Abstract

The response of the human endometrium to the ovarian hormones, estrogen and progesterone, has been the focus of decades of research. In order to understand this critical aspect of endometrial physiology, we undertook a genome‐wide analysis of transcript abundance and changes in transcript level between normal endometrium in the proliferative and secretory phases of the menstrual cycle. A high‐density, oligonucleotide gene array, comprising 60 000 gene targets, was used to define the gene expression profile of proliferative and secretory phase endometrium. Results from the arrays were verified using real‐time PCR. The expression levels of 149 transcripts differed significantly between the two phases of the cycle determined by stringent range limits (99.99%), calculated using local variance values. These transcripts include previously documented steroidally responsive genes (such as placental protein 14 and stromelysin‐3) and novel transcripts not previously linked to either endometrial physiology or steroid regulation (such as intestinal trefoil factor and a number of expressed sequence tags). Examination of the 5′ promoter regions of these genes identified many putative estrogen and progesterone receptor DNA binding domains, suggesting a direct response of these genes to the ovarian hormones.

Submitted on August 6, 2002; accepted on September 15, 2002

Introduction

The human endometrium is a complex tissue and its cyclic regulation requires the successful interaction of hundreds of factors. Normal human endometrium exhibits an idealized 28 day cycle, strictly controlled by the ovarian sex steroid hormones, estrogen and progesterone. The steroid hormones elicit their actions by binding to specific high‐affinity receptors [estrogen receptor (ER)‐α, ER‐β and progesterone receptor (PR)]; these act as ligand‐dependent transcription factors (O’Malley and Tsai, 1992). In order to turn transcription on, the steroid hormones form homodimers and bind to the corresponding hormone. This complex then binds to the steroid response element to activate the transcription factors and begin transcription. Cooke et al. (1997) used the ERKO (estrogen receptor knock‐out) mouse model to demonstrate that the proliferative effect of estrogen on uterine epithelium was a paracrine event, mediated through stromal estrogen receptors. Estrogen binds to the estrogen receptor in uterine stromal cells to trigger production of paracrine factors which act on uterine epithelium to stimulate mitogenesis (Cooke, 1997). These indirect mechanisms rely on the correct functioning and interaction of many local factors in the endometrium. It is these crucial local factors, or the pathways that lead to their generation, which we aimed to identify. We propose that this information will allow a greater understanding of the processes which regulate the human endometrium.

Previous methods of investigation have limited research to small sub‐groups of factors. Here we use oligonucleotide microarrays to assess the levels of all known transcripts in the human endometrium. Microarrays are now a widely recognized tool for effective assessment of thousands of genes in a single sample. Many different types of arrays are available, depending on the experimental needs. Affymetrix chips are two‐dimensional, high‐density oligonucleotide arrays capable of assessing the level of 60 000 transcripts within a single sample.

One significant problem with microarray experiments is how to effectively analyse the data and determine the statistical significance of the observed changes. Many studies simply assess fold change values between genes in control and experimental samples, accepting any gene with a fold change greater than a previously designated threshold value. However, this method is simplistic and prone to a high false positive rate. This is because there is considerably more variation in the signals obtained for transcripts with low signal values and small changes in the absolute value are greater. For example, a fold change of 20 may appear to be more interesting than a fold change of 4, but if the transcript levels actually change from 8000 to 32 000 (a 4‐fold change) then this would be of more importance than a change of 2 to 40 (a 20‐fold change). We have developed a novel method of statistical analysis of chip data to overcome these limitations.

Although endometrial physiology has been the focus of decades of research, many unresolved questions remain. Due to the large number of factors acting in combination, it is particularly difficult to gain a clear understanding of endometrial regulation. By determining the response of all the transcripts in this steroidally controlled tissue, we offer a description of those factors of importance in normal cyclic endometrium including a number of factors previously unreported in human endometrium.

Materials and methods

Tissue collection

Endometrial samples (10–500 mg) were obtained from five women between days 9 and 11 of the menstrual cycle (the proliferative phase group) and a further five samples from women, 6–8 days after the LH surge, as judged by measurement of urinary levels of LH.

All women had a normal pelvice (i.e. no endometriosis) as assessed by laparoscopic investigation for unexplained infertility (n = 1), dyspareunia (n = 5), sterilization (n = 3) or fertility investigation (n = 1). Of the 10 women included in the study, one was nulliparous, one had one child, four had two children, two had three children and two were unknown. None of the 10 patients had received any hormone therapy within 3 months before the biopsies were taken. The median age of patients was 35.7 years and the range was between 23 years and 44 years. All women had regular cycles (between 28 and 32 days). All tissues were examined by a histopathologist, who was unaware of the day of collection and all samples were found to be consistent with the appropriate stage of the cycle. For women in the secretory phase of the menstrual cycle, plasma levels of progesterone were determined by radioimmunoassay and all levels were >25 nmol/l. This project was approved by the Ethics Committee of Addenbrookes’ Hospital NHS Trust and written consent was obtained from all patients.

RNA extraction and performance of Affymetrix arrays

Total RNA was separately extracted from each tissue using Trizol Reagent (Invitrogen Life Technologies, Paisley, UK) and cleaned up using RNeasy affinity columns (Qiagen, Crawley, Sussex, UK). Total RNA was pooled into each group (proliferative or secretory) to give a total of 10 µg total RNA (2 µg from each sample). A sample of 5ug total RNA from each group was taken to run on the microarrays. Biotin labelling was performed according to the manufacturer’s instructions (Affymetrix Expression Analysis Technical Manual). Briefly, double‐stranded cDNA (ds‐cDNA) was synthesized and purified by phenol/chloroform/isoamyl alcohol. In‐vitro transcription was performed with biotin‐labelled CTP and UTP (Enzo Diagnostics, Farmingdale, NY, USA). RNeasy affinity columns (Qiagen) were used for clean‐up of the labelled probe. Samples were hybridized to Affymetrix HG_U95 chips A–E and stained with a streptavadin–phycoerythrin (SAPE) stain. These arrays together cover 60 000 human genes and expressed sequence tags (EST) with roughly 12 000 being distributed over each of the five chips. All Affymetrix work was performed at Pfizer Global Research & Development, Sandwich, UK.

Although Affymetrix chips address the same questions as other microarrays, their method of assessment is markedly different. Each transcript is represented on the chip as a set of 16–20 ‘probe pairs’ with each pair containing a ‘perfect‐match’ and a ‘mis‐match’. The perfect‐match is the precise reverse complement of the sequence of the transcript of interest. The mis‐match is the same oligonucleotide as the perfect match but with a single base substitution at the central position. By comparing the hybridization level between the perfect‐match and the mis‐match, one can correct for the amount of non‐specific hybridization. The Affymetrix Absolute Analysis algorithm (version 4.0) was used to analyse the scanned image. Global scaling techniques were used for all probe sets, to make the average intensity of each image equal to an arbitrary target intensity, set to 300. Transcript levels were assessed for all 60 000 genes and EST.

Statistical analysis

In order to highlight genes of particular interest, scatter plots were generated of average log transcript level in both phases of the cycle (x‐axis) against difference in log transcript levels between the phases (y‐axis). This was done for transcripts on chip A and for transcripts on chips B–E. Using the methods described below, we determined reference boundary limits (95, 97.5, 99, 99.5 and 99.99%). Genes/transcripts falling outside of these boundaries were taken to be significant.

The log‐transformation allows the results to be interpreted in relation to the original expression data. The variables XPg and XSg represent the intensities corresponding to a gene (or EST) g in the proliferative and secretory samples respectively. Genes (or EST) with negative intensities in either one or both samples (a total of 22 321) are removed from the analysis.

A Bland–Altman type plot of the difference in log‐intensities, also known as the log‐intensity ratio, i.e.

graphic

versus the mean of the log‐intensities, or the log‐geometric mean intensity, i.e.

graphic

is plotted (Altman and Bland, 1983; Bland and Altman, 1986, 1999). Superimposed on the graph are upper and lower reference lines (collectively known as the reference boundary ranges), which indicate different levels of belief on whether there is either up‐ or down‐ regulation of a gene in the secretory sample compared with the proliferative sample. For this study, a gene (or EST) is potentially differentially expressed if its log‐intensity ratio falls outside the 99.99% reference boundary range. The 99.99% limit was chosen instead of lesser extreme ones to overcome the problem of identifying too many false positives.

The Bland–Altman approach for constructing limits of agreement in method comparison studies is applied here to form the 99.99% [or any other, say 100(1 – α)%] reference boundary. The upper and lower 100(1 – α)% reference points of the reference boundary are defined for each gene (or EST), g, as

graphic

where graphic is the SD of the log‐intensity ratio corresponding to gene g and z1–α/2 is the (1α/2) upper percentile point of the standard normal distribution. Thus the 99.99% reference points for a gene g are obtained from (1) with z1–α/2 replaced by 3.89.

Note that graphic is allowed to change with g. This is done because it was observed that the variability of the log‐intensity ratio increased with decreasing mean log‐intensity and therefore it was necessary to model the SD of the log‐intensity ratios in terms of the mean log‐intensities. graphic is defined as the sample SD of the log‐intensity ratios of g and its neighbours. A neighbour of g is defined as a gene that has a mean log‐intensity within a distance of two bandwidths of g (on either side). Here the bandwidth, h, is calculated as

graphic

where n is the number of genes (or EST) considered and Var(.) and IQR represent the sample variance and the inter‐quartile range of the mean log‐intensity data respectively. Note that other choices of h can be used. The h chosen here is obtained from the Kernel Density Estimation literature (see Silverman, 1986). Note that we have chosen to borrow strength from the neighbours of a gene in order to calculate its SD. Thus we implicitly assume that genes with mean log‐intensities that are similar also have similar variability in their log‐intensity ratios.

The upper and lower reference coordinates of g are defined on the (x,y)‐Cartesian Coordinate System as

graphic

with some abuse of notation. To produce smooth curves (upper and lower) from these reference coordinates, a robust locally linear scatter plot smoother called ‘lowess’, available in the statistical software package S‐PLUS 2000© (1988–2000, MathSoft Inc; Cambridge, MA, USA), is employed.

Promoter analysis

Many of the transcripts identified in cyclic endometrium are under the direct influence of steroid hormone control. We investigated transcripts’ promoter regions for candidate steroid hormone response elements in silico using the Match™ database hosted by the Gene Regulation website (http://www.gene‐regulation.com/cgi‐bin/pub/programs/match/match.cgi). Transcript promoter regions were determined by analysis of the DNA sequence upstream of the 5′ start region of the gene of interest, as determined by investigation of corresponding genomic DNA and chromosomal sequences. Approximately 1 kb of promoter region from each transcript was used in each analysis. Only the vertebrate matrix was investigated. Core similarity and matrix similarity thresholds were set at the most stringent levels of 0.9 and 0.95 respectively and the number of candidate estrogen response elements (ERE) and progesterone response elements (PRE) determined.

Real‐time PCR verification

In order to verify the results obtained from the Affymetrix chips, real‐time PCR (Taqman) verification was performed for five genes: glutathione peroxidase 3 (GPX3), 17β‐hydroxysteroid dehydrogenase (17β‐HSD), metallothionein‐1G (MT‐1G), intestinal trefoil factor (TFF3) and lysyl tRNA synthetase. Primers and probes were designed using the Primer Express v1.5 software (Applied Biosystems, Warrington, UK) and purchased from Applied Biosystems and Sigma Genosys (Cambridge, UK). RNA from four of the five samples from the proliferative phase endometrium which were pooled for the Affymetrix chips and all five of the secretory phase samples were analysed individually. Details of the primers and probes used in the verification analyses are detailed below. All primers were labelled with 5′FAM and all probes were high‐performance liquid chromatography‐purified and labelled with TAMRA as the quencher.

GPX3 primers and probes were 5′CATCCCCTTCAAGCAGTATGCT‐3′ (forwards primer, Tm = 59), 5′GCCCGTCAGGCCTCAGTAG‐3′ (reverse primer, Tm = 59) and 5′AAATACGTCCTCTTTGTCAACGTGGCCA‐3′ (probe, Tm = 69). 17β‐HSD primers and probes were 5′GGCTTCCCAGGATCTGACT‐3′ (forwards primer, Tm = 59), 5′CCAGCTTTCCCACTTGTCACT‐3′ (reverse primer, Tm = 59) and 5′TTCCTTTCACCCCAGATATCGCAGGC‐3′ (probe, Tm = 69). MT‐1G primers and probes were 5′GCCAAATTCCCAGACACCAT‐3′ (forwards primer, Tm = 58), 5′GAGTCCCCTTACCTCTGATAGCAA‐3′ (reverse primer, Tm = 59) and 5′AGTGTCCCTGGGTTTGAGGAGGTCGTAT‐3′ (probe, Tm = 68). TFF3 primers and probes were 5′CCTTGCCCGGCTGTGA‐3′ (forwards primer, Tm = 59), 5′GCTTGCCGGGAGCAAAG‐3′ (reverse primer, Tm = 59) and 5′TGCTGCCAGGCACTGTTCATCTCAGT‐3′ (probe, Tm = 69). Lysyl tRNA synthetase primers and probes were 5′CGTGGACCCAAATCAATACTACAA‐3′ (forwards primer, Tm = 59), 5′GGGTATGGGTCTTCCCCATT‐3′ (reverse primer, Tm = 58) and 5′TCCGCAGTCAAGCAATTCATCAGCTG‐3′ (probe, Tm = 69). In addition to the transcripts above, two endogenous controls (β‐actin and cyclophilin) were assayed using the pre‐designed primers and probes from Applied Biosystems and their levels of expression did not change between phases (data not shown). Standard curves were generated between experimental and endogenous transcript levels to ensure that the transcripts amplified at the same rate. This allows for normalization of differing amounts of starting material between samples. GPX3 was normalized to cyclophilin and the remaining four transcripts were normalized to β‐actin. Cycle threshold (Ct) values were obtained and delta Ct (ΔCt) values calculated (ΔCt = experimental Ct – endogenous Ct). This ratio of experimental to endogenous signal was then compared with the transcript level ratio for the same transcripts from the Affymetrix results.

Results

Transcripts were ranked by abundance to assess the most highly expressed genes in human endometrium. As expected, the most abundant transcripts encoded ribosomal proteins and the spiked controls with the Alu‐(Sq) sub‐family consensus sequence being the second most highly expressed gene (data not shown). Of the 12 626 transcripts represented on the HG_U95A chip, 5114 were recorded as ‘present’ in the proliferative phase and 4370 in the secretory phase. Table I shows the top 200 most highly expressed transcripts in proliferative and secretory phase endometrium. There is little difference between the highest ranking transcripts of the two phases of the cycle; of the 200 most highly expressed genes in proliferative endometrium, 182 were also found in the 200 most highly expressed genes in secretory endometrium. On the remaining four chips covering 50 549 transcripts (HG_U95B‐E chips), 14 549 transcripts were present in the proliferative phase and 12 401 were present in the secretory phase. Genes were sub‐grouped according to function and ribosomal proteins and controls were excluded from the analyses to allow clearer evaluation of genes of interest. In order to identify transcripts that differ between the two phases of the menstrual cycle, we considered both the transcript level in each phase and the change in transcript level between the two phases.

As described previously, the Affymetrix analysis software often assigns negative values to the ‘average difference value’ or transcript level. Transcripts which fall into this category (in either of the two phases) have been excluded from our initial statistical analyses since negative numbers cannot be log‐transformed. We have therefore excluded 3868 and 18 453 transcripts from the chip A and chips B–E analyses respectively. Transcripts that have been excluded from this type of analysis are discussed later.

Transcripts were divided into two main groups, those present on the HG_U95A chip, being the 12 626 most well‐defined genes, and the remaining 50 281 less well‐defined transcripts and EST present on the HG_U95B‐E chips. Signal intensities (‘average differences’) for individual transcripts were plotted as increasing average log transcript level from both phases of the cycle (x‐axis) against the difference in log transcript level between the two phases (y‐axis) (Figure 1). Values are either positive (more highly expressed in the secretory phase) or negative (more highly expressed in the proliferative phase). This method of representing the data provided an effective means of highlighting transcripts which are both highly expressed in the endometrium and changing significantly between the two phases of the menstrual cycle. Figure 1a represents 8758 transcripts and Figure 1b represents 31 828 transcripts. Reference limits (95, 97.5, 99, 99.5 and 99.99%) were set and the transcripts lying outside of each range noted.

Table II lists the 146 genes that lay outside of the 99% reference limits for the HG_U95A chip, including the 30 genes that lay outside of the 99.99% reference limits (marked by an asterix). The list of genes found outside of the less extreme boundaries can be found on our website (www.obgyn.cam.ac.uk). Transcripts were grouped according to function to provide a framework for understanding the network of genes that influence endometrial physiology.

As many of the transcripts which change with the cyclic endometrium may act under the influence of steroid hormones, we probed the promoter regions of genes of interest for candidate ERE and PRE. This was performed in silico using the online tool, Match™. Table II shows the results from the analysis. Promoter regions were defined as described in Materials and methods and probed for both putative ERE and PRE, as defined by the Transfac™ database. Many of the transcripts which increased in the secretory phase exhibited a number of candidate progesterone response elements, e.g. transcobalamin had eight putative PRE and one candidate ERE and GPX3 had three PRE and two ERE. However, the number of candidate steroid response elements did not always reflect the behaviour of the gene. Those transcripts seen to be up‐regulated in the secretory phase and therefore probably responsive to progesterone stimulation, and did not necessarily show a corresponding increase in the number of candidate PRE.

A number of transcripts were excluded from our initial statistical analyses due to having a negative average difference in one of the samples, as described earlier. Many of these transcripts may be interesting, for example a transcript may be recorded as ‘absent’ by the Affymetrix software (and given a negative average difference value) in one phase but highly expressed in the other phase, therefore being of considerable interest. Table III lists the excluded transcripts with the highest apparent fold change (>6) as determined by the Affymetrix version 4.0 software. As with Table II, transcripts have been sub‐grouped into families according to function and probed for candidate ERE and PRE.

In order to verify our findings from the Affymetrix arrays, we performed real‐time PCR (Taqman analysis) on five genes; GPX3, 17β‐HSD, MT‐1G, TFF3 and lysyl tRNA synthetase. As can be seen from Figure 2, all five genes confirmed the results from our Affymetrix arrays. TFF3 had a greater transcript level in proliferative phase endometrium compared with secretory phase endometrium. GPX3, 17β‐HSD and MT‐1G exhibited a greater transcript level in secretory phase endometrium compared with proliferative phase endometrium and the level of lysyl tRNA synthetase remained largely unchanged throughout the cycle.

Discussion

The endometrial cycle is determined by the ovarian sex steroids, estrogen and progesterone. The action of these hormones can be direct or indirect; cells may be stimulated to proliferate or secrete a protein, or alternatively an epithelial cell, for example, may respond to an estrogen‐induced factor synthesized by a stromal cell. In the course of this study we have identified transcripts that are regulated and that reflect both modes of action.

Of the 5611 transcripts identified as present in the endometrium, the majority remained unchanged throughout the cycle. Many of these genes are highly expressed in endometrium and further characterization may allow them to be used as tissue‐specific markers of endometrium. Expression levels of other genes did alter between the two phases of the cycle. We designed a statistical approach which allows the identification of genes whose expression levels change significantly between the two phases of the cycle and, as would be expected, these factors cover a range of protein families and physiological roles. The utility of this statistical method has been confirmed in two ways. Firstly our data are in agreement with previous studies that have identified some of the genes thought to be regulated during the menstrual cycle. These genes, for example the progesterone‐dependent PP14 (glycodelin), are listed in Table IV. In addition, we have identified known transcripts either not previously identified in the endometrium or known to be steroid responsive. We have confirmed the presence and cycle‐dependent changes for a small number of these by real‐time PCR (Taqman). All five Taqman experiments confirmed the results from our Affymetrix studies.

A recent investigation by Kao et al. also investigated gene expression in cycling human endometrium using Affymetrix microarrays. We show a novel statistical approach that allows the simultaneous consideration of transcript level in the tissue and the change in transcript expression levels between phases of the menstrual cycle. Although the approach and analysis of the two investigations were markedly different, similar findings were obtained from both. This highlights the strength of Affymetrix microarrays as tools for large scale investigations and broadly confirms the findings of both studies. Additionally, we report a group of genes highly expressed in the endometrium that do not alter in expression levels between the two phases of the cycle. We propose that these genes may be useful as molecular markers of human endometrium. Our analysis also extended past the 12 626 named genes analysed by Kao et al., to include all known genes and EST covered by the Affymetrix HG_U95 chips (60 000 in total), thus providing access to the most comprehensive gene expression profile for human endometrium to date. Furthermore, we investigated the steroid hormones’ action on the human endometrium by promoter analysis, highlighting transcripts thought to be acting directly in response to steroid hormone stimulation.

Our analysis identified over 100 known genes as being differentially expressed by cycling endometrium. These factors were subdivided into a variety of functional families: transcription factors, cell death and survival factors, transport and carrier proteins and differentiation and embryonic polarity mediators such as the Wnt (wingless‐type MMTV integratin site) family of genes (Tables II and III). A number of novel factors not previously documented in human endometrium or previously shown to be hormonally regulated were also discovered. Here, we focus on the roles of two genes poorly defined in the endometrium; TFF3 and GP3.

Proliferative endometrium needs a number of growth and remodelling factors for successful regeneration of the denuded endometrium. One gene that falls into the category of remodelling factors is TFF3. The trefoil family of peptides (TFF) are mucin‐associated peptides found predominantly in mucus‐secreting cells of the gastrointestinal mucosa (Poulsom and Wright, 1993). This family of peptides share a common domain of 42–43 amino acids, including six cysteine residues, which form three disulphide bonds. This gives the proteins their characteristic three‐loop structure and the family name (Thim, 1997). TFF and the mucins are often co‐expressed in mucous cells and are thought to be involved in mucus structure and processing. Another function of the trefoil peptides is to maintain the surface integrity of mucus epithelia (Mashimo et al., 1996; Poulsom, 1996). They act as motogens to promote epithelial cell migration (Dignass et al., 1994) and mediate epithelial repair after damage, also referred to as restitution (Poulsom, 1996; Podolsky, 1997). The expression of the trefoil peptides is rapidly up‐regulated after mucosal damage in mice and TFF3 knockout mice exhibit impaired mucosal healing (Williams and Wright, 1997).

Previous literature on TFF3 expression in the human endometrium is conflicting. Wiede et al. (2001) reported the finding of trefoil peptides in the human uterus, specifically TFF3 mRNA being in the surface epithelium of the endocervix. TFF‐1 and ‐2 mRNA were detected occasionally in the endocervix and very rarely in the endometrium. Western blot analysis revealed TFF3 to be a constituent of human cervical mucus and located in the gland‐like structures of the cervical epithelium. By RT–PCR, TFF3 was detectable in the endometrium but no cycle‐dependent changes were seen and the protein was not detectable by Western blot analysis. Our investigations showed a 52‐fold greater level of TFF3 in the proliferative phase of the cycle compared with the secretory phase. Similarly, our real‐time PCR studies showed an average 15‐fold increase in TFF3 level in the proliferative phase compared with secretory phase. Promoter analysis identified two candidate ERE but no PRE in this gene. In agreement with our findings, Kao et al. (2002) reported the increased expression of TFF3 in proliferative endometrium compared with endometrium at the time of implantation as assessed by Genechip technology.

The increased level of TFF3 mRNA during menstrual repair and epithelial proliferation suggests that this factor may play a role at this time as considerable epithelial cell migration is required. Due to its motogenic and anti‐apoptotic effects, we propose that human intestinal trefoil factor plays a key role in the regeneration of the human endometrium following menstruation.

Glutathione peroxidase 3 (GPX3) and metallothionein act to protect cells from damage from unstable reactive radicals and heavy metals (Kagi, 1991; Sies, 1993). The glutathione peroxidases are a family of reducing agents, which function to reduce hydrogen peroxide and organohydroperoxides (Ursini et al., 1995; Arthur, 2000). Cells exposed to such reactive oxygen species (oxygen free radicals) are subject to considerable damage, often resulting in death of the cell (Buttke and Sandstrom, 1994). Free radical damage is implicated in the pathophysiology of a number of organs including the endometrium (Ishikawa et al., 1993; Hubel, 1999; Beltran‐Garcia et al., 2000). Glutathione peroxidases reduce these free radicals to harmless compounds. The glutathione peroxidase family are selenium‐dependent proteins (Flohé et al., 1973; Rotruck et al., 1973). Selenium deficiency in women is associated with spontaneous abortion and infertility (Kingsley et al., 1998), thus the selenium‐dependent GPX may play a role around the time of implantation to protect the embryo from oxidant damage and to create a safe environment for reception of a fertilized ovum.

Recently, glutathione peroxidase 1 (GPX1) was identified in the surface and glandular epithelium of normal, eutopic, human endometrium throughout the menstrual cycle. Expression was assessed by immunohistochemistry and GPX1 was weakly observed in the early proliferative phase, gradually increasing to a peak in the early secretory stage before decreasing again thereafter (Ota et al., 2000). To date, there are no published data describing the specific expression of plasma glutathione peroxidase (GPX3) in the human endometrium. We found that GPX3 was highly expressed in secretory phase endometrium but only detectable at very low levels in the proliferative phase (94.9‐fold higher in secretory phase compared with proliferative phase). Similarly, our real‐time PCR studies found an average 50‐fold increase in GPX3 expression in secretory phase versus proliferative phase endometrium. However, this was only true for samples obtained on day LH+8 (70.8‐fold and 172.86‐fold increase). On assessment of the promoter region of the GPX3 gene, we identified three candidate PRE and two candidate ERE.

The metallothioneins are ubiquitous low molecular weight proteins that protect cells against heavy metal ion toxicity and damage from oxygen‐derived free radicals (Kagi, 1991). Heavy metal ions and oxygen free radicals may be detrimental to the attachment, implantation and development of the embryo (Orsi and Leesse, 2001). Our study reports the differences in expression levels of metallothionein between the phases of the menstrual cycle. We show that four metallothionein isoforms are up‐regulated in secretory phase endometrium (MT‐1G, MT‐1E, MT‐1H and MT‐III). We verified this finding with real‐time PCR experiments (MT‐1G) and our promoter analysis revealed four candidate PRE compared with only two candidate ERE for this gene.

It is possible that plasma glutathione peroxidase and the metallothioneins are up‐regulated by progesterone in human endometrium to protect the implanting embryo from harmful reactive oxygen species and heavy metal ion toxicity.

Identification of candidate ERE and PRE in the promoters of these genes suggests the possibility of direct steroid regulation. A number of transcripts markedly up‐regulated in the progesterone‐dominated secretory phase (e.g. MT‐1G and GPX3) displayed more candidate PRE than ERE. In addition, genes down‐regulated in the secretory phase, e.g. MUC5B, also displayed more candidate PRE than ERE. However, some transcripts known to be steroidally responsive, such as osteopontin (Johnson et al., 2000), had no ERE or PRE at all when probed using the criteria previously described. These genes may contain the hormone response elements outside the region of the promoter we analysed or the criteria may have been too strict. Alternatively they respond to steroids via indirect mechanisms.

In conclusion, we have catalogued all the transcripts present in human endometrium. Using a novel statistical approach, we have described transcripts with significantly different levels between the proliferative and secretory phases of the menstrual cycle. Additionally we identified candidate ERE and PRE in the promoter regions of these genes. We present two factors, GP3 and TFF3, as novel regulators of human endometrial function.

Acknowledgements

We thank Claire M.Johnson for her technical help with the Affymetrix chips. This work was supported by a BBSRC CASE award in collaboration with Pfizer Ltd.

Figure 1. The 95, 97.5, 99, 99.5 and 99.99% reference limits. (a) Transcripts used from the HG_U95A chip (a total of 8758). (b) Transcripts from the HG_U95B‐E chips (a total of 31 828). Transcripts where the average difference value is negative for one or both phases of the cycle are excluded due to the inability to log‐transform negative values.

Figure 1. The 95, 97.5, 99, 99.5 and 99.99% reference limits. (a) Transcripts used from the HG_U95A chip (a total of 8758). (b) Transcripts from the HG_U95B‐E chips (a total of 31 828). Transcripts where the average difference value is negative for one or both phases of the cycle are excluded due to the inability to log‐transform negative values.

Figure 2. Results from the real‐time PCR verification of our Affymetrix results using the RNA from individual samples, which were pooled for the Genechip study. Results observed from microarrays for GPX3, MT‐1G, 17β‐HSD, TFF3 and lysyl tRNA synthetase were all verified by this method. y‐Axes represent the ratio of the gene of interest to the endogenous control as assessed by Affymetrix chips (left‐hand side) and real‐time PCR (Taqman) (right‐hand side). [tick] represents the expression ratio on the Affymetrix chip or per patient in the Taqman results. [cross] represents the average ratio value from the Taqman results.

Figure 2. Results from the real‐time PCR verification of our Affymetrix results using the RNA from individual samples, which were pooled for the Genechip study. Results observed from microarrays for GPX3, MT‐1G, 17β‐HSD, TFF3 and lysyl tRNA synthetase were all verified by this method. y‐Axes represent the ratio of the gene of interest to the endogenous control as assessed by Affymetrix chips (left‐hand side) and real‐time PCR (Taqman) (right‐hand side). [tick] represents the expression ratio on the Affymetrix chip or per patient in the Taqman results. [cross] represents the average ratio value from the Taqman results.

Table I.

The 200 most abundant transcripts present in proliferative and secretory phase endometrium

Gene type Rank in proliferative phase Rank in secretory phase 
Ribosomal proteins   
    A total of 88 ribosomal proteins (range) 2–192 4–197 
Internal controls   
    A total of 10 internal controls (range) 1–153 1–99 
Structural factors   
    U34995 normal keratinocyte subtraction library mRNA 
    Z19554 vimentin 17 30 
    M22919 non‐muscle/smooth muscle alkali myosin light chain 38 36 
    X14420 pro‐alpha‐1 type 3 collagen 39 20 
    X04098 cytoskeletal gamma actin 72 63 
    X63432 ACTB mutant beta‐actin 81 29 
    X52851 cyclophilin gene 82 82 
    M63573 secreted cyclophilin‐like protein 89 98 
    AL031670 ferritin light, polypeptide 1 103 129 
    J03464 collagen alpha‐2 type 1 104 97 
    J04755 ferritin H processed pseudogene 106 21 
    AB021288 beta‐2‐microglobulin 120 79 
    V00599 mRNA fragment encoding beta‐tubulin 121 185 
    V00503 mRNA encoding pro‐alpha‐2 chain of type 1 collagen 126 92 
    K00558 alpha‐tubulin 132 169 
    U21128 Lumican 136 165 
    X95404 non‐muscle type cofilin 157 105 
    V00567 mRNA fragment for the beta‐2 microglobulin >200 53 
    S82297 beta‐2‐microglobulin >200 108 
    X05610 mRNA for type IV collagen alpha (2) chain >200 193 
Transcription factors   
    AF054187 NAC 86 99 
    X53281 BTF3b 148 166 
    X58965 nm23‐H2 gene 168 >200 
    AF054187 NAC 170 178 
    M55914 c‐myc binding protein (MBP‐1) 182 132 
    M94046 zinc finger protein (MAZ) 184 197 
    Z93930 clone 292E10 on chromosome 22q11–12 >200 162 
    X75861 TEGT gene >200 199 
Proteases   
    X04470 antileukoprotease (ALP) from cervix uterus 66 177 
    X57766 stromelysin‐3 133 >200 
    X98296 ubiquitin hydrolase >200 176 
Intracellular/signalling factors   
    X04803 Homo sapiens ubiquitin gene 78 117 
    U49869 human ubiquitin gene 93 127 
    AB009010 polyubiquitin UbC 94 43 
    AB002533 Qip1 97 112 
    U73824 p97 109 114 
    M26880 ubiquitin mRNA 112 48 
    M26880 ubiquitin mRNA 113 61 
    AI525652 PT1.3_01_C04.r1 143 150 
    D78361 ornithine decarboxylase antizyme 149 158 
    J03077 co‐beta glucosidase (proactivator) 161 >200 
    M92383 thymosin beta‐10 171 108 
    AI971724 wr07a04.x1 172 185 
    M22806 prolyl 4‐hydroxylase beta‐subunit and disulphide isomerase gene 173 171 
    Y00345 polyA binding protein 175 141 
    J04599 hPGI mRNA encoding small bone proteoglycan 1 176 >200 
    AF026692 frizzled related protein FrpHE 177 >200 
    X04409 coupling protein G(s) alpha‐subunit 179 151 
    Z48501 polyadenylate binding protein II 186 159 
    X70326 MacMarcks mRNA 189 >200 
    X56009 GSA mRNA for alpha subunit of GsGTP binding protein 193 143 
    J04173 phosphoglycerate mutase 195 187 
    Spermidine/spermine N1‐acetyltransferase Alt Splice 2 >200 54 
    M98539 prostaglandin D2 synthase >200 112 
    Y10387 PAPS synthetase >200 122 
    AF039656 neuronal tissue enriched acidic protein (NAP‐22) >200 135 
    AI207842 ao89h09.x1 >200 137 
    X04409 coupling protein G(s) alpha‐subunit >200 152 
    J03592 ADP/ATP translocase mRNA >200 183 
    U12472 glutathione S‐transferase >200 187 
Transporters   
    L48215 beta‐globin (HBB) gene 65 94 
    M94250 retinoic acid inducible factor (MK) 137 >200 
    D14696 lysosomal associated protein transmembrane 4‐alpha 147 162 
    J03592 ADP/ATP translocase 154 182 
    M25079 sickle cell beta globin 187 >200 
Growth factors   
    J03040 SPARC/osteonectin 128 82 
    X86693 hevin‐like protein 159 >200 
    X55110 neurite outgrowth‐promoting protein 181 >200 
Membrane proteins/immunological factors   
    M24194 MHC protein homologous to chicken B complex protein 45 31 
    D00017 lipocortin II 80 12 
    M62895 lipocotin (LIP) 2 pseudogene 83 17 
    V00567 mRNA fragment for the beta‐2 microglobulin 91 53 
    M33680 26 kDa surface protein TAPA‐1 102 38 
    X58536 HLA class 1 locus C heavy chain 111 42 
    M24194 MHC protein homologous to chicken B complex protein 117 154 
    Y12711 putative progesterone binding protein 135 >200 
    M14630 prothymosin alpha 138 138 
    S82297 beta‐2‐microglobulin 140 107 
    Heat shock protein, 70 kDa 142 101 
    L19686 macrophage migration inhibitory factor (MIF) 146 124 
    X15183 90 kDa heat shock protein 164 195 
    M16660 90 kDa heat shock protein gene 178 189 
    J04182 lysosomal membrane glycoprotein‐1 (LAMP1) 191 >200 
    Z23090 28 kDa heat shock protein 194 129 
    L33930 CD24 signal transducer 198 165 
    D32129 HLA class‐1 heavy chain >200 177 
    AL031295 DNA sequence from clone 886K2 on chromosome 1p35.1–36.12 (epimerase) >200 200 
DNA/RNA proteins   
    U28686 putative RNA binding protein RNPL 85 139 
    X77956 Id1 145 140 
    X78136 hnRNP‐E2 163 >200 
    D30655 mRNA for eukaryotic initiation factor 4AII 185 170 
Apoptotic/tumour proteins   
    AI535946 lectin 33 103 
    M55409 pancreatic tumour‐related protein 69 83 
    AF054183 GTP binding protein (RAN) 151 194 
    L09159 RHOA proto‐oncogene multidrug resistance protein 167 149 
    AL050268 DKFZp564B163 188 173 
    X56681 junD mRNA >200 170 
    X56681 junD mRNA >200 181 
Kinases   
    M19311 calmodulin 152 146 
    X15334 gene for creatinine kinase >200 173 
    V00572 mRNA encoding phosphoglycerate kinase >200 184 
Miscellaneous/unknowns   
    L41498 longation factor 1‐alpha (PTI‐1) 
    AI541542 lobtest16.A02.r 16 
    M17733 thymosin beta‐4 19 
    J04164 interferon‐inducible protein 9–27 32 52 
    AB011114 KIAA0542 99 142 
    U20982 insulin‐like growth factor binding protein 4 (IGFBP4) gene 122 160 
    X13794 lactate dehydrogenase B 129 167 
    M11353 H3.3 histone class C mRNA 134 125 
    L27560 insulin‐like growth factor 5 (IGFBP5) 150 >200 
    AI540925 cytochrome oxidase C 155 135 
    AI540958 PIN (inhibitor of NOS) 156 152 
    M62403 insulin‐like growth factor 4 (IGFBP4) mRNA 162 >200 
    AI540957 PEC1.2_15_G03.r 180 191 
    X13794 lactate dehydrogenase B gene exons 1 and 2 190 106 
    AI708889 cytochrome C oxidase 197 >200 
    L27560 insulin‐like growth factor 5 (IGFBP5) 199 >200 
    U30521 P311 HUM (3.1) mRNA 200 >200 
    L19182 MAC25 >200 148 
    AF095154 C1q‐related factor >200 157 
    S73591 brain expressed HHCPA78 homolog >200 182 
    U50523 BRCA2 region, mRNA sequence CG037 >200 189 
Gene type Rank in proliferative phase Rank in secretory phase 
Ribosomal proteins   
    A total of 88 ribosomal proteins (range) 2–192 4–197 
Internal controls   
    A total of 10 internal controls (range) 1–153 1–99 
Structural factors   
    U34995 normal keratinocyte subtraction library mRNA 
    Z19554 vimentin 17 30 
    M22919 non‐muscle/smooth muscle alkali myosin light chain 38 36 
    X14420 pro‐alpha‐1 type 3 collagen 39 20 
    X04098 cytoskeletal gamma actin 72 63 
    X63432 ACTB mutant beta‐actin 81 29 
    X52851 cyclophilin gene 82 82 
    M63573 secreted cyclophilin‐like protein 89 98 
    AL031670 ferritin light, polypeptide 1 103 129 
    J03464 collagen alpha‐2 type 1 104 97 
    J04755 ferritin H processed pseudogene 106 21 
    AB021288 beta‐2‐microglobulin 120 79 
    V00599 mRNA fragment encoding beta‐tubulin 121 185 
    V00503 mRNA encoding pro‐alpha‐2 chain of type 1 collagen 126 92 
    K00558 alpha‐tubulin 132 169 
    U21128 Lumican 136 165 
    X95404 non‐muscle type cofilin 157 105 
    V00567 mRNA fragment for the beta‐2 microglobulin >200 53 
    S82297 beta‐2‐microglobulin >200 108 
    X05610 mRNA for type IV collagen alpha (2) chain >200 193 
Transcription factors   
    AF054187 NAC 86 99 
    X53281 BTF3b 148 166 
    X58965 nm23‐H2 gene 168 >200 
    AF054187 NAC 170 178 
    M55914 c‐myc binding protein (MBP‐1) 182 132 
    M94046 zinc finger protein (MAZ) 184 197 
    Z93930 clone 292E10 on chromosome 22q11–12 >200 162 
    X75861 TEGT gene >200 199 
Proteases   
    X04470 antileukoprotease (ALP) from cervix uterus 66 177 
    X57766 stromelysin‐3 133 >200 
    X98296 ubiquitin hydrolase >200 176 
Intracellular/signalling factors   
    X04803 Homo sapiens ubiquitin gene 78 117 
    U49869 human ubiquitin gene 93 127 
    AB009010 polyubiquitin UbC 94 43 
    AB002533 Qip1 97 112 
    U73824 p97 109 114 
    M26880 ubiquitin mRNA 112 48 
    M26880 ubiquitin mRNA 113 61 
    AI525652 PT1.3_01_C04.r1 143 150 
    D78361 ornithine decarboxylase antizyme 149 158 
    J03077 co‐beta glucosidase (proactivator) 161 >200 
    M92383 thymosin beta‐10 171 108 
    AI971724 wr07a04.x1 172 185 
    M22806 prolyl 4‐hydroxylase beta‐subunit and disulphide isomerase gene 173 171 
    Y00345 polyA binding protein 175 141 
    J04599 hPGI mRNA encoding small bone proteoglycan 1 176 >200 
    AF026692 frizzled related protein FrpHE 177 >200 
    X04409 coupling protein G(s) alpha‐subunit 179 151 
    Z48501 polyadenylate binding protein II 186 159 
    X70326 MacMarcks mRNA 189 >200 
    X56009 GSA mRNA for alpha subunit of GsGTP binding protein 193 143 
    J04173 phosphoglycerate mutase 195 187 
    Spermidine/spermine N1‐acetyltransferase Alt Splice 2 >200 54 
    M98539 prostaglandin D2 synthase >200 112 
    Y10387 PAPS synthetase >200 122 
    AF039656 neuronal tissue enriched acidic protein (NAP‐22) >200 135 
    AI207842 ao89h09.x1 >200 137 
    X04409 coupling protein G(s) alpha‐subunit >200 152 
    J03592 ADP/ATP translocase mRNA >200 183 
    U12472 glutathione S‐transferase >200 187 
Transporters   
    L48215 beta‐globin (HBB) gene 65 94 
    M94250 retinoic acid inducible factor (MK) 137 >200 
    D14696 lysosomal associated protein transmembrane 4‐alpha 147 162 
    J03592 ADP/ATP translocase 154 182 
    M25079 sickle cell beta globin 187 >200 
Growth factors   
    J03040 SPARC/osteonectin 128 82 
    X86693 hevin‐like protein 159 >200 
    X55110 neurite outgrowth‐promoting protein 181 >200 
Membrane proteins/immunological factors   
    M24194 MHC protein homologous to chicken B complex protein 45 31 
    D00017 lipocortin II 80 12 
    M62895 lipocotin (LIP) 2 pseudogene 83 17 
    V00567 mRNA fragment for the beta‐2 microglobulin 91 53 
    M33680 26 kDa surface protein TAPA‐1 102 38 
    X58536 HLA class 1 locus C heavy chain 111 42 
    M24194 MHC protein homologous to chicken B complex protein 117 154 
    Y12711 putative progesterone binding protein 135 >200 
    M14630 prothymosin alpha 138 138 
    S82297 beta‐2‐microglobulin 140 107 
    Heat shock protein, 70 kDa 142 101 
    L19686 macrophage migration inhibitory factor (MIF) 146 124 
    X15183 90 kDa heat shock protein 164 195 
    M16660 90 kDa heat shock protein gene 178 189 
    J04182 lysosomal membrane glycoprotein‐1 (LAMP1) 191 >200 
    Z23090 28 kDa heat shock protein 194 129 
    L33930 CD24 signal transducer 198 165 
    D32129 HLA class‐1 heavy chain >200 177 
    AL031295 DNA sequence from clone 886K2 on chromosome 1p35.1–36.12 (epimerase) >200 200 
DNA/RNA proteins   
    U28686 putative RNA binding protein RNPL 85 139 
    X77956 Id1 145 140 
    X78136 hnRNP‐E2 163 >200 
    D30655 mRNA for eukaryotic initiation factor 4AII 185 170 
Apoptotic/tumour proteins   
    AI535946 lectin 33 103 
    M55409 pancreatic tumour‐related protein 69 83 
    AF054183 GTP binding protein (RAN) 151 194 
    L09159 RHOA proto‐oncogene multidrug resistance protein 167 149 
    AL050268 DKFZp564B163 188 173 
    X56681 junD mRNA >200 170 
    X56681 junD mRNA >200 181 
Kinases   
    M19311 calmodulin 152 146 
    X15334 gene for creatinine kinase >200 173 
    V00572 mRNA encoding phosphoglycerate kinase >200 184 
Miscellaneous/unknowns   
    L41498 longation factor 1‐alpha (PTI‐1) 
    AI541542 lobtest16.A02.r 16 
    M17733 thymosin beta‐4 19 
    J04164 interferon‐inducible protein 9–27 32 52 
    AB011114 KIAA0542 99 142 
    U20982 insulin‐like growth factor binding protein 4 (IGFBP4) gene 122 160 
    X13794 lactate dehydrogenase B 129 167 
    M11353 H3.3 histone class C mRNA 134 125 
    L27560 insulin‐like growth factor 5 (IGFBP5) 150 >200 
    AI540925 cytochrome oxidase C 155 135 
    AI540958 PIN (inhibitor of NOS) 156 152 
    M62403 insulin‐like growth factor 4 (IGFBP4) mRNA 162 >200 
    AI540957 PEC1.2_15_G03.r 180 191 
    X13794 lactate dehydrogenase B gene exons 1 and 2 190 106 
    AI708889 cytochrome C oxidase 197 >200 
    L27560 insulin‐like growth factor 5 (IGFBP5) 199 >200 
    U30521 P311 HUM (3.1) mRNA 200 >200 
    L19182 MAC25 >200 148 
    AF095154 C1q‐related factor >200 157 
    S73591 brain expressed HHCPA78 homolog >200 182 
    U50523 BRCA2 region, mRNA sequence CG037 >200 189 

Transcripts are listed as a rank position, with position one being the most highly expressed transcript.

Transcripts that fall out of the top 200 genes in one phase of the cycle are listed as >200 in the appropriate column. Transcripts have been classified according to function.

Table II.

All the transcripts on the HG_U95A chip that lie outside of the 99% reference limit

Gene Affymetrix code No. of ERE No. of PRE Transcript level in proliferative phase Transcript level in secretory phase Fold change 
Transcription factors       
    D14520 GC‐Box binding protein BTEB2* 37926_at   62.7 932.3 11.5 
    M92843 Zn finger transcriptional regulator 40448_at 189.2 1308.1 7.4 
    U65093 msg‐1‐related gene 1 33113_at 132.6 789.7 7.2 
    X64318 E4BP4 gene 37544_at 96 805 7.1 
    X96584 NOV protein 39250_at   3.3 255.9 5.5 
    AI123426 qa49c09.x1 33861_at 426 2450.7 5.4 
    U00115 Zn finger protein (bcl6) 40091_at 97.2 541.6 4.8 
    X51345 JUN‐B protein 32786_at 348.8 1676.6 4.8 
    AF001461 Kruppel‐like Zn finger protein Zf9 37026_at 501.1 2124.6 4.7 
    D31716 GC Box binding protein 40202_at   335.8 1484 
    W28479 47d8 cDNA 37758_s_at   542.5 81.3 –3 
    U48213 D‐site binding protein gene 40274_at   1349.8 193.9 –4.6 
Kinases/proteases/peptidases       
    M18737 Hannukah factor serine protease  40757_at 160.8 1175 6.3 
    Y10032 putative ser/thr protein kinase 973_at   446.2 2185.5 4.9 
    Protein kinase Ht31, cAMP dependent 735_s_at   177.7 763.5 4.7 
    AF071219 mammaglobin B precursor 41066_at 1990.4 8259.9 4.1 
    M80482 PACE4 32001_s_at 205.3 939.2 4.1 
    U01337 Ser/Thr protein kinase (A‐RAF‐1)  1707_g_at   1550.5 333.3 1.1 
    U83411 carboxypeptidase Z precursor 37248_at   3042.1 758.5 –2.9 
    Y10275 L‐3‐phosphoserine phosphatase 36736_f_at   414.3 51.2 –4.9 
    X01683 alpha‐1 antitrypsin 36781_at   1132.5 220.3 –5.1 
    U56387 PC6A protease (hPC6) 41032_at 364.3 3.9 –6.7 
    AF015287 serine protease* 40078_at 1383.6 7.5 –8.6 
    J04970 carboxypeptidase M* 36708_at 1187.8 100.1 –12.5 
Growth factors       
    AB000584 TGF‐beta superfamily protein 1890_at 63.4 669.1 5.2 
    M94250 retinoic acid‐inducible factor (MK) 577_at 7074.8 1777.8 –3.6 
    M77349 TGFB‐induced gene product (BIGH3) 1385_at 1796.5 482.4 –3.8 
    X55110 neurite outgrowth‐promoting protein 38124_at 5256.8 1313.6 –4.1 
    M34641 FGF receptor 1 2057_g_at   306.6 9.7 –6.2 
Complement proteins       
    U24578 RP1 and complement C4B precursor 40766_at   193 1184.2 21.8 
    M31516 decay‐accelerating factor* 39695_at 16 215.3 1899.4 8.1 
    M31452 proline‐rich protein (PRP) 41109_at 153.4 758 7.3 
    X54486 C‐1 inhibitor* 39775_at   1391.3 11121.5 
    M84526 adipsin/complement factor D 40282_s_at   325 1233.2 3.8 
    M14058 complement C1r 39409_at   961.5 3557.5 3.7 
Metal ion regulators/protective factors       
    D00632 glutathione peroxidase 3* 770_at 1.5 5788 94.9 
    J03910 metallothionein 1G (MT‐1G)* 926_at   227.6 5499.9 25.3 
    J05068 transcobalamin 1 35919_at 69.2 494.5 7.2 
    H68340 clone similar to MT‐1f* 41446_f_at   1262.3 8576 7.1 
    R93527 clone similar to MT‐1h 39594_f_at   1503.9 7088.4 6.4 
    M13699 ceruplasmin (ferroxidase) 39008_at 183.9 1141.2 5.7 
    K01383 metallothionein‐1A 31623_f_at   958.6 4649.5 4.2 
    R92331 clone similar to MT‐1e* 36130_f_at   1369 8119.3 4.7 
    M93311 metallothionein III 870_f_at   1261.6 4427.5 3.3 
    U83461 putative copper uptake protein  34749_at   8.5 266.2 3.2 
    AF037335 carbonic anhydrase precursor CA12 36454_at   455.3 47.6 –8.2 
Cell death and cell survival factors       
    U67156 MAPKKK5  41688_at 131.4 669.1 8.8 
    AI688299 wc87h10.x1 1717_s_at 111.7 696.1 6.2 
    U45878 inhibitor of apoptosis protein 1 33442_at   101.7 670.1 5.8 
    AB002365 Nip2 36933_at   301.3 5.5 
    D87953 RTP 1327_s_at 474.4 1725.1 3..2 
    D28124 unknown product 37005_at 3245.5 900.5 –3.6 
    AF089814 growth suppressor rel (DOC1R) 35151_at 564.5 14.5 –4.5 
Tissue modelling/matrix/structural proteins       
    AF052124 clone 23810 osteopontin* 34342_s_at 340.9 7456.6 21.9 
    J04765 osteopontin* 2092_s_at 224.4 4736.1 20 
Tissue modelling/matrix/structural proteins (cont.)       
    AJ238246 sarcolectin* 41294_at 55.8 824.1 14.2 
    J05581 polymorphic epithelial mucin (MUC‐1) 38783_at 231.2 1263.9 5.5 
    L32137 germline oligomeric matrix protein  40161_at   27.6 295.7 5.4 
    U02556 RP3 36921_at   523.3 2271.6 4.3 
    AA058852 gamma‐tubulin migratory complex protein 40986_s_at 553.7 81.4 –2.8 
    AI985964 wr79d08.x1 (similar to TFF‐3) 37897_s_at   1802.5 406.7 –4.4 
    M92642 alpha‐1 type XVI collagen  35168_f_at 988 193.2 –5.1 
    X57766 stromelysin‐3* 38181_at 7292.9 846.4 –8.5 
    L22524 matrilysin 668_s_at 1804.8 120.1 –14.3 
    Y09788 MUC5B* 41365_at 1199.6 97.3 –15.6 
    DNA/RNA proteins       
    M10098 18S rRNA gene AFFXHUMRG/M10098_M_ 67.6 520.3 7.8 
    M34455 interferon‐gamma‐inducible indoleamine 2,3‐dioxygenase (IDO)* 36804_at   374.2 2871.4 6.9 
    M10098 18S rRNA gene AFFXHUMRGE/M10098at 132.7 1017.5 6.2 
    M83667 NF‐IL6‐beta protein 1052_s_at   423.9 2450 5.9 
    D49677 U2AF1‐RS2 38523_f_at 6.7 318.8 2.1 
    AF073362 endo/exonuclease Mre11 32870_g_at 306.5 1.2 ‐1.1 
Transporters/carrier proteins       
    J02611 apolipoprotein D* 36681_at 88.7 1297.8 27.7 
    U08989 glutamate transporter 38268_at   48.8 720.3 12.7 
    AF038662 chromosome 3q13 beta‐1,4‐galactosyltransferase 39432_at   44.1 378.2 6.8 
    AF054825 VAMP5 32533_s_at   92.3 562.7 6.1 
    X57522 RING4 40153_at   185.9 1098.2 5.9 
    V01512 cellular oncogene c‐fos 38064_at   263.9 1282.9 5.7 
    X79882 lrp 1915_s_at 162.6 901.2 5.5 
    AB012130 sodium bicarbonate cotransporter 2 34936_at   227 914.3 3.9 
    Spermine/spermidine N1‐acetyltransferase 1173_g_at   3942.1 13332.3 3.1 
    W28230 43h12 40884_g_at   0.7 103 –1.1 
    AF058718 putative 13S golgi transport complex 34737_at   246.9 10.7 –5.1 
    M97815 CRABP‐II exon  1057_at   1321.9 199.9 –6.6 
    M97815 retinoic acid‐binding protein II (CRABP‐II) 41783_at 787.2 69.8 –15.5 
    Signalling/intracellular factors       
    AB020315 Dickkopf‐1 (hddk‐1) gene* 35977_at   56 975.2 18.6 
    M68840 monoamine oxidase A* 41772_at 214.3 1857 8.7 
    AA420624 nc61c12.r (similar to MAOA)1 41771_g_at   457.3 2769.8 6.1 
    AF020038 NADP‐dependent isocitrate dehydrogenase (IDH) 39023_at   940 4504.4 5.3 
    D67029 SEC14L 36207_at 228.3 1654.2 4.8 
    D13643 24‐dehydrocholesterol reductase 36658_at   68 505.8 4.6 
    X14830 muscle acetylcholine receptor beta 35027_at   167.8 1305.7 2.9 
    L37882 frizzled gene product 628_at   281.7 16.4 –5.6 
    AB024704 fls353 38855_s_at 495.9 74.8 –6.6 
    AF056087 secreted frizzled related protein* 32521_at   4551.7 512.1 –9.6 
    D82345 NB thymosin beta 36491_at 819.2 81.9 –9.9 
    AF026692 frizzled related protein frpHE* 41405_at   5381.7 281.7 –17.7 
Immunological factors/membrane proteins       
    J04129 placental protein 14 (PP14)* 37633_s_at 339.5 10827.1 34.3 
    M85276 NKG5* 37145_at   211.9 4165.7 18.1 
    AI445461 transmembrane 4 superfamily member 1 41531_at 191.8 1162.6 
    N74607 aquaporin 3 39248_at   326.1 2123.2 6.5 
    X03066 HLA‐D class II antigen DO beta chain 38570_at   202.3 1151.5 5.7 
    M55543 guanylate binding protein isoform II 32700_at 12 17.9 268.1 5.4 
    M90657 tumour antigen (L6) 892_at   287.3 1252.8 4.1 
Immunological factors/membrane proteins (cont.)       
    AL034397 DNA sequence from clone 159A1 on chromosome Xq12–13.3 37976_at   220.1 964.8 2.4 
    AA524547 FXYD1 32109_at 416.3 51.2 –1.2 
    X58401 L2‐9 transcript of unrearranged immunoglobulin V(H)5 pseudogene 35014_at   187.6 1.8 –2.4 
    AL080181 DKFZp4340111 35829_at 1116.9 206.8 –5.4 
    AB017563 IGSF4 37929_at 11 585.7 63.5 –9.2 
Miscellaneous        
    AW015055 lipophilin B* 32880_at   277.4 7227.1 28.5 
    U07919 aldehyde dehydrogenase 6* 36686_at   171 2509.2 20.2 
    V00511 pregastrin* 34319_at 29.1 657.5 11.9 
    AA131149 S100 protein 41867_at   74.9 717.1 10.9 
    AF055009 clone 24747* 34823_at   146.6 1530.9 10.4 
    X60708 pcHDP7 36464_at   46.7 359.1 7.4 
    X94323 SGP28 38797_at 94 595.1 
    D31887 similar to LIV‐1 31844_at   669.7 4578 6.8 
    AF000573 homogentisate 1,2‐dioxygenase 38407_r_at 176 1114.2 6.4 
    AI207842 PGD2 synthase 35007_at   388.5 2326 
    AC004940 PAC clone DJ0978E18 from 7p214 40187_at   29.5 305.3 5.8 
    AW016815 similar to lipophilin B 40339_at   137.6 875.1 5.8 
    U95367 GABA‐A receptor pi subunit 39338_at 586.1 3247.8 5.5 
    AI201310 annexin II Ligand 1911_s_at   557.6 3262 5.4 
    M60974 GADD45 38482_at 242.5 1106.3 5.1 
    AJ011497 claudin‐7 36173_r_at 325.7 1322.6 4.3 
    AF002163 delta‐adaptin 1798_at 119.3 702.1 1.2 
    U41060 LIV‐1 33405_at   4221.3 1065.9 –3.4 
    N90755 adenylyl cyclase‐associated protein 2 39710_at 681.6 114.1 –3.7 
    U30521 P311 HUM (3.1) 1577_at   4726.8 1091.1 –4.3 
    M23263 human androgen receptor 36073_at 947.1 164.6 –4.7 
    U35139 NECDIN‐related protein 37749_at 701.4 131.3 –5.3 
    D78611 MEST 32818_at 713.3 129.4 –5.5 
    X78565 tenascin‐C* 717_at 2571 381.8 –5.9 
    D87119 mRNA for GS3955 36134_at 1554.8 235.5 –5.9 
    U79299 neuronal olfactomedin‐related ER localized protein 41607_at   1460.7 207.4 –6.4 
    U09550 oviductal glycoprotein 38291_at 534.4 92.4 –7.6 
    J00123 enkephalin* 34552_at 2071.3 145.6 –13.9 
Gene Affymetrix code No. of ERE No. of PRE Transcript level in proliferative phase Transcript level in secretory phase Fold change 
Transcription factors       
    D14520 GC‐Box binding protein BTEB2* 37926_at   62.7 932.3 11.5 
    M92843 Zn finger transcriptional regulator 40448_at 189.2 1308.1 7.4 
    U65093 msg‐1‐related gene 1 33113_at 132.6 789.7 7.2 
    X64318 E4BP4 gene 37544_at 96 805 7.1 
    X96584 NOV protein 39250_at   3.3 255.9 5.5 
    AI123426 qa49c09.x1 33861_at 426 2450.7 5.4 
    U00115 Zn finger protein (bcl6) 40091_at 97.2 541.6 4.8 
    X51345 JUN‐B protein 32786_at 348.8 1676.6 4.8 
    AF001461 Kruppel‐like Zn finger protein Zf9 37026_at 501.1 2124.6 4.7 
    D31716 GC Box binding protein 40202_at   335.8 1484 
    W28479 47d8 cDNA 37758_s_at   542.5 81.3 –3 
    U48213 D‐site binding protein gene 40274_at   1349.8 193.9 –4.6 
Kinases/proteases/peptidases       
    M18737 Hannukah factor serine protease  40757_at 160.8 1175 6.3 
    Y10032 putative ser/thr protein kinase 973_at   446.2 2185.5 4.9 
    Protein kinase Ht31, cAMP dependent 735_s_at   177.7 763.5 4.7 
    AF071219 mammaglobin B precursor 41066_at 1990.4 8259.9 4.1 
    M80482 PACE4 32001_s_at 205.3 939.2 4.1 
    U01337 Ser/Thr protein kinase (A‐RAF‐1)  1707_g_at   1550.5 333.3 1.1 
    U83411 carboxypeptidase Z precursor 37248_at   3042.1 758.5 –2.9 
    Y10275 L‐3‐phosphoserine phosphatase 36736_f_at   414.3 51.2 –4.9 
    X01683 alpha‐1 antitrypsin 36781_at   1132.5 220.3 –5.1 
    U56387 PC6A protease (hPC6) 41032_at 364.3 3.9 –6.7 
    AF015287 serine protease* 40078_at 1383.6 7.5 –8.6 
    J04970 carboxypeptidase M* 36708_at 1187.8 100.1 –12.5 
Growth factors       
    AB000584 TGF‐beta superfamily protein 1890_at 63.4 669.1 5.2 
    M94250 retinoic acid‐inducible factor (MK) 577_at 7074.8 1777.8 –3.6 
    M77349 TGFB‐induced gene product (BIGH3) 1385_at 1796.5 482.4 –3.8 
    X55110 neurite outgrowth‐promoting protein 38124_at 5256.8 1313.6 –4.1 
    M34641 FGF receptor 1 2057_g_at   306.6 9.7 –6.2 
Complement proteins       
    U24578 RP1 and complement C4B precursor 40766_at   193 1184.2 21.8 
    M31516 decay‐accelerating factor* 39695_at 16 215.3 1899.4 8.1 
    M31452 proline‐rich protein (PRP) 41109_at 153.4 758 7.3 
    X54486 C‐1 inhibitor* 39775_at   1391.3 11121.5 
    M84526 adipsin/complement factor D 40282_s_at   325 1233.2 3.8 
    M14058 complement C1r 39409_at   961.5 3557.5 3.7 
Metal ion regulators/protective factors       
    D00632 glutathione peroxidase 3* 770_at 1.5 5788 94.9 
    J03910 metallothionein 1G (MT‐1G)* 926_at   227.6 5499.9 25.3 
    J05068 transcobalamin 1 35919_at 69.2 494.5 7.2 
    H68340 clone similar to MT‐1f* 41446_f_at   1262.3 8576 7.1 
    R93527 clone similar to MT‐1h 39594_f_at   1503.9 7088.4 6.4 
    M13699 ceruplasmin (ferroxidase) 39008_at 183.9 1141.2 5.7 
    K01383 metallothionein‐1A 31623_f_at   958.6 4649.5 4.2 
    R92331 clone similar to MT‐1e* 36130_f_at   1369 8119.3 4.7 
    M93311 metallothionein III 870_f_at   1261.6 4427.5 3.3 
    U83461 putative copper uptake protein  34749_at   8.5 266.2 3.2 
    AF037335 carbonic anhydrase precursor CA12 36454_at   455.3 47.6 –8.2 
Cell death and cell survival factors       
    U67156 MAPKKK5  41688_at 131.4 669.1 8.8 
    AI688299 wc87h10.x1 1717_s_at 111.7 696.1 6.2 
    U45878 inhibitor of apoptosis protein 1 33442_at   101.7 670.1 5.8 
    AB002365 Nip2 36933_at   301.3 5.5 
    D87953 RTP 1327_s_at 474.4 1725.1 3..2 
    D28124 unknown product 37005_at 3245.5 900.5 –3.6 
    AF089814 growth suppressor rel (DOC1R) 35151_at 564.5 14.5 –4.5 
Tissue modelling/matrix/structural proteins       
    AF052124 clone 23810 osteopontin* 34342_s_at 340.9 7456.6 21.9 
    J04765 osteopontin* 2092_s_at 224.4 4736.1 20 
Tissue modelling/matrix/structural proteins (cont.)       
    AJ238246 sarcolectin* 41294_at 55.8 824.1 14.2 
    J05581 polymorphic epithelial mucin (MUC‐1) 38783_at 231.2 1263.9 5.5 
    L32137 germline oligomeric matrix protein  40161_at   27.6 295.7 5.4 
    U02556 RP3 36921_at   523.3 2271.6 4.3 
    AA058852 gamma‐tubulin migratory complex protein 40986_s_at 553.7 81.4 –2.8 
    AI985964 wr79d08.x1 (similar to TFF‐3) 37897_s_at   1802.5 406.7 –4.4 
    M92642 alpha‐1 type XVI collagen  35168_f_at 988 193.2 –5.1 
    X57766 stromelysin‐3* 38181_at 7292.9 846.4 –8.5 
    L22524 matrilysin 668_s_at 1804.8 120.1 –14.3 
    Y09788 MUC5B* 41365_at 1199.6 97.3 –15.6 
    DNA/RNA proteins       
    M10098 18S rRNA gene AFFXHUMRG/M10098_M_ 67.6 520.3 7.8 
    M34455 interferon‐gamma‐inducible indoleamine 2,3‐dioxygenase (IDO)* 36804_at   374.2 2871.4 6.9 
    M10098 18S rRNA gene AFFXHUMRGE/M10098at 132.7 1017.5 6.2 
    M83667 NF‐IL6‐beta protein 1052_s_at   423.9 2450 5.9 
    D49677 U2AF1‐RS2 38523_f_at 6.7 318.8 2.1 
    AF073362 endo/exonuclease Mre11 32870_g_at 306.5 1.2 ‐1.1 
Transporters/carrier proteins       
    J02611 apolipoprotein D* 36681_at 88.7 1297.8 27.7 
    U08989 glutamate transporter 38268_at   48.8 720.3 12.7 
    AF038662 chromosome 3q13 beta‐1,4‐galactosyltransferase 39432_at   44.1 378.2 6.8 
    AF054825 VAMP5 32533_s_at   92.3 562.7 6.1 
    X57522 RING4 40153_at   185.9 1098.2 5.9 
    V01512 cellular oncogene c‐fos 38064_at   263.9 1282.9 5.7 
    X79882 lrp 1915_s_at 162.6 901.2 5.5 
    AB012130 sodium bicarbonate cotransporter 2 34936_at   227 914.3 3.9 
    Spermine/spermidine N1‐acetyltransferase 1173_g_at   3942.1 13332.3 3.1 
    W28230 43h12 40884_g_at   0.7 103 –1.1 
    AF058718 putative 13S golgi transport complex 34737_at   246.9 10.7 –5.1 
    M97815 CRABP‐II exon  1057_at   1321.9 199.9 –6.6 
    M97815 retinoic acid‐binding protein II (CRABP‐II) 41783_at 787.2 69.8 –15.5 
    Signalling/intracellular factors       
    AB020315 Dickkopf‐1 (hddk‐1) gene* 35977_at   56 975.2 18.6 
    M68840 monoamine oxidase A* 41772_at 214.3 1857 8.7 
    AA420624 nc61c12.r (similar to MAOA)1 41771_g_at   457.3 2769.8 6.1 
    AF020038 NADP‐dependent isocitrate dehydrogenase (IDH) 39023_at   940 4504.4 5.3 
    D67029 SEC14L 36207_at 228.3 1654.2 4.8 
    D13643 24‐dehydrocholesterol reductase 36658_at   68 505.8 4.6 
    X14830 muscle acetylcholine receptor beta 35027_at   167.8 1305.7 2.9 
    L37882 frizzled gene product 628_at   281.7 16.4 –5.6 
    AB024704 fls353 38855_s_at 495.9 74.8 –6.6 
    AF056087 secreted frizzled related protein* 32521_at   4551.7 512.1 –9.6 
    D82345 NB thymosin beta 36491_at 819.2 81.9 –9.9 
    AF026692 frizzled related protein frpHE* 41405_at   5381.7 281.7 –17.7 
Immunological factors/membrane proteins       
    J04129 placental protein 14 (PP14)* 37633_s_at 339.5 10827.1 34.3 
    M85276 NKG5* 37145_at   211.9 4165.7 18.1 
    AI445461 transmembrane 4 superfamily member 1 41531_at 191.8 1162.6 
    N74607 aquaporin 3 39248_at   326.1 2123.2 6.5 
    X03066 HLA‐D class II antigen DO beta chain 38570_at   202.3 1151.5 5.7 
    M55543 guanylate binding protein isoform II 32700_at 12 17.9 268.1 5.4 
    M90657 tumour antigen (L6) 892_at   287.3 1252.8 4.1 
Immunological factors/membrane proteins (cont.)       
    AL034397 DNA sequence from clone 159A1 on chromosome Xq12–13.3 37976_at   220.1 964.8 2.4 
    AA524547 FXYD1 32109_at 416.3 51.2 –1.2 
    X58401 L2‐9 transcript of unrearranged immunoglobulin V(H)5 pseudogene 35014_at   187.6 1.8 –2.4 
    AL080181 DKFZp4340111 35829_at 1116.9 206.8 –5.4 
    AB017563 IGSF4 37929_at 11 585.7 63.5 –9.2 
Miscellaneous        
    AW015055 lipophilin B* 32880_at   277.4 7227.1 28.5 
    U07919 aldehyde dehydrogenase 6* 36686_at   171 2509.2 20.2 
    V00511 pregastrin* 34319_at 29.1 657.5 11.9 
    AA131149 S100 protein 41867_at   74.9 717.1 10.9 
    AF055009 clone 24747* 34823_at   146.6 1530.9 10.4 
    X60708 pcHDP7 36464_at   46.7 359.1 7.4 
    X94323 SGP28 38797_at 94 595.1 
    D31887 similar to LIV‐1 31844_at   669.7 4578 6.8 
    AF000573 homogentisate 1,2‐dioxygenase 38407_r_at 176 1114.2 6.4 
    AI207842 PGD2 synthase 35007_at   388.5 2326 
    AC004940 PAC clone DJ0978E18 from 7p214 40187_at   29.5 305.3 5.8 
    AW016815 similar to lipophilin B 40339_at   137.6 875.1 5.8 
    U95367 GABA‐A receptor pi subunit 39338_at 586.1 3247.8 5.5 
    AI201310 annexin II Ligand 1911_s_at   557.6 3262 5.4 
    M60974 GADD45 38482_at 242.5 1106.3 5.1 
    AJ011497 claudin‐7 36173_r_at 325.7 1322.6 4.3 
    AF002163 delta‐adaptin 1798_at 119.3 702.1 1.2 
    U41060 LIV‐1 33405_at   4221.3 1065.9 –3.4 
    N90755 adenylyl cyclase‐associated protein 2 39710_at 681.6 114.1 –3.7 
    U30521 P311 HUM (3.1) 1577_at   4726.8 1091.1 –4.3 
    M23263 human androgen receptor 36073_at 947.1 164.6 –4.7 
    U35139 NECDIN‐related protein 37749_at 701.4 131.3 –5.3 
    D78611 MEST 32818_at 713.3 129.4 –5.5 
    X78565 tenascin‐C* 717_at 2571 381.8 –5.9 
    D87119 mRNA for GS3955 36134_at 1554.8 235.5 –5.9 
    U79299 neuronal olfactomedin‐related ER localized protein 41607_at   1460.7 207.4 –6.4 
    U09550 oviductal glycoprotein 38291_at 534.4 92.4 –7.6 
    J00123 enkephalin* 34552_at 2071.3 145.6 –13.9 

For each transcript, the average difference value for the proliferative and secretory phases and the fold change between the two are listed, as calculated by the Affymetrix Software (version 4.0). Transcripts marked with an asterix represent those that also fall outside of the 99.99% reference limit. Transcripts have been classified according to function. For some transcripts, the number of candidate ERE and PRE in the 5′ promoter regions were determined using Match™. All transcripts were investigated for this; however, only transcripts where the definitive promoter region was identified are listed.

Table III.

Transcripts of high fold change (>6‐fold change) which were excluded from the statistical analyses

Gene Affymetrix code No. of candidate ERE No. of candidate PRE Transcript level in proliferative phase Transcript level in secretory phase Fold change 
Transcription factors       
    M68891 GATA‐binding protein 203_at   320.9 –154.1 –9.3 
    X58840 variant hepatic nuclear factor 1 (vHNF‐1) 38506_at –17.4 368.4 7.7 
Kinases/proteases/peptidases       
    AF015287 serine protease 40078_at 1383.6 7.5 –8.6 
    W28330 45d4 32765_f_at   291.1 –57.8 –7.1 
    X79389 GSTT1 35538_at   246.4 196.4 –7.1 
    AI796048 wh41g06.x1 carboxypeptidase 32764_at   256.7 –90.3 –7 
    AB012917 serine protease (TLSP) 40035_at   71.4 –235.1 –6.3 
    U37519 aldehyde dehydrogenase 37956_at   –58.4 283.6 
    AF005418 retinoic acid hydroxylase 34982_at   –11.3 800.4 15.6 
Transporters/carrier proteins       
    AF038662 beta 1,4‐galactosyltransferase 39432_at   44.1 378.2 6.8 
    U08021 nicotinamide N‐methyltransferase 37032_at –316.3 –157.2 7.6 
    U81800 monocarboxylate transproter 33143_s_at   –62.6 651.1 13.4 
    AI928365 EACC1 38267_at   –31.1 1559.7 26 
    U73379 cyclin‐selective ubiquitin carrier 1651_at   543.9 –258.4 –15 
    AB002305 KIAA0307 35352_at   309.3 –9 –6.5 
    AF015926 ezrin‐radixin‐moesin binding phosphoprotein‐50 32174_at   523.4 –167.1 –6.3 
    L37792 syntaxin 1A 37184_at   –340.7 131.1 9.2 
Immunological factors/membrane proteins       
    L36033 pre‐B cell stimulating factor homologue 33834_at 538.5 –58.4 –11.4 
    D28137 BST‐2 39061_at 270.8 43.1 –10 
    AB017563 IGSF4 gene 37929_at 585.7 63.5 –9.2 
    U49184 occludin 38524_at 221.3 –234.8 –8.9 
    U16954 AF1q 36941_at 346.6 –39.8 –7.5 
    J05096 Na, K‐ATPase subunit alpha 2 34377_at 203.7 –84.4 –6 
    J02973 thrombomodulin gene 33803_at 58.7 368.5 6.3 
    L40802 17β‐HSD 38178_at   –2 746.3 11.8 
    AB022718 DEPP 39114_at   –32 697.1 13.4 
    AB000712 CPE receptor 35276_at   –467.8 1332.8 43.2 
    M61886 PAEP 37634_at   ‐89.3 2443.7 50.1 
Signalling/intracellular factors       
    M63582 preprothyrotropin releasing hormone gene 32323_at   870.5 –24.3 –16.6 
    L38517 indian hedgehog protein 899_at   263 –220 –9.4 
    AF037335 carbonic anhydrase precursor 36454_at   455.3 47.6 –8.2 
    X06409 mRNA fragment for activated c‐raf‐1 38743_f_at   150.8 58.9 –6.9 
Miscellaneous       
    L08044 intestinal trefoil factor 31477_at 2792.7 –123.3 –52.8 
    M34057 TGF‐beta 1495_at 1039.7 –23.4 –14.3 
    D55716 mRNA for P1cdc47 947_at 116.4 –414.1 –14.1 
    D82345 NB thymosin beta 36491_at   819.2 81.9 –9.9 
    D78014 dihydropyrimidinase 36149_at   356.8 –75.2 –7.5 
    AF001691 195 kDa cornified envelope precursor 36890_at   63.6 328.4 7.4 
    M69199 G0S2 protein 38326_at   –77.5 384.2 9.6 
Unkowns/EST       
    AL050214 DKFZp586H2123 40017_at   1564.1 –212.7 –36.7 
    AB020647 KIAA0840 37205_at   337.7 –4.1 –7 
    D50920 KIAA0130 34289_f_at   400.3 59.3 –6.7 
    AF054984 hs clone 23709 40677_at   47.9 –786.5 –6.2 
    AA149644 zl39d08.s1 32526_at   –57.2 –322.9 –6.2 
    AL050404 DNA sequence from clone 955M13 37498_at   –12.1 312.3 6.6 
Gene Affymetrix code No. of candidate ERE No. of candidate PRE Transcript level in proliferative phase Transcript level in secretory phase Fold change 
Transcription factors       
    M68891 GATA‐binding protein 203_at   320.9 –154.1 –9.3 
    X58840 variant hepatic nuclear factor 1 (vHNF‐1) 38506_at –17.4 368.4 7.7 
Kinases/proteases/peptidases       
    AF015287 serine protease 40078_at 1383.6 7.5 –8.6 
    W28330 45d4 32765_f_at   291.1 –57.8 –7.1 
    X79389 GSTT1 35538_at   246.4 196.4 –7.1 
    AI796048 wh41g06.x1 carboxypeptidase 32764_at   256.7 –90.3 –7 
    AB012917 serine protease (TLSP) 40035_at   71.4 –235.1 –6.3 
    U37519 aldehyde dehydrogenase 37956_at   –58.4 283.6 
    AF005418 retinoic acid hydroxylase 34982_at   –11.3 800.4 15.6 
Transporters/carrier proteins       
    AF038662 beta 1,4‐galactosyltransferase 39432_at   44.1 378.2 6.8 
    U08021 nicotinamide N‐methyltransferase 37032_at –316.3 –157.2 7.6 
    U81800 monocarboxylate transproter 33143_s_at   –62.6 651.1 13.4 
    AI928365 EACC1 38267_at   –31.1 1559.7 26 
    U73379 cyclin‐selective ubiquitin carrier 1651_at   543.9 –258.4 –15 
    AB002305 KIAA0307 35352_at   309.3 –9 –6.5 
    AF015926 ezrin‐radixin‐moesin binding phosphoprotein‐50 32174_at   523.4 –167.1 –6.3 
    L37792 syntaxin 1A 37184_at   –340.7 131.1 9.2 
Immunological factors/membrane proteins       
    L36033 pre‐B cell stimulating factor homologue 33834_at 538.5 –58.4 –11.4 
    D28137 BST‐2 39061_at 270.8 43.1 –10 
    AB017563 IGSF4 gene 37929_at 585.7 63.5 –9.2 
    U49184 occludin 38524_at 221.3 –234.8 –8.9 
    U16954 AF1q 36941_at 346.6 –39.8 –7.5 
    J05096 Na, K‐ATPase subunit alpha 2 34377_at 203.7 –84.4 –6 
    J02973 thrombomodulin gene 33803_at 58.7 368.5 6.3 
    L40802 17β‐HSD 38178_at   –2 746.3 11.8 
    AB022718 DEPP 39114_at   –32 697.1 13.4 
    AB000712 CPE receptor 35276_at   –467.8 1332.8 43.2 
    M61886 PAEP 37634_at   ‐89.3 2443.7 50.1 
Signalling/intracellular factors       
    M63582 preprothyrotropin releasing hormone gene 32323_at   870.5 –24.3 –16.6 
    L38517 indian hedgehog protein 899_at   263 –220 –9.4 
    AF037335 carbonic anhydrase precursor 36454_at   455.3 47.6 –8.2 
    X06409 mRNA fragment for activated c‐raf‐1 38743_f_at   150.8 58.9 –6.9 
Miscellaneous       
    L08044 intestinal trefoil factor 31477_at 2792.7 –123.3 –52.8 
    M34057 TGF‐beta 1495_at 1039.7 –23.4 –14.3 
    D55716 mRNA for P1cdc47 947_at 116.4 –414.1 –14.1 
    D82345 NB thymosin beta 36491_at   819.2 81.9 –9.9 
    D78014 dihydropyrimidinase 36149_at   356.8 –75.2 –7.5 
    AF001691 195 kDa cornified envelope precursor 36890_at   63.6 328.4 7.4 
    M69199 G0S2 protein 38326_at   –77.5 384.2 9.6 
Unkowns/EST       
    AL050214 DKFZp586H2123 40017_at   1564.1 –212.7 –36.7 
    AB020647 KIAA0840 37205_at   337.7 –4.1 –7 
    D50920 KIAA0130 34289_f_at   400.3 59.3 –6.7 
    AF054984 hs clone 23709 40677_at   47.9 –786.5 –6.2 
    AA149644 zl39d08.s1 32526_at   –57.2 –322.9 –6.2 
    AL050404 DNA sequence from clone 955M13 37498_at   –12.1 312.3 6.6 

For each transcript, the average difference value for the proliferative and secretory phases and the fold change between the two are listed, as calculated by the Affymetrix Software (version 4.0). Transcripts have been classified according to function. Transcripts have also been probed for candidate ERE and PRE and the results are listed here.

Table IV.

Agreement between the published literature and the results observed in our study, for the transcripts lying outside of the 99.99% reference limits

Gene Literature Reference Our findings Agree? 
BTEB2 Associated with vascular smooth muscle cell proliferation. Increased expression in secretory phase endometrium Walsh and Takahashi(2001) Increased in secretory phase 
PP14 Greater expression in secretory phase. Produced by glandular epithelial cells of secretory endometrium Klentzeris et al. (1994), Brown et al. (2000), Mylonas et al. (2000) High abundance in secretory phase.  
Decay accelerating factor (i) Progesterone increases expression (i) Kaul et al. (1995) Increased in secretory phase 
 (ii) Present throughout the female reproductive tract (ii) Jensen et al. (1995)   
C‐1 Inhibitor (i) Tissue factor expression requires progesterone receptor mediation (i) Schatz et al. (2000) Increased in secretory phase 
 (ii) May have a role in implantation (ii) Lockwood et al. (1999)   
Metallothioneins Increased expression in secretory phase endometrium Jin et al. (2000), Ioachim et al. (2000) Increased in secretory phase 
Osteopontin Regulated by progesterone Johnson et al. (1999, 2000) Increased in secretory phase 
Apolipoprotein D (i) Can bind progesterone (i) Rassart et al. (2000), Vogt et al. (2001) Increased in secretory phase 
 (ii) Expression decreased by estrogen (ii) Simard et al. (1992)   
Monoamine oxidase A Increased expression in female genital tract in response to progesterone Mazumer et al. (1980) Increased in secretory phase 
Dickkopf‐1 Increased expression in secretory phase endometrium Kao et al. (2002) Increased in secretory phase 
NKG5 Stimulates mitogenicity of endothelial cells in angiogenesis in vitro Langer et al. (1999) Increased in secretory phase 
Enkephalin (i) Proenkephalin found in primate endometrium. (i) Rosen et al. (1990) Increased in proliferative phase 
 (ii) Proenkephalin in proliferative but not secretory phase (ii) Low et al. (1989)   
Soluble frizzled related protein 4 In stroma of proliferative endometrium but not secretory or menstrual Abu‐Jawdeh et al. (1999) Increased in proliferative phase 
MUC5B Inversely regulated by progesterone Gipson et al. (2001) Increased in proliferative phase 
Stromelysin‐3 MMP expressed at end of secretory phase and during estrogen‐mediated growth Rogers et al. (1993), Osteen et al. (1999) Increased in proliferative phase 
Secreted frizzled related protein Increased expression in proliferative phase endometrium Kao et al. (2002) Increased in proliferative phase 
Serine protease No literature published  Increased in secretory phase – 
Glutathione peroxidase 3 No literature published  Increased in secretory phase – 
Sarcolectin No literature published  Increased in secretory phase – 
Interferon‐gamma‐inducible indoleamine 2,3‐dioxygenase No literature published  Increased in secretory phase – 
Lipophilin B Found in endocrine response organs Zhao et al. (1999) Increased in secretory phase – 
Pregastrin No literature published  Increased in secretory phase – 
Clone 24747 No literature published  Increased in secretory phase – 
Aldehyde dehydrogenase 6 No literature published  Increased in secretory phase – 
Tenascin‐C Increased expression in proliferative phase endometrium (i) Yamanaka et al. (1996) Increased in secretory phase 
  (ii) Kao et al. (2002)   
Carboxypeptidase M (i) Strong expression at ovulation in granulosa cells (i) Yoshioka (1998) Increased in proliferative phase 
 (ii) Regulates differentiation of endothelial cells (ii) Fujiwara (1999)   
Gene Literature Reference Our findings Agree? 
BTEB2 Associated with vascular smooth muscle cell proliferation. Increased expression in secretory phase endometrium Walsh and Takahashi(2001) Increased in secretory phase 
PP14 Greater expression in secretory phase. Produced by glandular epithelial cells of secretory endometrium Klentzeris et al. (1994), Brown et al. (2000), Mylonas et al. (2000) High abundance in secretory phase.  
Decay accelerating factor (i) Progesterone increases expression (i) Kaul et al. (1995) Increased in secretory phase 
 (ii) Present throughout the female reproductive tract (ii) Jensen et al. (1995)   
C‐1 Inhibitor (i) Tissue factor expression requires progesterone receptor mediation (i) Schatz et al. (2000) Increased in secretory phase 
 (ii) May have a role in implantation (ii) Lockwood et al. (1999)   
Metallothioneins Increased expression in secretory phase endometrium Jin et al. (2000), Ioachim et al. (2000) Increased in secretory phase 
Osteopontin Regulated by progesterone Johnson et al. (1999, 2000) Increased in secretory phase 
Apolipoprotein D (i) Can bind progesterone (i) Rassart et al. (2000), Vogt et al. (2001) Increased in secretory phase 
 (ii) Expression decreased by estrogen (ii) Simard et al. (1992)   
Monoamine oxidase A Increased expression in female genital tract in response to progesterone Mazumer et al. (1980) Increased in secretory phase 
Dickkopf‐1 Increased expression in secretory phase endometrium Kao et al. (2002) Increased in secretory phase 
NKG5 Stimulates mitogenicity of endothelial cells in angiogenesis in vitro Langer et al. (1999) Increased in secretory phase 
Enkephalin (i) Proenkephalin found in primate endometrium. (i) Rosen et al. (1990) Increased in proliferative phase 
 (ii) Proenkephalin in proliferative but not secretory phase (ii) Low et al. (1989)   
Soluble frizzled related protein 4 In stroma of proliferative endometrium but not secretory or menstrual Abu‐Jawdeh et al. (1999) Increased in proliferative phase 
MUC5B Inversely regulated by progesterone Gipson et al. (2001) Increased in proliferative phase 
Stromelysin‐3 MMP expressed at end of secretory phase and during estrogen‐mediated growth Rogers et al. (1993), Osteen et al. (1999) Increased in proliferative phase 
Secreted frizzled related protein Increased expression in proliferative phase endometrium Kao et al. (2002) Increased in proliferative phase 
Serine protease No literature published  Increased in secretory phase – 
Glutathione peroxidase 3 No literature published  Increased in secretory phase – 
Sarcolectin No literature published  Increased in secretory phase – 
Interferon‐gamma‐inducible indoleamine 2,3‐dioxygenase No literature published  Increased in secretory phase – 
Lipophilin B Found in endocrine response organs Zhao et al. (1999) Increased in secretory phase – 
Pregastrin No literature published  Increased in secretory phase – 
Clone 24747 No literature published  Increased in secretory phase – 
Aldehyde dehydrogenase 6 No literature published  Increased in secretory phase – 
Tenascin‐C Increased expression in proliferative phase endometrium (i) Yamanaka et al. (1996) Increased in secretory phase 
  (ii) Kao et al. (2002)   
Carboxypeptidase M (i) Strong expression at ovulation in granulosa cells (i) Yoshioka (1998) Increased in proliferative phase 
 (ii) Regulates differentiation of endothelial cells (ii) Fujiwara (1999)   

A summary of previously published findings is given with a direct comparison with the findings we have found. A = agreement between published literature and our findings; D = disagreement; – = no relevant data have previously been published; MMP = matrix metalloproteins.

References

Abu‐Jawdeh, G., Comella, N., Tomita, Y., Brown, L.F., Tognazzi, K., Sokol, S.Y. and Kocher, O. (
1999
) Differential expression of frpHE: a novel human stromal protein of the secreted frizzled gene family, during the endometrial cycle and malignancy.
Lab. Invest.
 ,
79
,
439
–447.
Altman, D.G and Bland, J.M. (
1983
) Measurement in medicine: the analysis of methos comparison studies.
Statistician
 ,
32
,
307
–317.
Arthur, J.R. (
2000
) The glutathione peroxidases.
Cell. Mol. Life Sci.
 ,
57
,
1825
–1835.
Beltran‐Garcia, M.J., Espinosa, A., Herrera, N., Perez‐Zapata, A.J., Beltran‐Garcia, C. and Ogura, T. (
2000
) Formation of copper oxychloride and reactive oxygen species as causes of uterine injury during copper oxidation of Cu‐IUD.
Contraception
 ,
2
,
99
–103.
Bland, J.M. and Altman, D.G. (
1986
) Statistical methods for assessing agreement between two methods of clinical measurement.
Lancet
 , I,
307
–310.
Bland, J.M. and Altman, D.G. (
1999
) Measuring agreement in method comparison studies.
Statist. Meth. Med. Res.
 ,
8
,
135
–160.
Brown, S.E., Mandelin, E., Oehninger, S., Toner, J.P., Seppala, M. and Jones, H.E. Jr (
2000
) Endometrial glycodelin‐A expression in the luteal phase of stimulated ovarian cycles.
Fertil. Steril.
 ,
74
,
130
–133.
Buttke, T.M. and Sandstrom, P.A. (
1994
) Oxidative stress as a mediator of apoptosis.
Immunol. Today
 ,
1
,
7
–10.
Cooke, P.S., Buchanan, D.L., Young, P., Setiawan, T., Brody, J., Korach, K.S., Taylor, J., Lubahn, D.B. and Cuhna, G.R. (
1997
) Stromal estrogen receptors mediate mitogenic effects of estradiol on uterine epithelium.
Proc. Natl Acad. Sci. USA
 ,
94
,
6535
–6540.
Dignass, A., Lynch‐Devaney, K., Kindon, H., Thim, L. and Podolsky, D.K. (
1994
) Trefoil peptides promote epithelial migration through a transforming growth factor independent pathway.
J. Clin. Invest.
 ,
94
,
376
–383.
Flohé, L., Günzler, W.A. and Schock, H.H. (
1973
) Glutathione peroxidase: a selenoenzyme.
FEBS Lett.
 
32
,
132
–134.
Fujiwara, H., Imai, K., Inoue, T., Maeda, M. and Fujii, S. (
1999
) Membrane‐bound cell surface peptidases in reproductive organs.
Endocr. J.
 ,
46
,
11
–25.
Gipson, I.K., Moccia, R., Spurr‐Michaud, S., Argueso, P., Gargiulo, A.R., Hill, J.A. 3rd, Offner, G.D. and Keutmann, H.T. (
2001
) The Amount of MUC5B mucin in cervical mucus peaks at midcycle.
Clin. Endocrinol. Metab.
 ,
86
,
594
–600.
Hauser, F., Poulsom, R., Chinery, R. et al. (
1993
) Protein hP1.B, a human P‐domain peptide homologous with rat intestinal trefoil factor, is expressed also in the ulcer‐associated cell lineage and the uterus.
Proc. Natl Acad. Sci. USA
 ,
90
,
6961
–6965.
Hubel, C.A. (
1999
) Oxidative stress in the pathogenesis of preeclampsia.
Proc. Soc. Exp. Biol. Med.
 ,
3
,
222
–235.
Ioachim, E.E., Kitsiou, E., Carassavoglou, C., Stefanaki, S. and Agnantis, N.J. (
2000
) Immunohistochemical localization of metallothionein in endometrial lesions.
J. Pathol.
 ,
191
,
269
–273.
Ishikawa, M., Nakata, T., Yaginuma, Y., Nishiwaki, K., Goishi, K. and Saitoh, S. (
1993
) Expression of superoxide dismutase (SOD) in adenomyosis.
Am. J. Obstet. Gynecol.
 ,
3
,
730
–734.
Jensen, T.S., Bjorge, L., Wollen, A.L. and Ulstein, M. (
1995
) Identification of the complement regulatory proteins CD46, CD55, and CD59 in human fallopian tube, endometrium, and cervical mucosa and secretion.
Am. J. Reprod. Immunol.
 ,
34
,
1
–9.
Jin, R., Bay, B.H., Chow, V.T., Tan, P.H. and Lin, V.C. (
2000
) Metallothionein 1E mRNA is highly expressed in oestrogen receptor‐negative human invasive ductal breast cancer.
Br. J. Cancer.
 ,
83
,
319
–323.
Johnson, G.A., Burghardt, R.C., Spencer, T.E., Newton, G.R., Ott, T.L. and Bazer, F.W. (
1999
) Ovine osteopontin: II. Osteopontin and alpha(v)beta(3) integrin expression in the uterus and conceptus during the periimplantation period.
Biol. Reprod.
 ,
61
,
892
–899.
Johnson, G.A., Spencer, T.E., Burghardt, R.C., Taylor, K.M., Gray, C.A. and Bazer, F.W. (
2000
) Progesterone modulation of osteopontin gene expression in the ovine uterus.
Biol. Reprod.
 ,
62
,
1315
–1321.
Kagi, J.H. (
1991
) Overview of metallothionein.
Methods Enzymol.
 ,
205
,
613
–626.
Kao, L.C., Tulac, S., Lobo, S., Imani, B., Yanj, J.P., Germeyer, A., Osteen, K., Taylor, R.N., Lessey, B.A. and Giudice, L.C. (
2002
) Global gene profiling in human endometrium during the window of implantation.
Endocrinology
 ,
143
,
2119
–2138.
Kaul, A., Nagamani, M. and Nowicki, B. (
1995
) Decreased expression of endometrial decay accelerating factor (DAF), a complement regulatory protein, in patients with luteal phase defect.
Am. J. Reprod. Immunol.
 ,
34
,
236
–240.
Kingsley, P.D., Whitin, J.C., Cohen, H.J. and Pails, J. (
1998
) Developmental expression of extracellular glutathione peroxidase suggests antioxidant roles in deciduum, visceral yolk sac and skin.
Mol. Reprod. Dev.
 ,
44
,
343
–355.
Klentzeris, L.D., Bulmer, J.N., Seppala, M., Li, T.C., Warren, M.A. and Cooke, I.D. (
1994
) Placental protein 14 in cycles with normal and retarded endometrial differentiation.
Hum. Reprod.
 ,
9
,
394
–398.
Langer, N., Beach, D. and Lindenbaum, E.S. (
1999
) Novel hyperactive mitogen to endothelial cells: human decidual NKG5.
Am. J. Reprod. Immunol.
 ,
42
,
263
–272.
Lockwood, C.J., Krikun, G. and Schatz, F. (
1999
) The decidua regulates hemostasis in human endometrium.
Semin. Reprod. Endocrinol.
 ,
17
,
45
–51.
Low, K.G., Nielsen, C.P., West, N.B., Douglass, J., Brenner, R.M., Maslar, I.A. and Melner, M.H. (
1989
) Proenkephalin gene expression in the primate uterus: regulation by estradiol in the endometrium.
Mol. Endocrinol.
 ,
3
,
852
–857.
Mashimo, H., Wu, D.C., Podolsky, D.K. and Fishman, M.C. (
1996
) Impaired defense of intestinal mucosa in mice lacking intestinal trefoil factor.
Science
 ,
5285
,
262
–265.
Mazumder, R.C., Glover, V. and Sandler, M. (
1980
) Progesterone provokes a selective rise of monoamine oxidase A in the female genital tract.
Biochem. Pharmacol.
 ,
29
,
1857
–1859.
Mylonas, I., Speer, R., Makovitzky, J., Richter, D.U., Briese, V. and Jeschke, U. (
2000
) Immunohistochemical analysis of steroid receptors and glycodelin A (PP14) in isolated glandular epithelial cells of normal human endometrium.
Histochem. Cell Biol.
 ,
114
,
405
–411.
O’Malley, B.W. and Tsai, M.J. (
1992
) Molecular pathways of steroid receptor action.
Biol. Reprod.
 ,
2
,
163
–167.
Orsi, N.M. and Leese, H.J. (
2001
) Protection against reactive oxygen species during mouse preimplantation embryo development: role of EDTA, oxygen tension, catalase, superoxide dismutase and pyruvate.
Mol. Reprod. Dev.
 ,
59
,
44
–53.
Osteen, K.G., Keller, N.R., Feltus, F.A. and Melner, M.H. (
1999
) Paracrine regulation of matrix metalloproteinase expression in the normal human endometrium.
Gynecol. Obstet. Invest.
 ,
48
,
2
–13.
Ota, H., Igarashi, S., Kato, N. and Tanaka, T. (
2000
) Aberrant expression of glutathione peroxidase in eutopic and ectopic endometrium in endometriosis and adenomyosis.
Fertil. Steril.
 ,
74
,
313
–318.
Podolsky, D.K. (
1997
) Healing the epithelium: solving the problem from two sides.
J. Gastoenterol.
 ,
32
,
122
–126.
Poulsom, R. (
1996
) Trefoil peptides.
Baillières Clin. Gastroenterol.
 ,
1
,
113
–134.
Poulsom, R. and Wright, N.A. (
1993
) Trefoil Peptides: A newly recognized form of epithelial mucin‐associated molecules.
Am. J. Phys.
 ,
2
,
G205
–213.
Rassart, E., Bedirian, A., Do Carmo, S., Guinard, O., Sirois, J., Terrisse, L. and Milne, R. (
2000
) Apolipoprotein D.
Biochim. Biophys. Acta
 ,
1482
,
185
–198.
Rogers, P.A., Au, C.L. and Affandi, B. (
1993
) Endometrial microvascular density during the normal menstrual cycle and following exposure to long‐term levonorgestrel.
Hum. Reprod.
 ,
8
,
1396
–1404.
Rosen, H., Itin, A., Schiff, R. and Keshet, E. (
1990
) Local regulation within the female reproductive system and upon embryonic implantation: identification of cells expressing proenkephalin A.
Mol. Endocrinol.
 ,
4
,
146
–154.
Rotruck, J.T., Pope, A.L., Ganther, H.E., Swanson, A.B., Hafeman, D.G. and Hoekstra, W.G. (
1973
) Selenium: biochemical role as a component of glutathione peroxidase.
Science
 ,
179
,
588
–590.
Schatz, F., Soderland, C., Hendricks‐Munoz, K.D., Gerrets, R.P. and Lockwood, C.J. (
2000
) Human endometrial endothelial cells: isolation, characterization, and inflammatory‐mediated expression of tissue factor and type 1 plasminogen activator inhibitor.
Biol. Reprod.
 ,
62
,
691
–697.
Sies, H. (
1993
) Strategies of antioxidant defense.
Eur. J. Biochem.
 ,
215
,
213
–219.
Silverman, B.W. (
1986
) Density Estimation for Statistics and Data Analysis. Chapman and Hall, London.
Simard, J., de Launoit, Y., Haagensen, D.E. and Labrie, F. (
1992
) Additive stimulatory action of glucocorticoids and androgens on basal and estrogen‐repressed apolipoprotein‐D messenger ribonucleic acid levels and secretion in human breast cancer cells.
Endocrinology
 ,
130
,
1115
–1121.
Thim, L. (
1997
) Trefoil Peptides: from structure to function.
Cell Mol. Life Sci.
 ,
53
,
888
–903.
Ursini, F., Maiorino, M., Brigelius‐Flohé, R., Aumann, K.D., Roveri, A., Schomburg, D. and Flohe, L. (
1995
) Diversity of glutathione peroxidases.
Methods Enzymol.
 ,
252
,
38
–53.
Vogt, M. and Skerra, A. (
2001
) Bacterially produced apolipoprotein D binds progesterone and arachidonic acid, but not bilirubin or E‐3M2H.
J. .Mol. Recognit.
 ,
14
,
79
–86.
Walsh, K. and Takahashi, A. (
2001
) Transcriptional regulation of vascular smooth muscle cell phenotype.
Z. Kardiol.
 ,
90
,
12
–16.
Wiede, A., Hinz, M., Canzler, E. et al. (
2001
) Synthesis and localization of the mucin‐associated TFF‐peptides in the human uterus.
Cell Tissue Res.
 ,
303
,
109
–115.
Williams, G.R. and Wright, N.A. (
1997
) Trefoil factor family domain peptides.
Virchows Arch.
 ,
431
,
299
–304.
Yamanaka, M., Taga, M. and Minaguchi, H. (
1996
) Immunohistological localisation of tenascin in the human endometrium.
Gynecol. Obstet. Invest.
 ,
41
,
247
–252.
Yoshioka, S., Fujiwara, H., Yamada, S., Nakayama, T., Higuchi, T., Inoue, T., Mori, T. and Maeda, M. (
1998
) Membrane‐bound carboxypeptidase‐M is expressed on human ovarian follicles and corpora lutea of menstrual cycle and early pregnancy.
Mol. Hum. Reprod.
 ,
4
,
709
–717.
Zhao, C., Nguyen, T., Yusifov, T., Glasgow, B.J. and Lehrer, R.I. (
1999
) Lipophilins: human peptides homologous to rat prostatein.
Biochem. Biophys. Res. Commun.
 ,
256
,
147
–155.