Abstract

Ancient DNA (aDNA) sequences, especially those of human origin, are notoriously difficult to analyze due to molecular damage and exogenous DNA contamination. Relatively few systematic studies have focused on this problem. Here we investigate the extent and origin of human DNA contamination in the most frequently used sources for aDNA studies, that is, bones and teeth from museum collections. To distinguish contaminant DNA from authentic DNA we extracted DNA from dog (Canis familiaris) specimens. We monitored the presence of a 148-bp human-specific and a 152-bp dog-specific mitochondrial DNA (mtDNA) fragment in DNA extracts as well as in negative controls. The total number of human and dog template molecules were quantified using real-time polymerase chain reaction (PCR), and the sequences were characterized by amplicon cloning and sequencing. Although standard precautions to avoid contamination were taken, we found that all samples from the 29 dog specimens contained human DNA, often at levels exceeding the amount of authentic ancient dog DNA. The level of contaminating human DNA was also significantly higher in the dog extracts than in the negative controls, and an experimental setup indicated that this was not caused by the carrier effect. This suggests that the contaminating human DNA mainly originated from the dog bones rather than from laboratory procedures. When cloned, fragments within a contaminated PCR product generally displayed several different sequences, although one haplotype was often found in majority. This leads us to believe that recognized criteria for authenticating aDNA cannot separate contamination from ancient human DNA the way they are presently used.

Introduction

The problems regarding ancient human DNA and contamination, often detected as several haplotypes from one single individual, have been known for a decade (Handt et al. 1994; Richards, Sykes, and Hedges 1995; Handt et al. 1996; Kolman and Tuross 2000; Hofreiter et al. 2001b). The implications of this problem have led to the development of a set of guidelines for authentication of ancient DNA (aDNA) results. These guidelines include the use of dedicated aDNA laboratories, biochemical preservation tests, multiple negative controls during extraction and amplification, quantification of the target DNA, cloning and sequencing of polymerase chain reaction (PCR) products, screening for human DNA in associated nonhuman remains, control of amplicon length, and reproducibility of results, both in-house and in a second laboratory (Pääbo, Gilford, and Wilson 1988; Kwok and Higuchi 1989; Handt et al. 1994; Cooper and Poinar 2000; Hofreiter et al. 2001b; Pääbo et al. 2004).

However, even when the guidelines are followed authenticated results have been questioned. Because potential modern contaminants share haplotypes with the ancient material, it is difficult to retrieve conclusive evidence for authenticity of the sequence (Abbot 2003). Others claim that, if the guidelines for authentication of aDNA are approved and fulfilled, the results must be accepted as being authentic (Barbujani and Bertorelle 2003). Postmortem damages to DNA and erroneous Taq polymerase incorporations have provided even more complexity to the discussion on authenticity (Hofreiter et al. 2001a; Gilbert et al. 2003; Bandelt 2004; Barbujani et al. 2004; Malyarchuk and Rogozin 2004; Vernesi et al. 2004).

The discussion is further complicated by studies detecting contamination in aDNA extracts even though accompanying negative controls show no indications of contamination (Cooper 1992; Handt et al. 1994; Kolman and Tuross 2000). This phenomenon has been explained by the so-called carrier effect, where low concentrations of contaminant DNA in PCR and extraction blanks are thought to be rendered PCR unamplifiable through adherence to plastic ware and equipment (Cooper 1992; Handt et al. 1994). An alternative explanation, as proposed by Richards, Sykes, and Hedges (1995) and Kolman and Tuross (2000), could be that it is the bone samples, rather than laboratory reagents, that are contaminated with modern DNA.

Although the contamination issue is not fully resolved, few efforts have been made to identify the extent of the problem. Here we examine the nature of contamination by real-time PCR quantification and by cloning and sequencing human mitochondrial DNA (mtDNA) molecules in nonhuman museum specimens and negative controls. Our data suggest that the criteria in use for authenticating aDNA results are not sufficient for work on DNA from ancient human tissue.

Materials

To separate between authentic aDNA and modern human contaminant DNA we sampled and extracted DNA from dogs (Canis familiaris). Twenty-nine bones and teeth from museum specimens were analyzed (table 1). Twenty-four of the specimens were from Neolithic settlement contexts dating approximately to 3300–2500 B.C. Three of the sites (Jettböle, Källsveden, and Ajvide) are located in the Baltic Sea area. One site is located in Eastern Central Sweden (Korsnäs) and another on the Swedish West coast (Dafter). One Neolithic specimen originated from a burial context in Central Sweden (Bergsgraven). Three specimens, dated to the medieval/early historical period, were recovered in urban contexts (Skara and Stockholm). One contemporary specimen from an osteological reference collection was also included. The bone was of German sheperd breed and had been defleshed from a fresh carcass in a veterinary laboratory in the 1970s. Twenty-one of the specimens where postcranial or cranial skeletal elements, while eight specimens originate from teeth (table 1). Because the bones from Korsnäs, Jettböle, and Ajvide were recovered scattered in the cultural layer of the sites, some of the samples taken from different skeletal elements may originate from the same individual. The specimens from Jettböle, Källsveden, and Dafter have been stored in museum collections since the beginning of the 20th century, whereas Bergsgraven, Korsnäs, the medieval specimens, and Ajvide originate from excavations in the 1950s, 1960s, mid-1980s, and 1990s, respectively. Most of the specimens have been washed, and all have undergone scientific osteological analyses. Some of the bones have been labeled with identification numbers directly on the surface.

Table 1

Sampled Dog Bones and Teeth


Specimen
 

Locality
 

Element
 
Younger stone age (approximately 3300–2500 B.C.  
Korsnäsa Tibia 
Korsnäsa Tibia 
Korsnäsa Tibia 
Korsnäsa Humerus 
Korsnäsa Humerus 
Jettböleb Ulna 
Jettböleb Humerus 
Jettböleb Tooth, molar 1 
Jettböleb Ulna 
10 Källsvedenc Humerus 
11 Dafterd Teeth, 2 incisors 
12 Bergsgravene Humerus 
13 Ajvidef Radius 
14 Ajvidef Radius 
15 Ajvidef Radius 
16 Ajvidef Radius 
17 Ajvidef Radius 
18 Ajvidef Femur 
19 Ajvidef Humerus 
20 Ajvidef Tooth, molar 1 
21 Ajvidef Tooth, molar 2 
22 Ajvidef Teeth, 2 incisors 
23 Ajvidef Tooth, molar 2 
24 Ajvidef Tooth, molar 1 
25 Ajvidef Tooth, molar 1 
Medieval/historical period (A.D. 1300–1500)   
26 Skara Ag Mandible 
27 Skara Bh Femur 
28 Stockholmi Radius 
Contemporary reference   
29
 
Contemporaryj
 
First phalanx
 

Specimen
 

Locality
 

Element
 
Younger stone age (approximately 3300–2500 B.C.  
Korsnäsa Tibia 
Korsnäsa Tibia 
Korsnäsa Tibia 
Korsnäsa Humerus 
Korsnäsa Humerus 
Jettböleb Ulna 
Jettböleb Humerus 
Jettböleb Tooth, molar 1 
Jettböleb Ulna 
10 Källsvedenc Humerus 
11 Dafterd Teeth, 2 incisors 
12 Bergsgravene Humerus 
13 Ajvidef Radius 
14 Ajvidef Radius 
15 Ajvidef Radius 
16 Ajvidef Radius 
17 Ajvidef Radius 
18 Ajvidef Femur 
19 Ajvidef Humerus 
20 Ajvidef Tooth, molar 1 
21 Ajvidef Tooth, molar 2 
22 Ajvidef Teeth, 2 incisors 
23 Ajvidef Tooth, molar 2 
24 Ajvidef Tooth, molar 1 
25 Ajvidef Tooth, molar 1 
Medieval/historical period (A.D. 1300–1500)   
26 Skara Ag Mandible 
27 Skara Bh Femur 
28 Stockholmi Radius 
Contemporary reference   
29
 
Contemporaryj
 
First phalanx
 
a

Grödinge parish, Uppland.

b

Jomala parish, Åland.

c

Saltvik parish, Åland.

d

Skee parish, Bohuslän.

e

Linköping in Östergötland.

f

Eksta parish, Gotland.

g,h

Mercurius (A) and Tor (B) districts of Skara in Västergötland.

i

Stockholm in Uppland.

j

Contemporary sample from an osteoarchaeological collection, Stockholm University.

Methods

Prevention of Contamination

Standard contamination precautions, such as working in a regularly UV-irradiated laboratory exclusively used for pre-PCR work on highly degraded DNA, were employed. Worktops for DNA extraction and PCR setup were separated and frequently cleaned with 1 M HCl, distilled water, and 95% ethanol. Laboratory personnel wore disposable facemasks, full zip suits, protective shoe covers, and sterile latex gloves. The facility was not entered if PCR products had been handled the same day. All equipment, disposables, and nonorganic buffers, except for the tubes used for the aDNA extracts, were autoclaved and/or UV irradiated at 254 nm in a crosslinker (Ultra-Violet Products Ltd., Cambridge, UK) with either 2.0 or 6.0 J/cm2. A separate laboratory was used for preparation and addition of the modern standard DNA to the real-time PCR reactions and for the carrier effect test.

DNA Extraction

The bones were cleaned using standard decontamination methods, the surfaces being brushed and UV irradiated with 0.5 J/cm2 at 254 nm on each side. All teeth were treated with q-tips soaked in 1 M HCl and subsequently with LiChrosolv water (Merck) and 95% ethanol. Teeth labeled 22–25 were cleaned as the teeth above and additionally UV irradiated as the bone samples. Before drilling, a layer of approximately 1 mm was removed from the sample surface by grinding using a drill. Two samples, containing between 70 and 180 mg of bone powder, were prepared from each specimen using a drill and disposable engraving cutters. The powder was collected onto pergamyne weighing papers and transferred into 2 ml polypropylene microtubes. DNA was extracted from the dog specimens using protocol C of the silica-spin column method (Yang et al. 1998). The duplicate samples were extracted at separate occasions, and extraction controls followed each extraction batch with a frequency of one control to every two to five extracts.

Real-time PCR Quantification

Mitochondrial genes are present in up to a thousand times higher concentration than nuclear genes in bone tissues (Smith et al. 2003) and are, for this reason, extensively used in aDNA studies (Handt et al. 1996; Krings et al. 1997; Stone and Stoneking 1998; Caramelli et al. 2003; Gilbert et al. 2003). Therefore, sequences from the control region of human and dog mtDNA were targeted in this study. To make the fragments compatible regarding PCR efficiency, preservation, and risk for extraneous DNA contamination, the fragments selected were of similar length. The human fragment was 148 bp including primer sites, spanning nucleotide positions 16104–16251 (Anderson et al. 1981). The dog fragment was 152 bp, spanning position 15541–15692 (Kim et al. 1998). Primers and TaqMan MGB probes (Applied Biosystems, Chesire, UK) for the fragments were designed using Primer Express version 2.0 (Applied Biosystems) and are presented in table 2.

Table 2

Primers and Probes for Human and Dog mtDNA Sequences


Namea
 

Sequence 5′ → 3′
 

Applicationb
 
dL15561F CGTCGTGCATTAATGGTTTGC PCR, qPCR, sequencing 
dL15561Fbio Biotin-CGTCGTGCATTAATGGTTTGC Hybridization 
dH15669R CATGGTGATTAAGCCCTTATTGGA PCR, qPCR, sequencing 
dH15669Rbio Biotin-CATGGTGATTAAGCCCTTATTGGA Hybridization 
dL15590MGB FAM-CATATAAGCATGTACATAATATT-MGB qPCR 
L16124F CTGCCAGCCACCATGAATATT PCR, qPCR, sequencing 
L16124Fbio Biotin-CTGCCAGCCACCATGAATATT Hybridization 
H16227R GGAGTTGCAGTTGATGTGTGATAGT PCR, qPCR, sequencing 
H16227Rbio Biotin-GGAGTTGCAGTTGATGTGTGATAGT Hybridization 
L16153MGB
 
FAM-TACCATAAATACTTGACCACCTG-MGB
 
qPCR
 

Namea
 

Sequence 5′ → 3′
 

Applicationb
 
dL15561F CGTCGTGCATTAATGGTTTGC PCR, qPCR, sequencing 
dL15561Fbio Biotin-CGTCGTGCATTAATGGTTTGC Hybridization 
dH15669R CATGGTGATTAAGCCCTTATTGGA PCR, qPCR, sequencing 
dH15669Rbio Biotin-CATGGTGATTAAGCCCTTATTGGA Hybridization 
dL15590MGB FAM-CATATAAGCATGTACATAATATT-MGB qPCR 
L16124F CTGCCAGCCACCATGAATATT PCR, qPCR, sequencing 
L16124Fbio Biotin-CTGCCAGCCACCATGAATATT Hybridization 
H16227R GGAGTTGCAGTTGATGTGTGATAGT PCR, qPCR, sequencing 
H16227Rbio Biotin-GGAGTTGCAGTTGATGTGTGATAGT Hybridization 
L16153MGB
 
FAM-TACCATAAATACTTGACCACCTG-MGB
 
qPCR
 
a

Primers and probes starting with dL or dH are dog specific and the ones starting with L or H are human specific.

b

qPCR is quantitative real-time PCR.

To create high-quality standard curves, to which our aDNA samples could be calibrated against, we manufactured specific standard DNA of known copy number for the two fragments targeted. DNA was isolated from human and dog blood samples using sodium dodecyl sulfate–urea extraction (Lindblom and Holmlund 1988) and phenol-chloroform extraction (Sambrock, Fritsch, and Maniatis 1989), respectively. The mtDNA fragments were specifically selected from the extracts by hybridization to sequence-specific biotinylated probes and immobilization to magnetic beads (Anderung et al. 2005). DNA was amplified (with preincubation for 10 min at 95°C, followed by 35 cycles of 20 s at 95°C, 20 s at 61°C for dog PCR or at 59°C for human PCR, 20 s at 72°C, and a final incubation step at 72°C for 10 min, for primers, see table 2) and purified using Geneclean Turbo for PCR kit (Qbiogene, Carlsbad, Calif.) according to the manufacturer's instructions. The DNA concentration was determined using PicoGreen P-7589 dsDNA quantitation kit (Molecular Probes, Leiden, the Netherlands) following the manufacturer's instructions. The florescence at 480/520 nm was measured on a Victor2 Multilabel Counter model 1420 (Wallac, Turku, Finland) using Wallac 1420 software version 2.0 (Wallac). The molecular weight of the fragments was calculated using an oligonucleotide weight formula (Ausubel et al. 1999) assuming nucleotide compositions identical to the reference sequences (Anderson et al. 1981; Kim et al. 1998). The number of copies was calculated from the molecular weight of the fragments, Avogadro's number (6.022 × 1023), and the DNA concentration.

The number of starting templates in the dog extracts was quantified using two real-time PCR assays, monitoring either the human or the dog fragment. Both aDNA extracts and the extraction controls were amplified in duplicates. PCR controls followed each amplification batch with a frequency of one control to every 2.5–12 reactions. The standard DNA was diluted into 10,000, 5,000, 1,000, 500, 250, and 125 copies per 10 μl, and the dilutions were amplified in quadruplicates. Real-time PCRs were conducted in 50-μl reactions containing 10 μl of DNA extract and 1 × QuantiTect Probe PCR mix (Qiagen), 900 nM of each forward and reverse primer, and 200 nM of the MGB probe in final concentrations (table 2). Amplification and detection of amplicons were performed in an ABI Prism 7700 Sequence Detector (Applied Biosystems). Thermal cycling conditions were preincubation for 15 min at 95°C, followed by 50 cycles of 15 s at 94°C and 60 s at 59°C. The assay was analyzed using the Sequence Detection System software, version 1.7 (Applied Biosystems). All CT values were estimated at the threshold of 0.10. A standard curve was generated in Excel (Microsoft) for each plate by plotting the CT values against the log of the number of starting template molecules in the standard DNA. If, occasionally, one standard clearly deviated from the trend line created from the rest of the standards it was considered an outlier and was subsequently removed. The linear relationship of the regression line was used to infer the amount of starting molecules in the aDNA extracts. The total number of starting molecules in each extract was calculated by multiplying the number of copies measured in the 10 μl used for real-time PCR with 4.5 (total volume of DNA extracts were 45 μl).

Carrier Effect

To investigate if negative results in negative controls might be false due to a carrier effect, we examined how the loss of template fragments was affected by the total amount of molecules in DNA extracts. Standard DNA from dog and human was used to simulate contaminant DNA and potential carrier molecules, respectively. The number of dog molecules in dog/human mixtures was quantified with real-time PCR. The mixtures were produced in duplicates containing 50, 250, or 5,000 input dog molecules mixed with 0, 50, 250, or 5,000 input human molecules. The samples were treated as in the aDNA extraction using authentic buffers, tubes, incubation times, temperature treatments, and centrifugation steps prior to the amplification.

Cloning and Sequencing

Nine of the contaminant human PCR products were cloned using JM109 competent cells and pGEM-T Vector System II cloning kit (both from Promega, Madison, Wisc.) according to the manufacturer's instructions. Recombinant colonies were further screened with PCR. The colonies were transferred into a 25-μl reaction mix containing the following in final concentrations: 1 × PCR buffer, 2.5 mM MgCl2, 1.5 U AmpliTaq Gold (all from Applied Biosystems), 200 μM of each dNTP, and 0.2 μM of M13 forward and reverse universal primers. Thermal cycling conditions were preincubation for 10 min at 95°C, followed by 35 cycles of 30 s at 94°C, 30 s at 50°C, and 30 s at 72°C. Clones with an insert of the expected size were identified by agarose gel electrophoresis.

Both contaminant human and authentic dog PCR products were sequenced in forward and reverse directions. The sequenced samples included 55 cloned human PCR products, 12 of the 116 real-time–derived human PCR products (11 samples from different specimens and one extraction control), as well as all dog-specific real-time–derived PCR products. The samples were cleaned with ExoSAP-IT (USB Corporation, Cleveland, Ohio) according to the manufacturer's instructions. Sequencing was performed using the DYEnamic cycle sequencing kit (Amersham Biosciences, Piscataway, N.J.), with the primers shown in table 2. The fragments were analyzed on a MEGABACE 1000 (Amersham Biosciences). Obtained nucleotide sequences were aligned manually using the BioEdit software and compared to GenBank sequences.

Statistical Computations

To assess differences in the amount of human and dog DNA retrieved from the dog specimens we used the Mann-Whitney U test. The average number of real-time–quantified human and dog molecules in each specimen was used to calculate the proportions of the two types of molecules. Differences between the two series of human amplifications from the dog bones, i.e., extraction one and two, and from the extraction blanks (treated as three sample sets) were tested using analysis of variance (ANOVA) and Tukey HSD posthoc. Data were transformed (Log10 [observation + 1]) to control for difference in variance in the three samples. The presence of a carrier effect was investigated by using an analysis of covariance, to see if the retrieved number of dog molecules was affected by different amounts of input human DNA in the samples. In the model the quantified dog DNA was the dependent variable, the amount of human input DNA was the independent class variable, and the input amount of dog DNA was used as the covariate. The homogeneity of slope was tested with the interaction between the amounts of input human DNA and the covariate. The variance of the measurements was roughly proportional to the measurement values, and thus the dog molecule data were Log2 adjusted prior to the analysis. For all sequences from each clone-derived human PCR product, the average number of nucleotide differences per site (Nei 1987) and the number of unique haplotypes were calculated. The diversity data were compared to 28 recently published cloned and sequenced PCR products from an aDNA study of human remains (Vernesi et al. 2004, data labeled “L16107/H16261”). ANOVA was used for the comparison. All calculations were performed using Statistica version 5.5 (StatSoft Inc., Tulsa, Okla.).

Results

Human mtDNA

All the 29 dog specimens contained amplifiable human DNA in all PCR quadruplicates (table 3), and the origin of the PCR products was confirmed in the 12 samples that were sequenced. Twenty-six of the 30 extraction controls and 12 of the 16 PCR controls contained PCR products. The maximum number of contaminating templates found in the controls was 87 and the average number of molecules was 39 (standard deviation [SD] ± 23) and 27 (SD ± 22) in extraction controls and in PCR controls, respectively.

Table 3

Number of Human and Dog mtDNA Templates in Each Dog Specimen


 

Human Sequencea,b
 
 
Dog Sequencea
 
 
Specimen
 
First Extraction
 
Second Extraction
 
First Extraction
 
Second Extraction
 
154 ± 54 14 ± 9 1 ± 1 
2,620 ± 410 595 ± 42 11 ± 15 52 ± 17 
2,761 ± 211 1,687 ± 34 24 ± 2 11 ± 1 
166,156 ± 18,612 4,378 ± 245 3,867 ± 183 2,097 ± 19 
161 ± 15 17 ± 13 
740 ± 73 134 ± 65 2 ± 2 1 ± 1 
1,018 ± 59 26 ± 10 2 ± 1 
731 ± 16 75 ± 6 
101 ± 53 69 ± 50 
10 1,208 ± 5 1,361 ± 138 
11 300 ± 76 170 ± 61 4 ± 6 
12 2,950 ± 185 311 ± 21 4,848 ± 595 3,246 ± 0 
13 64 ± 40 118 ± 24 1,466 ± 7 2,519 ± 103 
14 270 ± 121 142 ± 127 4 ± 5 1 ± 2 
15 587 ± 113 114 ± 21 2,208 ± 365 5,032 ± 366 
16 4,090 ± 239 8,296 ± 42 3,251 ± 246 2,996 ± 68 
17 171 ± 131 293 ± 65 505 ± 22 1,614 ± 463 
18 435 ± 51 45 ± 14 8 ± 2 79 ± 23 
19 215 ± 101 339 ± 26 4,593 ± 651 4,869 ± 596 
20 2,826 ± 530 68 ± 4 786 ± 19 1,836 ± 38 
21 238 ± 34 1,960 ± 86 1,225 ± 99 2,008 ± 33 
22 438 ± 57 6,002 ± 642 694 ± 43 1,411 ± 68 
23 53 ± 6 25,491 ± 356 4,220 ± 276 562 ± 78 
24 104 ± 4 38 ± 5 9 ± 12 21 ± 30 
25 67 ± 31 7,549 ± 597 1,895 ± 209 1,357 ± 195 
26 73 ± 15 35 ± 8 92 ± 46 54 ± 6 
27 309 ± 39 93 ± 62 917 ± 22 3,443 ± 453 
28 67 ± 3 133 ± 37 2,087 ± 119 1,635 ± 15 
29
 
91 ± 38
 
88 ± 25
 
457,684 ± 18,754
 
504,503 ± 0
 

 

Human Sequencea,b
 
 
Dog Sequencea
 
 
Specimen
 
First Extraction
 
Second Extraction
 
First Extraction
 
Second Extraction
 
154 ± 54 14 ± 9 1 ± 1 
2,620 ± 410 595 ± 42 11 ± 15 52 ± 17 
2,761 ± 211 1,687 ± 34 24 ± 2 11 ± 1 
166,156 ± 18,612 4,378 ± 245 3,867 ± 183 2,097 ± 19 
161 ± 15 17 ± 13 
740 ± 73 134 ± 65 2 ± 2 1 ± 1 
1,018 ± 59 26 ± 10 2 ± 1 
731 ± 16 75 ± 6 
101 ± 53 69 ± 50 
10 1,208 ± 5 1,361 ± 138 
11 300 ± 76 170 ± 61 4 ± 6 
12 2,950 ± 185 311 ± 21 4,848 ± 595 3,246 ± 0 
13 64 ± 40 118 ± 24 1,466 ± 7 2,519 ± 103 
14 270 ± 121 142 ± 127 4 ± 5 1 ± 2 
15 587 ± 113 114 ± 21 2,208 ± 365 5,032 ± 366 
16 4,090 ± 239 8,296 ± 42 3,251 ± 246 2,996 ± 68 
17 171 ± 131 293 ± 65 505 ± 22 1,614 ± 463 
18 435 ± 51 45 ± 14 8 ± 2 79 ± 23 
19 215 ± 101 339 ± 26 4,593 ± 651 4,869 ± 596 
20 2,826 ± 530 68 ± 4 786 ± 19 1,836 ± 38 
21 238 ± 34 1,960 ± 86 1,225 ± 99 2,008 ± 33 
22 438 ± 57 6,002 ± 642 694 ± 43 1,411 ± 68 
23 53 ± 6 25,491 ± 356 4,220 ± 276 562 ± 78 
24 104 ± 4 38 ± 5 9 ± 12 21 ± 30 
25 67 ± 31 7,549 ± 597 1,895 ± 209 1,357 ± 195 
26 73 ± 15 35 ± 8 92 ± 46 54 ± 6 
27 309 ± 39 93 ± 62 917 ± 22 3,443 ± 453 
28 67 ± 3 133 ± 37 2,087 ± 119 1,635 ± 15 
29
 
91 ± 38
 
88 ± 25
 
457,684 ± 18,754
 
504,503 ± 0
 
a

The average number (±SD) of mtDNA templates from duplicate amplification products quantified with real-time PCR.

b

The samples used for cloning are shown in boldface and the cloning results are reported in table 4.

The proportion of human DNA in the specimens was significantly higher (P = 0.0016) than the proportion of endogenous ancient dog DNA (fig. 1). There were also clear differences in human DNA content between the negative controls and the dog extracts, where the extracts contained significantly higher amounts of human DNA than the controls (P < 0.000001, F = 19.6 for the ANOVA and P = 0.0001 for both cases of the Tukey HSD test). The number of template molecules varied between 8 and 1,79,317 (table 3). The variation of human DNA concentration was broad between samples from the different specimens and between the two different DNA extracts from the same specimen, whereas the number of molecules in amplification duplicates from the same DNA extract was more similar to one another. The standard curves in the real-time PCR assay showed linear relationships with correlation coefficients with an average R2 of 0.9864 (SD ± 0.0093) between reactions and with slopes averaging 3.4203 (SD ± 0.1824).

FIG. 1.—

The proportion of human and dog DNA templates in extracts from ancient dog specimens are shown. There was a significantly higher proportion of human DNA than dog DNA in the extracts (Mann-Whitney U test, Z = 3.15, P = 0.0016). Error bars represent standard error.

FIG. 1.—

The proportion of human and dog DNA templates in extracts from ancient dog specimens are shown. There was a significantly higher proportion of human DNA than dog DNA in the extracts (Mann-Whitney U test, Z = 3.15, P = 0.0016). Error bars represent standard error.

Cloning of PCR products from nine different dog specimens produced between 3 and 11 sequences per specimen (table 4). The number of starting molecules in these cloned PCR products ranged from 69 to 1,66,156 templates (see table 3). Fourteen different haplotypes were found among the specimens (table 4). None of them were identical to the mtDNA of the researchers that were practically involved in this study (H.M., A.G., and J.S.). The clones presented from one (specimen 12 and 20) to six (specimen 14) unique haplotypes per PCR product. This could be compared to an earlier published data set, where approximately the same region of the human mtDNA was amplified in ancient human bones (Vernesi et al. 2004). Here, twenty-eight PCR products presented two to seven unique haplotypes each. No difference with respect to average number of nucleotide differences was detected in the two data sets (ANOVA, P = 0.72, U = 116, Z = −0.35).

Table 4

DNA Sequence Analysis of Cloned Human PCR Products


 

Polymorphic Sites in Human mtDNA
 
            
 
  No. of clones
 
   
Sample
 
6
 
2
 
3
 
4
 
7
 
2
 
3
 
9
 
2
 

 
5
 
3
 
4
 
 
CRS –  
Specimen 4 
 
Specimen 7 
 
 
Specimen 8 
 
 
 
Specimen 9 
 
Specimen 11 
 
Specimen 12 
Specimen 14 
 
 
 
 
 
Specimen 20 
Specimen 23 
 
H.M. n.d. 
A.G. n.d. 
J.S.
 
.
 
.
 
.
 
.
 
.
 
.
 
C
 
C
 
T
 
.
 
.
 
.
 
.
 
n.d.
 

 

Polymorphic Sites in Human mtDNA
 
            
 
  No. of clones
 
   
Sample
 
6
 
2
 
3
 
4
 
7
 
2
 
3
 
9
 
2
 

 
5
 
3
 
4
 
 
CRS –  
Specimen 4 
 
Specimen 7 
 
 
Specimen 8 
 
 
 
Specimen 9 
 
Specimen 11 
 
Specimen 12 
Specimen 14 
 
 
 
 
 
Specimen 20 
Specimen 23 
 
H.M. n.d. 
A.G. n.d. 
J.S.
 
.
 
.
 
.
 
.
 
.
 
.
 
C
 
C
 
T
 
.
 
.
 
.
 
.
 
n.d.
 

NOTE.—Sequence polymorphisms found in cloned contaminant samples and in the researchers involved in this study (H.M, A.G., and J.S.) are shown in relation to the Cambridge Reference Sequence (CRS) (Anderson et al. 1981).

Dog mtDNA

Twenty-five of the 29 dog specimens contained amplifiable dog DNA in at least 1 of the PCR reactions (table 3). The total number of ancient templates in the DNA extracts varied between 1 and 5,291 molecules. In contrast, the DNA extracts from the contemporary dog (specimen 29) contained well over 450,000 starting molecules. The standard curves in the real-time PCR assay showed linear relationships, with correlation coefficients with an average R2 of 0.9923 (SD ± 0.0048) between reactions and with slopes averaging 3.6788 (SD ± 0.2305).

Direct sequencing of PCR products yielded 25 ancient dog sequences that were in accordance with Canis control region sequences in GenBank. The sequences that originated from the same specimen displayed a single haplotype. Three sequences had been amplified from few template molecules (from specimens labeled 6, 11, and 18) and showed ambiguities at six, one, and two nucleotide positions, respectively. Some of the dog sequences displayed nucleotide variations not previously reported, and all sequences have been deposited to GenBank under the labels AY673648AY673672.

The majority of all controls, 16 of the 16 PCR controls and 29 of the 30 extraction controls, were negative for dog DNA. The only contaminant found was one extraction control containing 34 dog molecules.

Carrier Effect

The number of retrieved dog molecules in samples containing different input of human and dog DNA are shown in table 5. No influence by the added human DNA on the efficiency of the amplification of the dog molecules could be detected. This is indicated by a nonsignificant interaction between input amount of human DNA and the input amount of dog DNA (P = 0.47, F3,40 = 0.87). Further, the number of quantified dog molecules was not significantly affected by the input of human DNA in the samples (P = 0.12, F3,43 = 2.08).

Table 5

Quantified Number of Dog Molecules After Carrier Effect Test


Input Molecules
 

Dog 50
 

Dog 250
 

Dog 5,000
 
Human 0 7 ± 11 34 ± 40 605 ± 119 
Human 50 0 ± 0 19 ± 25 617 ± 139 
Human 250 8 ± 11 42 ± 19 521 ± 137 
Human 5,000
 
1 ± 3
 
14 ± 16
 
494 ± 115
 

Input Molecules
 

Dog 50
 

Dog 250
 

Dog 5,000
 
Human 0 7 ± 11 34 ± 40 605 ± 119 
Human 50 0 ± 0 19 ± 25 617 ± 139 
Human 250 8 ± 11 42 ± 19 521 ± 137 
Human 5,000
 
1 ± 3
 
14 ± 16
 
494 ± 115
 

NOTE.—The average number of dog templates (±SD) in duplicate real-time PCR products retrieved after extraction of mixes containing different input amounts of human and dog mtDNA are shown.

Discussion

To discriminate between contaminating and authentic mtDNA molecules, we targeted both human and dog sequences in extracts from ancient dog bones and teeth. By using real-time PCR quantification we found preserved aDNA in the majority of our samples, in amounts varying from single molecules to more than 5,000 templates. Similar and sometimes even larger amounts have been accounted for in other studies (Krings et al. 1997; Di Benedetto et al. 2000; Caramelli et al. 2003; Alonso et al. 2004; Cappellini et al. 2004; Gilbert et al. 2004b; Pruvost and Geigl 2004). The authenticity of the dog sequences was supported by multiple extractions and amplifications at different occasions and by quantifying the extracted DNA. The single contaminated negative control in the dog assay may have been caused by cross contamination. This control was extracted in the final batch of samples, in which the contemporary dog bone was included. Sequence comparison between the ancient dog samples did not indicate that they were affected by cross contamination because samples from different specimens displayed different haplotypes.

The proportion of human DNA in our ancient dog specimens greatly exceeded the amount of dog DNA (fig. 1 and table 3). The main source for this contamination was derived from prelaboratory handling of the teeth and bones. This is supported by the detection of significantly higher amounts of human DNA in the dog extracts than in the negative controls, as shown by the ANOVA and the following posthoc test. Further, we found no support for the low level of contamination in controls being caused by a carrier effect. Our extractions and amplifications of known amounts of DNA showed no decrease in the simulated contaminating molecules with decreasing amounts of carrier molecules (table 5).

Even though sporadic or low levels of human contamination in negative controls are sometimes accounted for (Izagirre and de la Rúa 1999; Yang, Eng, and Saunders 2003; Gilbert et al. 2004a), it is more common to only report successful results without contamination. In this respect, the large number of contaminated controls reported in this study might seem adverse. The differences in negative control results are probably not directly comparable. Real-time PCR allowed us to measure the number of initial templates down to single molecules, whereas conventional and competitive PCRs display amplification end products and have a detection limit of nanograms when visualized on an agarose gel. Further, we used a large proportion (more than 1/5) of our concentrated DNA extracts for each amplification reaction to avoid random loss of low-level contamination. The major part of our contaminated controls would have been undetected had we used conventional techniques and conventional amounts of extract as template for amplification.

Several studies report occurrence of human DNA contamination in ancient human (Handt et al. 1996; Krings et al. 1997; Stone and Stoneking 1998; Kolman and Tuross 2000; Schmitz et al. 2002; Serre et al. 2004; Vernesi et al. 2004; Gilbert et al. 2005) and nonhuman specimens (Handt et al. 1994; Richards, Sykes, and Hedges 1995; Hofreiter et al. 2001b; Serre et al. 2004) but not in their negative controls. These results strongly support our conclusion that the majority of these contaminations are present in the samples before the start of the laboratory analysis. Further, variability in the treatment of the surfaces of the specimens might explain the different contamination levels in the aliquots of bone and tooth powder (see table 3).

Different pretreatments of bones and teeth may result in varying degrees of decontamination success. As we used brushing and UV (like Caramelli et al. 2003; Vernesi et al. 2004) and HCl treatment, we conclude that neither of these methods completely eliminated contamination from our samples. Other frequently used methods, relying on UV and bleach treatment, sample encasement in silicone rubber, and grinding or shotblasting of sample surfaces, have also failed in providing samples free from human contamination (Richards, Sykes, and Hedges 1995; Kolman and Tuross 2000; Gilbert et al. 2005).

Cloning of PCR products have been suggested as a way to detect sequence variation due to contamination. When the majority of cloned sequences from a single PCR product display only a few, or sporadic substitutions, a consensus is often produced (Caramelli et al. 2003; Lalueza-Fox et al. 2003). The high proportions of contaminant DNA in our samples suggest that a consensus of sequenced clones from PCR products would not always yield an authentic aDNA sequence. In fact, when we compared nucleotide diversity and number of haplotypes found in our cloned sequences and a published data set of clones from ancient human DNA (Vernesi et al. 2004), we could not detect any significant differences. Further, some of the dog specimens (numbers 12 and 20) displayed a single human haplotype in all cloned sequences. Although others showed a higher diversity, it should be noted that the number of haplotypes might not be directly proportional to the amount of contamination events. Other factors such as mutagenic substances in aDNA extracts (Pusch and Bachmann 2004; Pusch et al. 2004; but see Serre, Hofreiter, and Pääbo 2004), DNA polymerase misincorporation (Hansen et al. 2001), PCR jumping, and postmortem damage of DNA (Hofreiter et al. 2001a) have been proposed to contribute to sequence heterogeneity in clones.

All dog samples, from 10 different collections, contained human DNA (table 3). This suggests that contamination originating from prelaboratory handling of archaeological specimens is a problem of a general nature. The most alarming consequence of the specimens being contaminated is that independent extractions at separate laboratories as well as cloning of PCR products might yield reproducible, even though false, results. This leads us to believe that present applications of authentication criteria might not suffice for aDNA studies on human archaeological samples. Other cleaning methods than the ones we have used may be more appropriate, but alternative methods should be controlled by parallel DNA extraction and template quantification of several nonhuman samples with similar dating and history of treatment as the human samples investigated. Cloning, sequencing, and reproduction at a second laboratory may then further assist in the authentication. Thus, it may be possible to work with ancient human DNA, but the burden of proof lies heavily upon each researcher claiming to have such results.

William Martin, Associate Editor

The authors would like to thank A.-K. Sundqvist for dog DNA for standards and M. Douglas at Östergötland County Museum, M. Wretemark at Västergötland Museum, T. Ahlström at the Historical Osteology division, Lund University, F. Johansson at Göteborgs Natural History Museum, M. Karlsson at the Bureau of Antiquities, Government of Åland, I. Österholm at the Department of Cultural and Social Studies, Gotland University, and L. Drenzel at the Museum of National Antiquities in Stockholm for sharing their knowledge on ancient dogs and for supplying bone and tooth samples. We also thank H. Ellegren, J. Leonard, C. Víla, B. Linblom, P. Saetre, and A. Bouwman for valuable comments on the study. This work was supported by the Swedish Research Council and the Forensic Science Center at Linköping University.

References

Abbot, A.
2003
. Anthropologists cast doubt on human DNA evidence.
Nature
 
423
:
468
.
Alonso, A., P. Martín, C. Albarrán, P. García, O. García, L. Fernández de Simón, J. García-Hirschfeld, M. Sancho, C. de la Rúa, and J. Fernández-Piqueras.
2004
. Real-time PCR designs to estimate nuclear and mitochondrial DNA copy number in forensic and ancient DNA studies.
Forensic Sci. Int.
 
139
:
141
–149.
Anderson, S., A. T. Bankier, B. G. Barrell et al. (14 co-authors).
1981
. Sequence and organization of the human mitochondrial genome.
Nature
 
290
:
457
–465.
Anderung, C., A. Bouwman, P. Persson et al. (10 co-authors).
2005
. Prehistoric contacts over the Straits of Gibraltar indicated by genetic analysis of Iberian Bronze Age cattle.
Proc. Natl. Acad. Sci. USA
 
102
:
8431
–8435.
Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl.
1999
. Short protocols in molecular biology. 4th edition. Wiley John and Sons Inc., New York, p. A2-1.
Bandelt, H.-J.
2004
. Etruscan artifacts.
Am. J. Hum. Genet.
 
75
:
919
–920.
Barbujani, G., and G. Bertorelle.
2003
. Were Cro-Magnons too like us for DNA to tell?
Nature
 
424
:
127
.
Barbujani, G., C. Vernesi, D. Caramelli, L. Castrí, C. Lalueza-Fox, and G. Bertorelle.
2004
. Etruscan artifacts: much ado about nothing.
Am. J. Hum. Genet.
 
75
:
923
–927.
Cappellini, E., B. Chiarelli, L. Sineo, A. Casoli, A. Di Gioia, C. Vernesi, M. C. Biella, and D. Caramelli.
2004
. Biomolecular study of the human remains from tomb 5859 in the Etruscan necropolis of Monterozzi, Tarquinia (Viterbo, Italy).
J. Archaeol. Sci.
 
31
:
603
–612.
Caramelli, D., C. Lalueza-Fox, C. Vernesi et al. (11 co-authors).
2003
. Evidence for a genetic discontinuity between Neandertals and 24,000-year-old anatomically modern Europeans.
Proc. Natl. Acad. Sci. USA
 
100
:
6593
–6597.
Cooper, A.
1992
. Removal of colourings, inhibitors of PCR, and the carrier effect of PCR contamination from ancient DNA samples.
Anc. DNA Newslett.
 
1
:
31
–32.
Cooper, A., and H. N. Poinar.
2000
. Ancient DNA: do it right or not at all.
Science
 
289
:
1139
.
Di Benedetto, G., I. S. Nasidze, M. Stenico, L. Nigro, M. Krings, M. Lanzinger, L. Vigilant, M. Stoneking, S. Pääbo, and G. Barbujani.
2000
. Mitochondrial DNA sequences in prehistoric human remains from the Alps.
Eur. J. Hum. Genet.
 
8
:
669
–677.
Gilbert, M. T. P., J. Cuccui, W. White, N. Lynnerup, R. W. Titball, A. Cooper, and M. B. Prentice.
2004
a. Absence of Yersinia pestis-specific DNA in human teeth from five European excavations of putative plague victims.
Microbiology
 
150
:
341
–354.
Gilbert, M. T. P., L. Rudbeck, E. Willerslev et al. (15 co-authors).
2005
. Biochemical and physical correlates of DNA contamination in archaeological bones and teeth excavated at Matera, Italy.
J. Archaeol. Sci.
 
32
:
785
–793.
Gilbert, M. T. P., E. Willerslev, A. J. Hansen, I. Barnes, L. Rudbeck, N. Lynnerup, and A. Cooper.
2003
. Distribution patterns of post mortem damage in human mitochondrial DNA.
Am. J. Hum. Genet.
 
72
:
32
–47.
Gilbert, M. T. P., A. S. Wilson, M. Bunce et al. (12 co-authors).
2004
b. Ancient mitochondrial DNA from hair.
Curr. Biol.
 
14
:
R463
–R464.
Handt, O., M. Höss, M. Krings, and S. Pääbo.
1994
. Ancient DNA: methodological challenges.
Experientia
 
50
:
524
–529.
Handt, O., M. Krings, R. H. Ward, and S. Pääbo.
1996
. The retrieval of ancient human DNA sequences.
Am. J. Hum. Genet.
 
59
:
368
–376.
Hansen, A. J., E. Willerslev, C. Wiuf, T. Mourier, and P. Arctander.
2001
. Statistical evidence for miscoding lesions in ancient DNA templates.
Mol. Biol. Evol.
 
18
:
262
–265.
Hofreiter, M., V. Jaenicke, D. Serre, A. von Haeseler, and S. Pääbo.
2001
a. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA.
Nucleic Acids Res.
 
29
:
4793
–4799.
Hofreiter, M., D. Serre, H. N. Poinar, M. Kuch, and S. Pääbo.
2001
b. Ancient DNA.
Nat. Rev. Genet.
 
2
:
353
–359.
Izagirre, N., and C. de la Rúa.
1999
. An mtDNA analysis in ancient Basque populations: implications for haplogroup V as a marker for a major paleolithic expansion from southwestern Europe.
Am. J. Hum. Genet.
 
65
:
199
–207.
Kim, K. S., S. E. Lee, H. W. Jeong, and J. H. Ha.
1998
. The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondrial genome.
Mol. Phylogenet. Evol.
 
10
:
210
–220.
Kolman, C. J., and N. Tuross.
2000
. Ancient DNA analysis of human populations.
Am. J. Phys. Anthropol.
 
111
:
5
–23.
Krings, M., A. Stone, R. W. Schmitz, H. Krainitzki, M. Stoneking, and S. Pääbo.
1997
. Neandertal DNA sequences and the origin of modern humans.
Cell
 
90
:
19
–30.
Kwok, S., and R. Higuchi.
1989
. Avoiding false positives with PCR.
Nature
 
339
:
237
–238.
Lalueza-Fox, C., M. T. P. Gilbert, A. J. Martínez-Fuentes, F. Calafell, and J. Bertranpetit.
2003
. Mitochondrial DNA from pre-Columbian Ciboneys from Cuba and the prehistoric colonization of the Carribean.
Am. J. Phys. Anthropol.
 
121
:
97
–108.
Lindblom, B., and G. Holmlund.
1988
. Purification for restriction fragment length polymorphism analysis.
Gene Anal. Tech.
 
5
:
97
–101.
Malyarchuk, B. A., and I. B. Rogozin.
2004
. On the Etruscan mitochondrial DNA contribution to modern humans.
Am. J. Hum. Genet.
 
75
:
920
–923.
Nei, M.
1987
. Molecular evolutionary genetics. Columbia University Press, New York.
Pääbo, S., J. A. Gilford, and A. C. Wilson.
1988
. Mitochondrial DNA sequences from a 7000-year old brain.
Nucleic Acids Res.
 
16
:
9775
–9787.
Pääbo, S., H. Poinar, D. Serre, V. Jaenicke-Després, J. Hebler, N. Rohland, M. Kuch, J. Krause, L. Vigilant, and M. Hofreiter.
2004
. Genetic analyses from ancient DNA.
Annu. Rev. Genet.
 
38
:
645
–679.
Pruvost, M., and E. M. Geigl.
2004
. Real-time quantitative PCR to assess the authenticity of ancient DNA amplification.
J. Archaeol. Sci.
 
31
:
1191
–1197.
Pusch, C. M., and L. Bachmann.
2004
. Spiking of contemporary human template DNA with ancient DNA extracts induces mutations under PCR and generates nonauthentic mitochondrial sequences.
Mol. Biol. Evol.
 
21
:
957
–964.
Pusch, C. M., M. Broghammer, G. J. Nicholson, A. G. Nerlich, A. Zink, I. Kennerknecht, L. Bachmann, and N. Blin.
2004
. PCR-induced sequence alterations hamper the typing of prehistoric bone samples for diagnostic achondroplasia mutations.
Mol. Biol. Evol.
 
21
:
2005
–2011.
Richards, M. B., B. C. Sykes, and R. E. M. Hedges.
1995
. Authenticating DNA extracted from ancient skeletal remains.
J. Archaeol. Sci.
 
22
:
291
–299.
Sambrock, E., F. Fritsch, and T. Maniatis.
1989
. Molecular cloning. Cold Spring Harbor Press, New York.
Schmitz, R. W., D. Serre, G. Bonani, S. Feine, F. Hillgruber, H. Krainitzki, S. Pääbo, and F. H. Smith.
2002
. The Neandertal type site revisited: interdisciplinary investigations of skeletal remains from the Neander Valley, Germany.
Proc. Natl. Acad. Sci. USA
 
99
:
13342
–13347.
Serre, D., M. Hofreiter, and S. Pääbo.
2004
. Mutations induced by ancient DNA extracts.?
Mol. Biol. Evol.
 
21
:
1463
–1467.
Serre, D., A. Langaney, M. Chech, M. Teschler-Nicola, M. Paunovic, P. Mennecier, M. Hofreiter, G. Possnert, and S. Pääbo.
2004
. No evidence of Neandertal mtDNA contribution to early modern humans.
PLoS Biol.
 
2
:
0313
–0317.
Smith, C. I., A. T. Chamberlain, M. S. Riley, C. Stringer, and M. J. Collins.
2003
. The thermal history of human fossils and the likelihood of successful DNA amplification.
J. Hum. Evol.
 
45
:
203
–217.
Stone, A. C., and M. Stoneking.
1998
. mtDNA analysis of a prehistoric Oneota population: implications for the peopling of the New World.
Am. J. Hum. Genet.
 
62
:
1153
–1170.
Vernesi, C., D. Caramelli, I. Dupanloup et al. (13 co-authors).
2004
. The Etruscans: a population-genetic study.
Am. J. Hum. Genet.
 
74
:
694
–704.
Yang, D. Y., B. Eng, and S. R. Saunders.
2003
. Hypersensitive PCR, ancient human mtDNA, and contamination.
Hum. Biol.
 
75
:
355
–364.
Yang, D. Y., B. Eng, J. S. Waye, J. C. Dudar, and S. R. Saunders.
1998
. Technical note: improved DNA extraction from ancient bones using silica-based spin columns.
Am. J. Phys. Anthropol.
 
105
:
539
–543.

Author notes

*Department of Evolutionary Biology, Evolutionary Biology Centre, Uppsala University, Uppsala, Sweden; †Osteoarchaeological Research Laboratory, Stockholm University, Stockholm, Sweden; ‡Department of Zoology, Stockholm University, Stockholm, Sweden; and §The National Board of Forensic Medicine, Department of Forensic Genetics, Faculty of Health Science, Linköping University, Linköping, Sweden