A simple method to detect the tandem repeat of the cyp51A promoter in azole-resistant strains of Aspergillus fumigatus

Abstract

We designed primers and cycling probes to detect the tandem repeat (TR) of cyp51A promoter in Aspergillus fumigatus. A control-probe was designed to anneal to the outside of the TR region, whereas a TR-probe was designed to anneal to the inside of the TR region. For amplification and probe-hydrolysis detection, the CycleavePCR system was used. Although the difference between Ct values of the wild-type genome for the control-probe and the TR-probe was around −0.1, the difference between Ct values of TR-harboring strains was around 0.7. These data indicate that this is a simple method to detect TR in azole-resistant A. fumigatus.

real-time PCR, cycling probe, Aspergillus fumigatus, tandem repeat, azole resistance

Azole-resistant strains of Aspergillus fumigatus in the environment are a growing problem across the world, including in Japan.^1–3 These strains contain a 34-bp, 46-bp, or 53-bp tandem repeat (TR) in the cyp51A promoter in A. fumigatus. Recently, three or four 46-bp repeats have been found in environmental and/or clinical isolates⁴. These repeats are a good target to differentiate azole-resistant strains from wild-type strains. In the present study, we proposed a simple and convenient method to detect TR in resistant strains of A. fumigatus.

For the assay, we designed four oligonucleotides (Table 1). Two of the four oligonucleotides, TR-F and TR-R, were the primers used to amplify the cyp51A promoter region (approximately 120 bp in wild-type genome), including the TR region in azole-resistant strains (Table 1 and Figure 1a). The other two oligonucleotides were cycling probes, which is a variety of hydrolysis probes (Table 1). We designed a TR-probe to anneal to the inside of the TR region (Figure 1a) and a positive control (PC)-probe to anneal to the outside of the TR region (Figure 1a). The PC-probe was labeled with HEX fluorophore and used as the positive control. The TR-probe was labeled with FAM fluorophore and used as the indicator of TR.

Figure 1.

(a) The region of wild-type, TR₃₄, and TR₄₆ strains amplified by TR-F and TR-R primers whose annealing sites are indicated by arrows in the figure. Characters on the black background indicate the control-probe binding site. Boxed sites are TR-probe binding sites. Gray-background nucleotides indicate the tandem repeats of TR₃₄ and TR₄₆ strains. (b) Condition and procedure of real-time PCR analysis. (c) Differences of Ct values between the PC-probe and TR-probe. Circles and X marks indicate each mean of differences of Ct values from the TR₃₄ strain OKH50 and wild-type strain OKH31, respectively. Each experiment was repeated three times. Error bars indicate standard deviation. (d) Differences of Ct values between the PC-probe and TR-probe using genomic DNA. X marks indicate the differences of the OKH31 strain. Filled circles and triangles indicate the differences of OKH50 and IFM63432, respectively. Each experiment was repeated three times.

Table 1.

Oligo DNA and cycling probes used in this study.

Name	Sequence (5΄ → 3΄)
TR-F	ATGAGTGAATAATCGCAGCACC
TR-R	GTTAGGGTGTATGGTATGCTGG
TR-probe†	Eclipse-CTG(A)GCCGA-FAM
Control-probe†	Eclipse-TCTG(A) AGTGGT-HEX

^†Parentheses indicate RNA residues. Probes were conjugated with a quencher eclipse to the 5΄-end and a fluorophore FAM or HEX to the 3΄-end.

We prepared polymerase chain reaction (PCR) fragments from A. fumigatus OKH31 and OKH50 strains^3,5 amplified with TR-F and TR-R primers. A. fumigatus OKH50 is an azole-resistant strain harboring TR₃₄ in the cyp51A promoter. The copy numbers of the prepared PCR fragments from OKH31 and OKH50 were estimated as 4 × 10⁹ and 5 × 10⁹ copies/μl, respectively. These fragments were diluted 10, 10², 10³, 10⁴, 10⁶, or 10⁸ times with ultrapure water and then applied to real-time PCR as templates. The procedure of real-time PCR is shown in Figure 1b. Briefly, the PCR reaction mixture included 1 μl of template DNA, 0.2 μM each of TR-F and TR-R primers, 0.2 μM each of TR- and PC-probes, and 20 μl of CycleavePCR Reaction Mix (Takara Bio Inc., Shiga, Japan). LightCycler 480 Instrument II (Roche Diagnostics K.K., Tokyo, Japan) was used for the amplification and detection of hydrolysis. The reaction was performed by denaturation at 95°C for 30 s, followed by 45 cycles of denaturation at 95°C for 5 s, annealing at 55°C for 10 s, and polymerization and detection at 72°C for 15 s.

ΔCt values calculated as Ct_PC – Ct_TR, ranged from −0.22 to 0.04 for the fragment from OKH31, indicating equivalent levels of both PC and TR regions in the template DNA. In contrast, ΔCt values for OKH50 were around 0.6 or 0.7 (Figure 1c), indicating that the template DNA contained additional copy of the TR region compared with the PC region. The difference between ΔCt values of OKH31 and OKH50 was around 0.8, indicating that this method could differentiate TR-containing region from that of the wild type. Under the use of the smallest copy number (<100 copies) in this experiment, large variations were detected and ΔCt differences were smaller than those under the higher copy numbers because of unknown reason (Figure 1c), which suggests that pre-amplification is useful for samples containing a small a copy number of genomic DNA.

Furthermore, we used genomic DNA from A. fumigatus OKH31, OKH50, and IFM634321, a TR₄₆/Y121F/T289F strain, for the method. As shown in Figure 1d, the ΔCt values of the OKH31 genome were around −0.1. In contrast, the ΔCt values of OKH50 and IFM63432 strains were around 0.7. Genomic DNA from 12 other wild-type A. fumigatus strains also indicated the ΔCt values between −0.41 and −0.1 (data not shown). These data suggest that this method can be applied for TR detection from genomic DNA.

To summarize, we proposed a method to detect TR of the cyp51A promoter in azole-resistant strains. Multiplex real-time PCR assays are commercially available and are useful for the rapid identification of azole-resistant strains harboring TR as well as other point mutations. Our method provides another tool to identify azole-resistant strains with TR. Utilizing our method, the TR-probe can detect not only TR₃₄-harboring strains but also TR₄₆-harboring strains. Differentiation between TR34-harboring strains and TR46-harboring strains is important because resistance patterns between both strains are different. Cycling probes are useful to detect single-nucleotide polymorphisms; therefore, we are trying to prepare additional probes to differentiate between L98H and Y121F/T289F. We suggest that additional panels to TR detection are useful to differentiate between TR strains. The proposed method has another advantage in that the PC-probe and TR-probe anneal to and are consumed on the same amplicon; as a result, the Ct difference is not affected by the initial copy number of genome DNA and delay in amplification by inhibitory substances in the reaction mixture. Although this method needs to be validated using DNA from multiple strains and clinical specimens, this simple method was provided as another tool for TR detection in A. fumigatus.

Acknowledgments

This research is supported in part by the Research Program on Emerging and Re-emerging Infectious Diseases from Japan Agency for Medical Research and Development, AMED. The authors would like to thank Enago (www.enago.jp) for the English language review.

Declaration of interest

The authors report no conflicts of interest. The authors alone are responsible for the content and the writing of the paper.