blue to brighter blue indicate significant up-regulation or down-regulation of gene expression, respectively. The maximum value for image contrast was determined for each gene assessed. The *, ** and *** symbols in each coloured box indicate significant differences in gene expression (related to the controls) at P <0.05, P <0.01, and P <0.001, respectively, assessed by a Bonferroni post-test.
Regarding the expression of the last enzyme involved in ethylene biosynthesis, HrsACO was strongly up-regulated by ACC and ABA in petals after 1 h and 3 h. In contrast, after 6 h HrsACO was down-regulated in 1-MCP and ABA treatments. In the style–stigma plus stamen bud tissues HrsACO expression was mainly influenced by treatments at the end of the time course (9 h). After 6 h HrsACO was up-regulated in style–stigma plus stamen tissues in ABA-treated buds, while it was down-regulated in all treatments after 9 h. In the ovaries, on the other hand, the HrsACO expression changes were mainly observed after 3 h and 6 h. In the ovaries of buds treated with ACC and ABA, the HrsACO transcripts were lower than in the controls after 3 h, while they were up-regulated after 6 h in all treatments.
The gene expression of HrsETR in the petals of buds was up-regulated in all treatments after 1 h and with ACC and ABA treatments after 3 h and 9 h. The HrsETR in style–stigma plus stamens was up-regulated in all treatments after 3 h and 6 h. In the ovaries, the gene expression of this receptor was down-regulated by ACC and 1-MCP after 1 h and 9 h, while it was up-regulated after 3 h in the 1-MCP treatment and after 6 h in the ACC treatment. In the ABA-treated flowers HrsETR expression was up-regulated after 1 h and 6 h, and down-regulated after 9 h as observed in the ACC and 1-MCP treatments. The HrsERS expression in petals was up-regulated in all treatments after 1 h, and in ACC and ABA treatments after 3 h. On the other hand, after 6 h HrsERS was down-regulated in 1-MCP- and ABA-treated buds. In the style–stigma plus stamen tissues, the HrsERS transcripts were lower in all treatments, except after 6 h in the ABA-treated buds. In the ovaries, significant variations in HrsERS gene expression were observed after 3 h. The HrsERS expression was lower in the ovaries of buds treated with ACC and ABA.
Expression of HrsACS, HrsACO, HrsETR, and HrsERS genes in open flowers after ACC, 1-MCP, and ABA treatments
The ethylene biosynthetic and perception pathway was also investigated at a molecular level in open flowers (Fig. 8; Supplementary Tables S2, S4, S6 at JXB online). In petals, the HrsACS gene expression was mainly down-regulated in all treatments except after 3 h in ABA-treated flowers. The ACC treatment lowered the HrsACS transcript abundance after 3–9 h. The 1-MCP treatment after 3 h significantly down-regulated the HrsACS gene expression in petals. The ABA treatments increased the HrsACS expression level after 3 h, while they repressed the transcripts of this gene after 6 h and 9 h. In the style–stigma plus stamen tissues, HrsACS gene expression was only up-regulated following 1 h and 9 h of ACC treatment. Instead ABA repressed HrsACS transcript accumulation after 1 h and 3 h of the time course. The 1-MCP treatment significantly lowered HrsACS gene expression only after 3 h. In the ovaries, the HrsACS expression levels decreased after 1 h in all treatments and with 1-MCP and ABA treatments after 6 h. The HrsACS gene was only up-regulated in the ACC treatment after 6 h.

Effects of ACC, 1-MCP, and ABA treatments on the expression of genes involved in ethylene biosynthesis and perception. Open flowers were treated with 0.1 mM ACC, 500 ppb 1-MCP, and 0.1 mM ABA. Gene expression levels were determined by qRT-PCR, and are expressed as fold change relative to the transcript abundance in control flowers. The flower tissues examined were: petals, style–stigma plus stamens (S–S+S), and ovaries. Values are the means of three biological replicates and are displayed as a row of coloured boxes. Each timing treatment is represented by a row of coloured boxes, and each exogenous treatment is represented by a single column. Effects of chemicals shown as red to brighter red and blue to brighter blue indicate significant up-regulation or down-regulation of gene expression, respectively. The maximum value for image contrast was determined for each gene assessed. The *, ** and *** symbols in each coloured box indicate significant differences in gene expression (related to the controls) at P <0.05, P <0.01, and P <0.001, respectively, assessed by a Bonferroni post-test.
The HrsACO gene in petals of open flowers was up-regulated as soon as after 1 h of ACC and ABA treatments.
The HrsACO in petals from ACC-treated flowers was down-regulated after 3 h and 9 h, in 1-MCP-treated flowers after 3 h, and in ABA-treated flowers after 9 h. In style–stigma plus stamen tissues the HrsACO mRNAs were enhanced by ACC treatment after 1 h and 9 h, and by ABA after 3 h. In contrast, HrsACO gene expression was down-regulated after 6 h in all treatments. In the ovaries, HrsACO up-regulation was initially only observed following 1 h of 1-MCP treatment. The same treatment showed the opposite effect after 9 h. The ACC treatment did not affect this gene, while ABA repressed the transcript accumulation after 6 h and 9 h.
The two isolated genes involved in ethylene perception were influenced in different ways by the treatments. The HrsETR mRNAs were lower than the controls after 1 h in all treatments. The same results were observed after 3 h in ACC and 1-MCP treatments. The inhibition of HrsETR gene expression was also observed after 6 h and 9 h following ABA treatment.
In the style–stigma plus stamen tissues, the HrsETR gene expression was only influenced by ABA, which increased the transcript after 1 h and 9 h compared with the controls. In the ovaries the effect of the treatments on HrsETR was observed after 1 h. ACC and ABA inhibited HrsETR transcript accumulation, while 1-MCP treatment had the opposite effect. The effect of ABA treatment was also detected after 9 h.
HrsERS gene expression was up-regulated in all treatments but at different time points. ACC affected HrsERS immediately after 1 h and 6 h. In contrast, 1-MCP influenced HrsERS after 6 h and 9 h. ABA increased the HrsERS transcripts only after 3 h. In the style–stigma plus stamens in ACC-treated flowers, HrsERS was up-regulated throughout the whole experimental period. In the ovaries, HrsERS gene expression was down-regulated after 1 h following ACC and ABA, but up-regulated after 9 h in ACC-treated flowers. The 1-MCP treatment increased the expression of HrsERS after 3 h and 6 h, but inhibited the expression after 9 h as observed in the ABA treatment.
Discussion
Gene expression of HrsACS, HrsACO, HrsETR, and HrsERS, putative ethylene biosynthetic and receptor genes in H. rosa-sinensis, is involved in flower development and senescence
The isolation of components involved in ethylene biosynthesis and perception in H. rosa-sinensis, and the characterization of these genes, in natural senescence conditions or through the use of external hormonal stimuli, enabled the examination of the regulatory mechanism underlying the ethylene-sensitive process of flower senescence in depth.
Hibiscus flowers showed the first morphological–structural changes, from anthesis to the first senescence symptom characterized by petal in-rolling after 9 h. ACS and ACO genes are encoded by a multigene family, which exhibits differential tissue specificity at various stages of flower life and/or differential regulation by environmental or hormonal stimuli (Yang and Hoffman, 1984; Kende, 1993).
In the present study the expression analysis of both HrsACS and HrsACO genes revealed a high differential expression in H. rosa-sinensis tissues at the bud and open flower stages. These results suggest that at the early flower development stage, ACS and ACO genes are likely to be involved in the regulation of ethylene biosynthesis transcriptionally. This is because the results positively correlated with ethylene levels in isolated H. rosa-sinensis floral tissues, which showed a considerable ethylene production in style–stigma plus stamen and ovary tissues (Fig. 5B, C). In addition, in bud flowers, HrsACS transcript accumulation was greatly enhanced at an early stage in style–stigma plus stamen and ovary tissues (Fig. 2).
Similar evidence has been reported in carnation and petunia (Tang et al., 1994; Jones, 2002), and the present results may indicate that ethylene plays a role in the reproductive process of H. rosa-sinensis during the development of flowers. In open flowers, the results showed that ethylene production was effectively enhanced following detachment and was highest in ovaries, then style–stigma plus stamens, and lastly in petals (Fig. 5D–F).
Previous studies on rose cv White Sim and carnation have shown a positive regulation through an increase in both ethylene production and ACS expression as the flowers matured to senescence (Wang et al., 2004; Tanase et al., 2008). In contrast to these findings, in Hibiscus the HrsACS gene did not increase in the tissues examined, as senescence advanced (Fig. 3). It is reasonable to assume that ethylene biosynthesis is transcriptionally regulated at ACO levels during H. rosa-sinensis flower senescence, without the requirement for ACS gene transcription, as reported previously by Wang et al. (2002).
In fact, HrsACO showed an increase in its expression levels in different tissues as the ageing process advanced, and this was generally positively correlated with the increase in ethylene production. In other plant species such as Alstroemeria, a marked enhancement of ACO gene expression has been observed, rather than ACS, at the last stages of development (Wagstaff et al., 2005), and, in some rose cultivars, no changes in ACS transcripts during senescence have been reported (Müller et al., 2000b; Tanase et al., 2008). These discrepancies concerning the molecular regulation of the ethylene biosynthetic pathway among different plant species might be related to the fact that ACS and ACO enzymes are encoded by multifamily genes, with differential regulation in each tissue and in response to different stimuli.
During flower development, the expression of ethylene receptors seems to be involved in the regulation of flower tissue development. Hall and Bleeker (2003) reported several flower abnormalities and defects in Arabidopsis etr1-ers1 mutants. It is widely accepted that ethylene receptors regulate ethylene responses negatively, thus determining an inverse relationship between the transcript abundance of ethylene receptors and ethylene sensitivity (Hua and Meyerowitz, 1998; Bleecker, 1999). Transgenic tomato with reduced levels of LeETR4 were found to exhibit an acceleration of flower senescence, and the overexpression of Never ripe (Nr) gene determined a phenotype insensitive to ethylene (Ciardi et al., 2000; Tieman et al., 2000). Moreover, in Dianthus and Oncidium, the levels of DcERS2 and OgERS1 decreased during flower senescence, causing an enhancement of ethylene sensitivity (Shybuya et al., 2002; Huang et al., 2007). Several studies have also reported the expression of ethylene receptors to be up-regulated during flower senescence or in response to external stimuli (Vriezen et al., 1997; Müller et al., 2000a; Kuroda et al., 2003; Ma et al., 2006; Mutui et al., 2007).
In this study, although a decreased level in petal and ovary tissues at the open flower stage was observed 3 h after flower detachment (Fig. 3), the transcript accumulation of HrsERS, in both bud and open flower stages, was regulated in a tissue-specific manner, through a positive correlation with the progression of senescence, especially in petals and style–stigma plus stamens. In contrast, the HrsETR1 expression level decreased inversely with the concomitant climacteric peak in ethylene production shown by the petals of open flowers (Figs 3, 5D).
These results indicate that the HrsERS and HrsETR genes are differentially regulated by ethylene. However, it remains to be resolved whether the abundance (decrease or increase) of receptors can cause the inactivation of CTR components and the effective activation or inactivation of downstream components.
Ethylene controls flower senescence in Hibiscus
In the present study, in accordance with previous results (Woodson et al., 1985), ACC and 1-MCP treatments were found to accelerate and prevent petal in-rolling, respectively (Fig. 4). In-rolling characterizes the rapid and drastic senescence process in H. rosa-sinensis ethylene-sensitive flowers (Hoyer, 1996). To examine how ethylene influences the expression of ethylene biosynthetic genes in three different floral tissues at bud and open flower stages, the expression of HrsACS and HrsACO genes and ethylene production after ACC or 1-MCP treatment were determined. It is widely accepted that ethylene biosynthesis in ripening fruits and senescing flowers is subject to both positive and negative feedback regulation (Kende, 1993). A positive feedback regulation, through an increase in ethylene production triggered by exogenous ethylene, with the activation of ACS and/or ACO has been reported for petunia (Tang and Woodson, 1996), carnation (Jones and Woodson, 1997), and orchid (O'Neill et al., 1993). A negative feedback regulation has been shown for transgenic petunia flowers (Wilkinson et al., 1997), persimmon fruit (Zheng et al., 2006), and ripening tomato and banana (Nakatsuka et al., 1999; Inaba et al., 2007).
In this study, ethylene biosynthesis was found to be under both positive and negative feedback regulatory mechanisms in a tissue-temporal specific manner during flower development and senescence after treatments with ACC and 1-MCP. In petal and ovary tissues of open flowers, ethylene production (Fig. 5D, F) and the expression of ethylene biosynthetic genes after 3 h of ACC treatment and after 3 h and 9 h of 1-MCP treatment were under negative and positive feedback regulation, respectively (Fig. 8). On the other hand, in bud flowers tissues, this regulatory mechanism was diametrically opposed. A similar control mechanism between bud and open flower stages was also observed for style–stigma plus stamen tissues, but it was in contrast to previous results obtained for petals and ovaries. In fact, in style–stigma plus stamens from ACC-treated open flowers, ACC enhanced the transcript abundance of HrsACO after 1 h (Fig. 8) with an increase in ethylene production (Fig. 5E). On the other hand 1-MCP down-regulated the transcript abundance of HrsACO in style–stigma plus stamens after 6 h (Fig. 8), but did not inhibit ethylene production. In fact it had a stimulating effect at the end of the experimental time frame (Fig. 5E).
In petals and ovaries from open flowers, the reduction in gene expression of HrsACS under ACC treatment was a particularly intriguing result. It opened up the possibility that ACC content could exert an inhibitor-like effect on the regulation of ACS gene expression. Differences in HrsACS and HrsACO gene expression in response to ACC and 1-MCP treatments between buds and open flowers may modulate the differential sensitivity to ethylene, which is a consequence of unknown tissue-specific and developmental factors.
Similar to the present findings, others studies on climacteric fruit have reported a differential feedback regulation between pre-climacteric and ripening fruits and also between different tissues. In tomato pre-climacteric fruit, ethylene production is negatively feedback regulated by LeACS and LeACO genes. In addition, with an increase in ethylene production during the onset of the climacteric stage, the expression of LeACS and LeACO was markedly enhanced as a result of a positive feedback regulation (Nakatsuka et al., 1999). Inaba et al. (2007) showed that ethylene biosynthesis in banana fruit was under a negative feedback regulation mechanism in the pulp, whereas a positive feedback system operated in the peel.
In the perception regulatory machinery that causes ethylene responses, Hibiscus bud flowers treated with ACC and 1-MCP showed a complex regulation of ethylene receptor expression among different tissues. ACC treatment on bud flower tissues has led to an increase in ethylene production (Fig. 5A–C), confirming the presence of a very active ethylene-forming enzyme system at this early developmental stage (Woodson et al., 1985), and determining an overaccumulation of both HrsETR and HrsERS transcriptional levels in petals (Fig. 7). Petals and ovaries from ACC-treated open flowers showed an earlier (after 1 h) down-regulation of HrsETR gene expression (Fig. 7). Thus, the regulation of HrsETR under ACC treatment may have the purpose of increasing tissue sensitivity by reducing the number of its receptors (Bleecker, 1999).
When open flowers were treated with 1-MCP, the treatment increased HrsETR transcripts after 1 h, and HrsERS transcripts between 3 and 6h in the ovary tissues and after 9 h in the petals (Fig. 8), indicating a tissue-temporal specific reduction in ethylene sensitivity. These results are consistent with the standard model of ethylene signal transduction, which postulates that an increase in receptor abundance would result in a decreased sensitivity to ethylene (Bleeker, 1999). However, in the present study HrsETR and HrsERS expression patterns in style–stigma plus stamens strongly increased after ACC treatment (Fig. 8), showing that the regulation of ethylene receptors positively correlated with the accelerated senescence process of whole flowers. These results showed that possibly an ACC-induced and presumably ethylene-dependent senescence signal can be triggered by a positive increase in ethylene sensitivity through an enhancement of transcript abundance of both ethylene receptors in style–stigma plus stamen tissues.
Is ABA directly involved in Hibiscus flower senescence?
In H. rosa-sinensis open flowers, exogenous ABA may control the biosynthesis of ethylene via a feedback mechanism, as shown by the deferred decrease in ethylene production in all open flower tissues (Fig. 5D–F). This is further confirmed by the modulation of transcription activity of ethylene biosynthetic genes, which was consistent with the inhibition of ethylene biosynthesis (Fig. 8). Although ABA has been previously shown to enhance senescence symptoms by acting as a promoting stimulus through an increase in ethylene production (Panavas et al., 1998; Aneja et al., 1999; Müller et al., 1999), according to the findings presented here, the application of ABA promoted flower senescence and suppressed ethylene production in rose flowers (Mayak and Havely, 1972).
These observations suggest that the involvement of these two hormones in flower senescence is via the same signal transduction pathway. In addition, in H. rosa-sinensis, ABA may control ethylene biosynthesis and/or signalling in order to amplify its antagonistic effect on flower senescence. This antagonism between ABA and ethylene, which reciprocally regulate each other's metabolism and signalling pathway, is in keeping with a recent study on the antithetic cross-talk of these two hormones upon seed germination and early seedling growth in Arabidopsis (Cheng et al., 2009).
The role of ABA in the gynoecium as a trigger of flower senescence has been previously described as likely to be an accumulation of this hormone before the climacteric increment in ethylene production (Onoue et al., 2000). According to these results, in H. rosa-sinensis it appears that ABA accumulated early (3 h post-detachment) in the ovary and style–stigma plus stamen tissues (Fig. 6E, F). This took place before the climacteric increase in ethylene (Fig. 5E, F), and exogenous ABA treatment also affected the transcript abundance of ethylene biosynthetic and receptor genes early (Fig. 8). This would seem to support the key role played by the gynoecium as a trigger of flower senescence (Shybuya et al., 2000).
The endogenous concentration of ABA in H. rosa-sinensis during natural senescence was recently reported to be relatively low during early flower development, then peaked at the open flower stage and finally decreased during senescence (Trivellini et al., 2011). In this study, ABA content does not appear to change in open flowers over the 9 h period. However, when exogenous treatments with a promoter or inhibitor of senescence are imposed an alteration in ABA concentration was observed. In this study 1-MCP treatments determined a rapid change in ABA content, which led to a sequential increase, first in style–stigma plus stamens, then in petals (Fig. 6D, E), while in the ovary (Fig. 6F) it seems to decrease with time throughout the experiment. However in the latter stages, ABA content and flower longevity were respectively reduced (Fig. 6D–F) and enhanced (Fig. 4). The increase in 1-MCP-induced flower longevity might result from an initial tissue-specific counterbalance effect of ABA content and its successive decline in all flower tissues, thus confirming a possible role for ABA in flower longevity by regulating the ethylene perception pathway.
In conclusion, it is believed that the most important finding of the present study is that ABA has a regulatory effect on the ethylene biosynthetic and perception machinery at a physiological and molecular level. The findings would seem to show a refined regulatory mechanism of flower senescence in H. rosa-sinensis, where both ABA and ethylene are spatially and temporally involved in the coordination of differential ageing rates in flower tissues: (i) in ABA-accelerated flower senescence, both ethylene production and the transcriptional activity of ethylene biosynthetic genes decreased, showing that ethylene may be antagonized by ABA; (ii) its effects are most likely to target the ovary tissues by the prompt regulation of ethylene biosynthetic and receptor genes; (iii) 1-MCP appears to exert its positive effect on flower life through the up-regulation of HrsETR first in the ovary and later in petals with a consequent decrease in tissue sensitivity to ethylene and through the decline in ABA content in all flower organs; (iv) the accelerated flower senescence observed following ACC treatments may be derived from the simultaneous strong enhancement of both ethylene biosynthetic and receptor gene expression and ethylene production, in style–stigma plus stamens; and (v) ABA accumulation was substantially decreased in petals and ovaries at a later stage, thus showing that ABA may be antagonized by ethylene action.
Further research is needed, especially to determine the involvement of other plant hormones that could be spatially and temporally involved in the coordination of differential flower ageing rates. Currently, the distribution and action of cytokinins are under investigation in this species. Moreover, the isolation and characterization of the 9-cis-epoxycarotenoid dioxygenase (NCED) genes in H. rosa-sinensis might improve the understanding of the ABA–ethylene cross-talk during flower senescence.
This research was funded by the MIUR, PRIN 2007-2009 of Italy. A PhD scholarship was provided in part by Università degli Studi di Pisa and Sant'Anna School of Advanced Studies.
Comments