https://orcid.org/0000-0002-5133-9165
Abstract
Selenoprotein W (SelW) is an important member of the avian selenoprotein family. It is well known for its important role in protecting neurons from oxidative stress during neuronal development. d-Amino acid (d-serine), as a neurotransmitter in the central nervous system (CNS), can mediate neurotoxicity. d-Amino acid oxidase (DAAO) is responsible for regulating the d-serine levels in cells. However, the correlation between SelW and DAAO is not clear yet. To investigate the regulations between SelW and DAAO, chicken embryo monolayer neurons were treated with d-serine and/or Se. In this study, we predicted molecular binding between SelW and DAAO. These results showed that the 9–16, 18, 41–47 and 66 residues of SelW could combine with the DAAO, which suggested that chicken SelW might be the target of DAAO. We determined the DAAO activity and the mRNA expression of SelW in in vitro cultured chicken embryo primitive neuron cells. d-Serine influenced the activity of DAAO and, moreover, a significant increase in the mRNA expression of SelW was found in neurons treated with Se. Notably, we also observed changes in the expression of SelW and DAAO when neurons were treated with various concentrations of d-serine and Se. In conclusion, these data suggest that d-serine could regulate the mRNA expression of SelW by interfering with the activity of DAAO in chicken embryo neurons.
Selenoprotein W (SelW), an important member of the avian selenoprotein family, can combine with d-amino acid oxidase (DAAO). Selenium (Se) can inhibit the toxicity of d-serine and maybe has a detoxifying ability by increasing the expression of SelW and decreasing the activity of DAAO.
The mechanism of selenium's (Se) chemoprevention against neurotoxicity remains unclear. This paper provides evidence of the molecular blinding between SelW and DAAO in Gallus gallus. This research will draw wide-ranging attention to the novel biochemical functions of SelW in the central nervous system (CNS). d-Amino acid (DAA) can mediate neurotoxicity as a neurotransmitter in the CNS. d-Amino acid oxidase (DAAO) is responsible for the control of DAA content. Selenoprotein W (SelW) plays an important role in protecting neurons. Se can inhibit the neurotoxicity of DAA via increasing the expression of SelW and decreasing the activity of DAAO.
Introduction
Selenium (Se) is an essential obligatory micronutrient that is critical for the normal physiology of various species including birds. Se plays an important role in various physiological functions in humans and animals depending on its concentration. Deficiency or excessive intake often lead to biological interferences, resulting in the development of a wide ranges of diseases in animals. However, there is some controversy about the roles of Se in producing diseases in humans such as Amyotrophic Lateral Sclerosis (ALS),1 cancer,2,3 Keshan disease (a type of cardiomyopathy),4 and diabetes mellitus.5 Se plays important roles in the central nervous system (CNS), including reduction of lipid peroxidation and elevation of selenoenzyme activity and cell protection.6,7 Se, as a toxic metal, has long been known since 1957. The special clinical relevance is related to the adverse effects on the nervous system with acute Se intoxication. It also means that Se is sensitive for the CNS. Numerous previous studies have reported that Se has a neuro-protective effect.8 The protective effect of Se is highlighted when the external environment and chemicals change. A relatively low concentration of Se is implicated as a neuroprotective agent in a number of neuronal diseases, including epilepsy9 and pain.10 The neuroprotective roles of Se are primarily attributable to its ability to inhibit apoptosis and to modulate Ca2+ influx through ion channels.11 The biological functions of Se are performed mainly through the active sites of a variety of selenoproteins.12 At least 24 selenoproteins, which contain a selenocystein amino acid as a unique structural part, have been identified in chickens.13 Furthermore, Se and selenoproteins play crucial roles in the development, function, metabolism and degeneration of the brain.14
Selenoprotein W (SelW) is an important member of the selenoprotein family. SelW expression is found in chickens, and mostly in muscle and neural tissues.15 Previous recent studies have shown that supplementation of dietary Se can affect selenoprotein expression in the chicken brain. In a previous study, Chung et al.16 reported that SelW was a neuroprotective agent for primary neuronal cell injury following oxidative stress. Numerous previous studies have suggested that SelW could play a neuroprotective role in primary neuronal cell damage caused by oxidative stress.17 However, the molecular target responsible for SelW neuroprotection in the nervous system remains unclear.
d-Amino acids (DAA), such as d-serine, d-aspartate and d-alanine, have been considered to be absent and unnatural amino acids in mammals for a long time. However, recently they have been detected in various mammalian species. d-Amino acids play a key role in the regulation of biological processes in living organisms. DAA (d-serine), as a neurotransmitter, can combine with the N-methyl-d-aspartate (NMDA) receptor in the human CNS and mediate neurotoxicity with glutamate.18
d-Amino acid oxidase (DAAO) is a key flavoenzyme that is responsible for proper maintenance of d-amino acids level in mammals. Once DAA is taken up into the neurons, the peroxisomal flavoenzyme DAAO degrades the neuromodulator.19 In mammals, DAAO is mainly present in the kidneys and liver, but it is also found in the brain, where its role remained elusive until significant concentrations of d-serine were detected.20 A recent study has reported that DAAO is the important susceptible enzyme and recognition site in chronic neuropathic schizophrenia.21
Recent studies have shown the existence of a relationship between SelW and DAAO. However, the specific molecular mechanism remains unknown. Therefore, in this study, we used I-TASSER to predict the correlation between avian SelW and DAAO. To demonstrate this interaction, d-serine and Se were added to a chicken neuronal culture system. We investigated the regulatory mechanism between DAAO and SelW and also assessed its biological effects in chicken embryo neurons by determining the binding site of SelW.
Experimental
Prediction of the molecular binding between SelW and DAAO
For prediction of the molecular binding between SelW and DAAO, we used chicken SelW cDNA with bioinformatics approaches. I-TASSER (website: http://zhanglab.ccmb.med.umich.edu/I-TASSER/) was used to forecast the molecules that can interact with SelW. I-TASSER, an online software based on matching structure predictions with known functional templates and iterative threading assembly simulations, outputs the protein molecules with annotated biological functions.22
Ethics statement
All experimental procedures were approved by the Institutional Animal Care and Use Committee of Northeast Agricultural University (NEAU). Methods were carried out in accordance with the approved guidelines of NEAU.
Preparation of chicken embryo neurons
Chicken embryo neurons were prepared according to a modified previous method.23 In brief, the cultures were made by removing 8 day old chicken embryo cerebral hemispheres using 6 well plates for culturing the neurons and for the subsequent experiments. Poly-d-lysine (0.1 mg mL−1, Sigma, USA) was used to coat the plates overnight to attain optimal growth construction. The blood vessels and adhering meningeal membranes of the hemispheres were cleaned aseptically and trypsin was used to dissociate the hemispheres. A sterile stainless steel mesh with a pore size of 100 mM was used to disperse the neuron suspension. Then the dispersed neurons were cultured in complete cell culture medium (neurobasal medium containing penicillin, streptomycin and 1% glutamine, and supplemented with 10% fetal bovine calf serum) for 8 h.
Neuron cultures and treatments
The culture and treatment are according to Li et al.'s protocol.24 Neurons were cultured at 37 °C in 5% CO2 and 95% air. The neurons were adherent in per well after an incubation of 8 h. Then, the stale neurobasal medium was removed and the prepared neuron cells were grown in 2 mL of fresh complete medium and added into the same amount of solvent, then treated with 0 mol L−1 (control group, base selenium content of complete medium: 0.3 × 10−9 mol L−1), 10−3 mol L−1 d-serine (DAA-I group), 10−2 mol L−1 d-serine (DAA-II group), 10−7 mol L−1 Se (Se group) as sodium selenite (Sigma, USA), 10−7 mol L−1 Se + 10−3 mol L−1 d-serine (MIX-I group) and 10−7 mol L−1 Se + 10−2 mol L−1 d-serine (MIX-II group) for 24 h. The chicken embryo neurons were prepared for analysis of the SelW mRNA levels, neuron cell activity and DAAO.
The morphology of chicken embryo neurons
The morphology of treated and untreated chicken embryo neurons was determined by light microscopy (Eclipse-Ti, Nikon, Japan). Magnification of ×400 was chosen for the determination.
Measurement of neurite outgrowth
The digital images were taken from 10 randomly selected fields that contained more than 20 cells under a light microscope. This analysis was performed in a double-blinded fashion and the data were averaged and plotted for statistical analysis.
Determination of neuron viability
Cell Counting Kit (CCK) kit based on WST-8 (chemical name: 2-(2-methoxy-4-nitro-phenyl)-3-(4-nitro-phenyl)-5-(2,4-sulfophenyl)-2H-tetrazolium monosodium salt) is a fast detection kit widely used in cytotoxicity and cell proliferation.25 CCK-8 was used to determine the cell viability (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) according to the manufacturer's instructions. In detail, 1 × 105 cells per well were plated in 96 well plates. Neurons were treated with d-serine, as described. 100 μL of 10% CCK-8 solution was added to each of the wells and then the plate was incubated at 37 °C for 4 h. A microplate reader (BioTek, Epoch, USA) was used to measure the absorbance of the neurons at 450 nm.
Determination of SelW mRNA levels by quantitative RT-PCR
According to the manufacturer's instructions, the total RNA was extracted from the chicken embryo neurons using Trizol reagent. Diethyl-pyrocarbonate-treated water was subsequently used to suspend the RNA pellets. Total RNA concentration was determined spectrophotometrically by measuring the optical density (OD) at 260/280 nm. The absorbance ratio of each total RNA was between 1.9 and 2.0. The cDNA synthesis from 2 μg of total RNA was performed in 20 μL of a mixture containing first-strand buffer, 20 U of recombinant RNasin ribonuclease inhibitor, 10 mmol L−1 of dithiothreitol, 0.5 mmol L−1 of each dNTP, 200 U of Moloney Murine Leukemia Virus Reverse Transcriptase, and 2 μmol L−1 of oligo (dT) according to the manufacturer's instructions (Invitrogen, China) for 1.5 hours at 42 °C.
The specific primers for GADPH and SelW were designed by the software named Primer Premier (PREMIER Biosoft International, USA) (Table 1). Each 20 μL reaction volume contained 0.4 μL of each primer (10 μM), 0.4 μL of ROX Reference Dye II, 10 μL of 2× SYBR Premix Ex Taq™, 6.8 μL of nuclease-free water and 2 μL of 10× diluted cDNA template. The dissociation cycle was 95 °C for 1 min, 60 °C for 30 s and heating to 95 °C at 0.1 °C s−1 with continuous measurement of fluorescence. The sizes of the first and second rounds of PCR were 185 bp and 110 bp, respectively. An Applied Biosystems 7500 Real-Time PCR system was used to perform the PCR. For each sample, four technical replicates were performed. One peak for each PCR product was shown in the analysis. The RT-PCR program was used to determine the amplification efficiency.26 In this study, we analysed β-actin and GADPH expression levels, which were the housekeeping genes of the chicken embryo neurons. β-Actin and GADPH expression were stable in Se-treated and Se-untreated chicken embryo neurons. The Pfaffl method27 was used to calculate the relative mRNA abundance, which was normalized to the mean expression of GADPH and β-actin.24,28
Primers used for quantitative real-time PCR
| Gene | Sequence (5′ → 3′) | Amplicon size (bp) |
|---|---|---|
| GADPH | AGAACATCATCCCAGCGT | 182 |
| AGCCTTCACTACCCTCTTG | ||
| β-Actin | CCGCTCTATGAAGGCTACGC | 128 |
| CTCTCGGCTGTGGTGGTGAA | ||
| SelW | CTCCGCGTCACCGTGCTC | 150 |
| CACCGTCACCTCGAACCATCCC |
| Gene | Sequence (5′ → 3′) | Amplicon size (bp) |
|---|---|---|
| GADPH | AGAACATCATCCCAGCGT | 182 |
| AGCCTTCACTACCCTCTTG | ||
| β-Actin | CCGCTCTATGAAGGCTACGC | 128 |
| CTCTCGGCTGTGGTGGTGAA | ||
| SelW | CTCCGCGTCACCGTGCTC | 150 |
| CACCGTCACCTCGAACCATCCC |
Primers used for quantitative real-time PCR
| Gene | Sequence (5′ → 3′) | Amplicon size (bp) |
|---|---|---|
| GADPH | AGAACATCATCCCAGCGT | 182 |
| AGCCTTCACTACCCTCTTG | ||
| β-Actin | CCGCTCTATGAAGGCTACGC | 128 |
| CTCTCGGCTGTGGTGGTGAA | ||
| SelW | CTCCGCGTCACCGTGCTC | 150 |
| CACCGTCACCTCGAACCATCCC |
| Gene | Sequence (5′ → 3′) | Amplicon size (bp) |
|---|---|---|
| GADPH | AGAACATCATCCCAGCGT | 182 |
| AGCCTTCACTACCCTCTTG | ||
| β-Actin | CCGCTCTATGAAGGCTACGC | 128 |
| CTCTCGGCTGTGGTGGTGAA | ||
| SelW | CTCCGCGTCACCGTGCTC | 150 |
| CACCGTCACCTCGAACCATCCC |
Determination of the activity of DAAO
Statistical analysis
Statistical analysis of the DAAO enzyme unit and the SelW mRNA level was executed using GraphPad Prime software for Windows (version 5.01; GraphPad Software, Inc., 825 Fay Avenue, Suite 230, La Jolla, CA 92037 USA) and SPSS statistical software for Windows (version 19; SPSS Inc., Chicago, IL, USA). Further analysis was carried out when the explicit value was obtained by one-way variance analysis (P < 0.05). All the data showed a normal distribution and passed the same variance test. The differences between the methods were evaluated by means of Tukey's test. Data are expressed as mean ± standard deviation. P < 0.05 means that the differences were considered to be significant.
Results
The binding of SelW and DAAO
The molecular binding prediction is shown in Fig. 1. It indicates that SelW can interact with DAAO. The 9–16, 18, 41–47, and 66 amino acid residues of chicken SelW proteins can combine with DAAO. Of particular note, the 10–13 –CXXU– of the amino acid sequence was shown to be the active site of SelW. Therefore, it was predicted that DAAO might be the target molecule of chicken SelW and DAAO is closely related to the biological function of SelW.
Binding site residues in the predicted spatial structure of chicken SelW.
Binding site residues in the model: TYR(9), CYS(10), GLY(11), ALA(12), SEC(13), GLY(14), TYR(15), LYS(16), LYS(18), THR(41), GLN(42), GLU(43), VAL(44), THR(45), GLY(46), TRP(47), PHE(66).
Determination of the morphology and neurite outgrowth of neurons
The morphology and neurite outgrowth of the chicken embryo neurons treated with d-serine and Se are presented in Fig. 2. No significant differences were found in the lengths of the neurite branches and the neuron morphology among the 10−3 mol L−1 d-serine, 10−2 mol L−1 d-serine, 10−7 mol L−1 Se, 10−3 mol L−1 d-serine + 10−7 mol L−1 Se and 10−2 mol L−1 d-serine + 10−7 mol L−1 Se groups. In comparison to the control group, there was a significant increase in the lengths and branches of neurites when the neurons were treated with 10−7 mol L−1 Se. This study suggested that neurons could be promoted by relatively low concentrations of Se and are not sensitive to relatively low concentrations of d-serine.
Effects of d-serine and Se on the morphology and neurite outgrowth in chicken embryo neurons. The neuron monolayers were treated with 10−3 mol L−1 d-serine (DAA-I group), 10−2 mol L−1 d-serine (DAA-II group), 10−7 mol L−1 Se (Se group) as sodium selenite, 10−7 mol L−1 Se + 10−3 mol L−1 d-serine (MIX-I group) and 10−7 mol L−1 Se + 10−2 mol L−1 d-serine (MIX-II group) for 24 h. Light microscopy (magnification: ×400, bar 50 μm) was used to visualize the morphology of the chicken embryo neurons in the treated and control groups. Bars with “*” were significantly different from the controls as measured by one-way analysis of variance followed by a Tukey's multiple comparison test (*P < 0.05, **P < 0.01, ***P < 0.001). Data are expressed as mean ± standard deviation (n = 10/group).
The effects of d-serine and Se on neurite outgrowth in chicken embryo neurons were determined and the results are shown in Fig. 2A and B. Following treatment with d-serine and Se, the number of neurite-bearing cells was increased compared to the untreated control cells (P < 0.05, Fig. 2B). There was no significant difference in the number of neurite branches among the treatment groups compared to the control group (P > 0.05, Fig. 2C).
Effects of d-serine on the viability of neuron cells
To determine the toxic effects of d-serine on neuron cells, the cells were treated with d-serine at different concentrations (0 mol L−1, 1 mol L−1, 10−1 mol L−1, 10−2 mol L−1, 10−3 mol L−1, 10−4 mol L−1, 10−5 mol L−1, and 10−6 mol L−1). The cell viability was observed in chicken embryo neurons and the results are shown in Fig. 3A. We observed toxic effects on chicken embryo neurons when cells were treated with 10−1 and 1 mol L−1 DAA (a relatively high concentration) and a significant decrease in the viability was also noticed compared with the chicken embryo neurons treated with 0 mol L−1 of DAA. Intriguingly, it was clear that the survival rate of the chicken embryo neuron cells increased with decreasing levels of d-serine. A heatmap showing the correlation (R2) between the cell viability and the d-serine concentration is presented in Fig. 3B. The results of this study demonstrate that the chicken embryo neurons are sensitive to high d-serine concentrations and a dose-dependent effect on the viability of neurons was found.
Effect of d-serine on the viability of neuron cells by using CCK-8. The neurons were treated with 0 mol L−1, 1 mol L−1, 10−1 mol L−1, 10−2 mol L−1, 10−3 mol L−1, 10−4 mol L−1, 10−5 mol L−1 and 10−6 mol L−1 of d-serine. A microplate reader was used to determine the OD. Bars with “*” were significantly different from the controls, as measured by one-way analysis of variance followed by a Tukey's multiple comparison test (*P < 0.05, **P < 0.01, ***P < 0.001). Data are expressed as mean ± standard deviation (n = 6/group). The correlations (R2) between the cell viability and d-serine concentration are shown using the indicated pseudo color scale from −1 (green) to +1 (red).
Effects of d-serine on the mRNA levels of SelW
To examine the effects of d-serine on the expression of SelW mRNA, SelW mRNA levels were measured by quantitative real-time RT-PCR, as displayed in Fig. 4A. The alteration of SelW mRNA levels was observed in chicken embryo neurons treated with 10−2 mol L−1 of d-serine (DAA-II) and 10−7 mol L−1 of Se (Se), which was higher compared to the control. The expression of SelW mRNA levels was also increased in chicken embryo neurons treated with 10−3 mol L−1 of d-serine + 10−7 mol L−1 of Se (MIX-I) and 10−2 mol L−1 of d-serine + 10−7 mol L−1 of Se (MIX-II), but it was not a more significant increase compared to the DAA-I group and the Se group, which indicates that the expression of SelW might be inhibited by the combination of Se and d-serine. The heatmap shows the correlations (R2) among the SelW mRNA levels and d-serine and Se concentrations (Fig. 4B).
Effect of d-serine on the SelW mRNA levels in chicken embryo neurons. The neurons were treated with 0 mol L−1 (control), 10−3 mol L−1 d-serine (DAA-I), 10−2 mol L−1 d-serine (DAA-II), 10−7 mol L−1 Se as sodium selenite (Se group), 10−3 mol L−1 d-serine + 10−7 mol L−1 Se (MIX-I) and 10−2 mol L−1 d-serine + 10−7 mol L−1 Se (MIX-II) for 24 h. Quantitative real-time RT-PCR was performed to measure the expression of SelW mRNA levels in chicken embryo neurons. The housekeeping genes, GADPH and β-actin, were used for statistical comparison. Bars with “*” were significantly different from controls as measured by one-way analysis of variance followed by a Tukey's multiple comparison test (*P < 0.05, **P < 0.01, ***P < 0.001). Within the groups treated with different concentration of d-serine and Se (10−7 mol L−1), bars sharing a common letter (a or b or c or d) are not significantly different (P > 0.05). Data are expressed as mean ± standard deviation (n = 6/group). The correlations (R2) among the SelW mRNA levels and d-serine and Se concentrations are shown using the indicated pseudo color scale from −1 (green) to +1 (red).
Determination of the activity of DAAO in chicken embryo neurons by DNP method
The activity of DAAO was measured by DNP method and the results are shown in Fig. 5A. There was a significant decrease of the activity of DAAO in the MIX-I and MIX-II groups. There was decreased activity of DAAO in chicken embryo neuron neurobasal cells treated with 10−7 mol L−1 of Se. A decrease in the activity of DAAO was observed in the MIX-II group compared to the DAA-I group. A significant decrease in the activity of DAAO was observed in chicken embryo neurons treated with 10−3 and 10−2 mol L−1 of d-serine. The activity of DAAO in the neurons treated with 10−3 mol L−1 of d-serine was lower than that in the neurons treated with 10−2 mol L−1 of d-serine. The heatmap representing the correlations (R2) among the DAAO activity, d-serine and Se concentrations is shown in Fig. 5B. These results strongly suggest that the activity of DAAO changed with increasing concentrations of d-serine in chicken embryo neurons.
Effect of the activity of DAAO in chicken embryo neurons. 0 mol L−1 (control), 10−3 mol L−1 d-serine (DAA-I), 10−2 mol L−1 d-serine (DAA-II), 10−7 mol L−1 Se as sodium selenite (Se), 10−3 mol L−1 d-serine + 10−7 mol L−1 Se (MIX-I) and 10−2 mol L−1 d-serine + 10−7 mol L−1 Se (MIX-II) were added to the chicken embryo neurons for 24 h. A microplate reader was used to read the OD and the formula was used to convert into single enzyme values (μL g−1). Bars with “*” were significantly different from the controls as measured by one-way analysis of variance followed by a Tukey's multiple comparison test (*P < 0.05, **P < 0.01, ***P < 0.001). Within the groups treated with Se and different concentrations of d-serine, bars sharing a common letter (a or b or c) are not significantly different (P > 0.05). Data were expressed as mean ± standard deviation (n = 6/group). The correlations (R2) among the DAAO activity, d-serine and Se concentrations are shown using the indicated pseudo color scale from −1 (green) to +1 (red).
Discussion
Selenium (Se), a micronutrient, was discovered by the Swedish chemist Berzelius in 1817. The safe range of Se intake seems very narrow so it is investigated as a toxic substance as well as a nutrient. SelW is the smallest selenoprotein in mammals and is widely distributed in different species around the world.29 The mRNA expression level of SelW is remarkably regulated by the status and intake of Se. A very few previous reports have suggested that SelW mRNA expression is increased in diets supplemented with Se, and on the contrary, a significant decrease in the expression of SelW is noticed in Se-deficit diets in the spleen of rats, sheep and chicken.28,30 Our previous studies had confirmed that the increased neurite outgrowth in conjunction with SelW expression in chicken embryo neurons can be influenced by the low concentration of Se. However, our previous results revealed that the mRNA expression level of SelW was inhibited in neuronal cells treated with a high concentration of Se, which suggests that excess Se induces neurotoxicity at the same time. In this study, we observed that chicken embryo neurons incubated with 10−7 mol L−1 of Se resulted showed an increased SelW mRNA expression level, which was in agreement with the previous study by Li et al.28
SelW has been determined in various kinds of tissues, including muscle, intestine, liver, testis, tongue, kidney, brain, spleen, lung, and heart in animal species when the feed was supplemented with Se.31,32 In a previous study, when there was Se deficiency in the brain, the mRNA expression of SelW could still be preserved,33 suggesting that SelW plays important roles in the brain. Many studies have reported that SelW, like other selenoenzymes, can exert biological activity through binding with GSH in a redox mechanism.34 Jeon et al. have reported that the interaction between 14-3-3 protein and its target proteins can be inhibited owing to the incorporation of SelW and 14-3-3 protein.35 In our study, we found that the 9–16, 18, 41–47 and 66 amino acid residues of chicken SelW proteins could combine with DAAO when the spatial structure of chicken SelW protein was analysed by I-TASSER. We also observed high levels of DAAO expression and enzyme activity in the brain, like with SelW. DAAO expression and activity have been reported extensively in the cerebellum followed by the dorsolateral prefrontal cortex hippocampus and substantia nigra.36,37 Robust mRNA expression and DAAO immunoreactivity have been reported in the Bergmann glia and in the molecular and granule cell layers of the human cerebellum. In contrast to the cerebellum, DAAO mRNA and protein were localized to neurons in the prefrontal cortex, hippocampus and substantia nigra.38 The high expression level and the relationship between SelW and DAAO strongly demonstrate that DAAO may be of great significance to the biological function of SelW.
d-Serine plays a role in synaptic and cellular development in the brain. The synaptic plasticity, NMDA receptor transmission and neurotoxicity, important pathological and physiological processes, can be mediated by glutamate and the high bind between d-serine and the co-agonist site of NMDA receptors. DAAO, an enzyme once thought to metabolize d-serine from external sources.39 It has been reported that DAAO plays an essential role in degrading d-serine. A genetic association has been identified between DAAO and schizophrenia when d-serine is implicated.40 In this study, we found decreased viability of neuron cells with increasing concentrations of d-serine, indicating that d-serine could affect the viability of neurons. In the meantime, decreased DAAO activity was found in neurons treated with d-serine, which suggests that the activity of DAAO could be decreased by d-serine.
In this study, we found decreased activity of DAAO in Se-treated neurons in comparison to the control group. Meanwhile, the mRNA expression of SelW was also increased in both the DAA-I and DAA-II groups. On the contrary, the DAAO activity was decreased. Moreover, the results of the present study confirm that Se can increase the expression of SelW and decrease the activity of DAAO. According to the mechanism, SelW may inhibit the activity of DAAO when combined with each other, which indicates that the detoxification effect of DAAO on d-serine is regulated by Se via increasing the expression of SelW. On the other hand, we hypothesize that SelW could interfere with the activity of DAAO, and then change the toxic effect of d-serine, although the mechanism is not clear.
Conclusions
In summary, these results provide more research interest in the relationship between SelW and DAAO. We found molecular binding between SelW and DAAO. d-Serine, an amino acid whose mechanism is changed by the activity of DAAO, induced dose-dependent neurotoxicity. Our results suggest that part of the absorbed Se goes into the synthesized protein, and with more SelW more DAAO is bound, unless the system reaches saturation and the excess may exert cell toxicity with other mechanisms. The less unbound DAAO that is available, the less d-serine is degraded and the more d-serine can exert its toxic effect. In other words, Se can inhibit the toxicity of d-serine and maybe has a detoxifying ability by increasing the expression of SelW and decreasing the activity of DAAO. More particularly, d-serine regulates the expression of SelW by interfering with the activity of DAAO in chicken embryo neurons.
Conflicts of interest
The authors declare that there are no competing interests.
Acknowledgements
This study received assistance from China New Century Excellent Talents in University (No. NECT-1207-02), National Natural Science Foundation of China (No. 31572586), Excellent Youth Foundation of Heilongjiang Province of China (No. JC2017005) and Academic Backbone Project of Northeast Agricultural University (No. 15XG16). We also acknowledge the valuable help provided by Prof. Shi-Wen Xu in Northeast Agricultural University and all of the workers involved.
