Abstract

We characterized the expression profiles of LjHb1 and LjHb2, non-symbiotic hemoglobin (non-sym-Hb) genes of Lotus japonicus. Although LjHb1 and LjHb2 showed 77% homology in their cDNA sequences, LjHb2 is located in a unique position in the phylogenetic tree of plant Hbs. The 5′-upstream regions of both genes contain the motif AAAGGG at a position similar to that in promoters of other non-sym-Hb genes. Expression profiles obtained by using quantitative RT–PCR showed that LjHb1 and LjHb2 were expressed in all tissues of mature plants, and expression was enhanced in mature root nodules. LjHb1 was strongly induced under both hypoxic and cold conditions, and by the application of nitric oxide (NO) donor, whereas LjHb2 was induced only by the application of sucrose. LjHb1 was also induced transiently by the inoculation with the symbiotic rhizobium Mesorhizobium loti MAFF303099. Observations using fluorescence microscopy revealed the induction of LjHb1 expression corresponded to the generation of NO. These results suggest that non-sym-Hb and NO have important roles in stress adaptation and in the early stage of legume–rhizobium symbiosis.

(Received May 19, 2004; Accepted October 18, 2004)

Introduction

Plant hemoglobins (Hbs) were first identified in the root nodules of legumes (Kubo 1939). Hbs are now believed to be present in all plants (Hill 1998). Symbiotic Hbs (sym-Hbs) exist in the root nodules of both legumes and non-legumes (e.g. Casuarina glauca, Myrica gale and Alnus glutinosa) that establish a symbiosis with nitrogen-fixing bacteria. Sym-Hbs are expressed at high concentrations in root nodules, where they act as oxygen transporters to allow respiration of the microsymbionts and as regulators of oxygen concentration to allow effective nitrogenase activity (Appleby 1992).

Other plant Hbs, identified in both nitrogen-fixing and non-nitrogen-fixing plants such as Arabidopsis thaliana, monocots (Oryza, Hordeum, and Zea spp.) (Arredondo-Peter et al. 1998) and non-vascular plants (Hunt et al. 2001), are referred to as non-symbiotic Hbs (non-sym-Hbs) because they are not associated with the presence of a symbiont. Non-sym-Hbs can be divided into two distinct groups, class 1 and class 2 Hbs, according to their phylogeny, biochemical characteristics and profiles of gene expression.

A class 1 hemoglobin gene of Arabidopsis thaliana, AHB1, is highly induced under hypoxia, by sucrose addition (Trevaskis et al. 1997) and by nitrate addition (Wang et al. 2000). In light of the characteristics of class 1 Hbs and the features of transgenic plants carrying class 1 Hb genes, class 1 Hbs might have important functions in plant growth and ATP metabolism under hypoxia. Class 2 Hbs have been identified in several eurosid II species (Gossypium hirsutum, Cichorium intybus and Brassica napus) by genomic library screening and database searches (Hunt et al. 2001). Compared with class 1 Hbs, class 2 Hbs are closer in sequence to the sym-Hbs of legumes. Class 2 non-sym-Hbs were induced in tomato (Solanum lycopersicon) and Arabidopsis in response to microorganisms and cytokinin treatment (Hunt et al. 2001). Truncated Hbs were also identified in plants (Watts et al. 2001). Truncated Hbs have some similarity to non-sym-Hb groups and are thought to have unique functions and evolutionary histories.

In animals and unicellular organisms, hemoglobins interact with NO. NO is produced in animal cells during hypoxia, where it can function as a messenger in the apoptosis pathway (Brüne et al. 1998). In addition, flavohemoglobins of bacteria and yeast are believed to act as deoxygenases of toxic NO (Gardner et al. 1998). In plants, NO is produced under various conditions, and it works as a signal molecule, resulting in induction of the defense system and as a trigger of apoptosis (Durner et al. 1998, Dordas et al. 2003a). NO production was detected in hypoxic maize cell cultures and alfalfa root cultures (Seregélyes and Dudits 2003). Furthermore, a transgenic Arabidopsis culture overexpressing Arabidopsis Hb showed resistance to hypoxia (Hunt et al. 2002). A transgenic alfalfa root culture overexpressing barley Hb showed lower amounts of NO than wild type and underexpressing lines when exposed to hypoxia (Dordas et al. 2003b). Recently, Dordas et al. (2004) reported that NO was generated by nitrate reductase in maize cell suspension cultures under hypoxia, and that class 1 Hb controlled the NO level. These reports led us to suppose that class 1 Hbs may be involved in NO-mediated signaling pathways and in stress adaptation mechanisms of plants.

In this report, we examine the expression profile of the non-sym-Hb genes LjHb1 (LjHb1 was called LjNSG1 in the report of Uchiumi et al. 2002) and LjHb2 of the model legume Lotus japonicus MG20 Miyakojima (Kawaguchi 2000). LjHb1 was strongly induced under both hypoxia and cold stress, and by treatment with S-nitroso-N-acetyl-d,l-penicillamine (SNAP) as a NO donor. Transient expression of LjHb1 was induced by the inoculation of symbiotic rhizobium. Furthermore, the relationship between the specific expression of LjHb1 and NO was confirmed by fluorescence microscopy with 4-amino-5-methylamino-2′,7′-difluorofluorescein (DAM-FM) diacetate as a NO detector. Based on these results, we discussed the possible involvement of non-sym-Hb and NO under the stress conditions and in the early stage of legume–rhizobium symbiosis.

Results

Analysis of promoter regions of LjHb1 and LjHb2

By sequencing the TAC clone (LjT07I01a, Sato et al. 2001) that carries LjHb1 (Uchiumi et al. 2002), another non-sym-Hb gene, LjHb2, was identified 4 kb upstream of LjHb1 (Fig. 1a). No pseudogene was found in this TAC clone. LjHb1 and LjHb2 were mapped to linkage group 3 (marker name, TM0091; http://www.kazusa.or.jp/lotus/). Full-length LjHb2 was 2,080 bp and had four exons separated by three introns at positions identical to those in other plant Hb genes. The profiles of genomic Southern hybridization probed with LjHb1 and LjHb2 were completely consistent with the restriction map of TAC clone LjT07I01a (data not shown). This indicates that LjHb1 and LjHb2 exist at a single copy in the genome of L. japonicus.

The sequences of the 5′-upstream regions of LjHb1 and LjHb2 were also determined. The LjHb2 promoter contained two motifs (CTCCC and AAAGGG) that are presumed to be critical for the expression of non-sym-Hb genes (Andersson et al. 1996, Andersson et al. 1997, Uchiumi et al. 2002) (Fig. 1b). The promoter region of LjHb1 contained two similar motifs (CTCTT and GAAGGG) found in the promoters of other non-sym-Hb genes. Similar motifs are also conserved in the promoters of A. thaliana (AHB1 and AHB2) and Oryza sativa (HB1 and HB2) at a different spacing (data not shown). The sequences of the 5′-upstream regions (up to 1,500 bp) of LjHb1 and LjHb2 were used to identify motif sequences that may be involved in the expression of these genes. The 1,500 bp upstream regions of LjHb1 and LjHb2 showed little similarity. The LjHb1 promoter contained ABRE (abscisic acid-responsive element; TCCACGTGG, –191 to –183), which is involved in abscisic acid (ABA)-induced expression (Yamaguchi-Shinozaki and Shinozaki 1994) (Fig. 1b). In the LjHb2 promoter, the sequence TG(G/C)AC(T/G)G, which is similar to the sucrose-responsive element (SURE) that is involved in sugar-inducible expression (Maeo et al. 2001), was located more distantly from the transcription start site (Fig. 1b). No significant similarity could be identified in the 3′-untranslated regions of LjHb1 and LjHb2 except for the putative signal sequence (AATAAA) for poly(A) addition.

Phylogeny of LjHb1 and LjHb2

In the deduced amino acid sequences, heme-binding residues (distal and proximal histidine, phenylalanine and proline), which are highly conserved among plant Hb genes, were identified in LjHb2. LjHb1 and LjHb2 showed 74% similarity in amino acids. Fig. 2 shows a phylogenetic tree of plant Hbs constructed by the neighbor-joining method in ClustalW. In the tree, sym-Hbs and non-sym-Hbs branched off clearly. All class 1 Hbs make a large cluster that includes LjHb1, suggesting that LjHb1 is a class 1 Hb. Class 2 Hbs are closer to sym-Hbs and also made a independent cluster. Although LjHb2 made a large cluster with class 1 Hbs, LjHb2 was located distantly from LjHB1 and classified in a unique branch of the tree (Fig. 2).

Expression of LjHb1 and LjHb2 in mature plants and under stress conditions

The expression of LjHb1 and LjHb2 in mature plants was analyzed by quantitative RT–PCR using gene-specific primer pairs (Fig. 3). The amount of transcripts of LjeIF-4A, the gene for initiation factor 4A3 of L. japonicus, was used for normalization (Uchiumi et al. 2002). LjHb1 and LjHb2 were expressed in the leaf, stem and root of mature plants (6 weeks old), and enhanced expression was observed in mature root nodules (Fig. 3). Enhanced expression of LjHb2 was also observed in mature leaves (Fig. 3).

The expression of LjHb1 and LjHb2 under stress conditions was also analyzed by quantitative RT–PCR (Fig. 4). Plants 10 d old were exposed to stress conditions (hypoxia, cold and sucrose) for 24 h. LjHb1 was expressed strongly under hypoxia and cold stress. LjHb2 was expressed strongly in 1% sucrose, but was not induced under hypoxia (Fig. 4). To evaluate the reliability of the experimental conditions, the same stress treatments were applied to alfalfa (Medicago sativa). A non-sym-Hb gene of alfalfa (MHb1, AF172172) was enhanced only under hypoxia as described by Seregélyes et al. (2000) (data not shown).

Induction of LjHb1 and LjHb2 by plant hormones and NO donor (SNAP)

Plants 10 d old were treated with the plant hormones indole-3-acetic acid (IAA), 6-benzylaminopurine (BA), gibberellic acid (GA3) and ABA. LjHb1 was induced by BA and ABA, but LjHb2 was not (Fig. 5). LjHb2 was not strongly induced by any concentration of the NO donor SNAP (Fig. 6). On the other hand, LjHb1 was strongly induced in a dose-dependent manner (Fig. 6). In plants treated with 1 mM SNAP and 1 mM carboxy-2-phenyl-4,4,5,5-tetramethylimidazolinone-3-oxide-1-oxyl (c-PTIO, NO scavenger), the induction of LjHb1 by SNAP was repressed strongly (Fig. 7).

Induction of non-sym-Hb genes by rhizobial infection

To examine the response of LjHb1 and LjHb2 to microsymbionts, 14-day-old plants were inoculated with Mesorhizobium loti MAFF 303099. The expression of LjHb1 increased at 4 h after inoculation and decreased to its basal level at 10 h (Fig. 8, LjHb1). However, no obvious change could be detected in the expression of LjHb2 and sym-Hb genes of L. japonicus (Fig. 8, LjHb2 and Ljsym-Hb). By 10 d after inoculation, the expression levels of LjHb1 were the same as in uninfected control roots, except for increased expression in young nodules (data not shown).

Detection of NO accumulation using DAF-FM diacetate

To understand the relationship between the existence of NO and the expression of LjHb1 and LjHb2, we observed NO accumulation in root tissues under fluorescence microscopy using DAF-FM diacetate as a NO detector (Fig. 9). The intensity of fluorescence was dramatically and dose-dependently increased by the addition of SNAP a NO generator (Fig. 9, SNAP). When the roots were treated with SNAP mixed with c-PTIO a NO scavenger, the intensity of the fluorescence decreased compared with the intensity of SNAP treatment alone, but was still detectable (Fig. 9, SNAP + c-PTIO). These observations indicate that NO generated from SNAP in root tissues is detectable with DAF-FM diacetate, and that c-PTIO did not remove NO completely under the experimental conditions we used.

Stress-treated roots were also observed (Fig. 10). Strong fluorescence was detected in cold- and hypoxia-treated roots; root hair cells generated especially strong fluorescence (Fig. 10, cold and hypoxia). Although the intensity was not as strong, it was increased by inoculation with M. loti. No obvious fluorescence was detected in the ABA-treated (data not shown) or sucrose-treated roots (Fig. 10, sucrose).

Discussion

Non-sym-Hbs in plants are divided into two distinct types. Class 1 Hbs have high affinity for oxygen and their genes are induced under hypoxia. Dordas et al. (2003b) called class 1 Hbs stress-induced Hbs. Class 2 Hbs have a lower affinity for oxygen (Trevaskis et al. 1997, Dordas et al. 2003b); their genes are expressed in roots, leaves and inflorescences, and expression is induced in young plants by cytokinin treatment or low temperature (Trevaskis et al. 1997, Hunt et al. 2001). In leguminous plants, this is the first report about two distinct types of non-sym-Hb genes, LjHb1 and LjHb2, in the genome of L. japonicus. We characterized LjHb1 and LjHb2 by their expression profiles and propose a possible function for non-sym-Hbs in symbiosis.

Both LjHb1 and LjHb2 were expressed at a low level in leaves, stems and roots, and enhanced expression was observed in root nodules. Additionally, the sequence that resembles the nodulin motif was located 5′-upstream of both genes. This suggests that not only sym-Hb but also non-sym-Hb responds to microsymbionts. LjHb1 was expressed strongly under hypoxia, in common with other class 1 Hbs. It was also induced by low temperature (4°C) and by plant hormone (ABA and cytokinin) treatment. In A. thaliana, the class 1 AHB1 is induced under hypoxia and with sucrose addition, whereas the class 2 AHB2 is induced by cold (Trevaskis et al. 1997) and cytokinin treatment (Hunt et al. 2001). In alfalfa, the class 1 MHb1 is induced by hypoxia but not by cold stress (Seregélyes et al. 2000). In contrast, LjHb2 was induced only by sucrose addition and was not induced by low temperature or plant hormone treatments, unlike other class 2 Hbs. In the phylogenetic tree of plant Hbs, LjHb2 makes a large clade with class 1 Hbs containing LjHb1. However, LjHb2 is located on an independent branch, being consistent with the specific expression profile. Although we do not have a reliable explanation for these characteristics of LjHb1 and LjHb2, they might be unique features of non-sym-Hb genes of L. japonicus. Biochemical analysis, such as the measurement of affinity for oxygen, will be required to classify the non-sym-Hbs in L. japonicus.

The expression profiles of LjHb1 and LjHb2 were supported by the existence of cis-elements (ABRE and SURE) in each promoter. In the LjHb2 promoter, SURE was identified at a distal region as found in the promoter of the sucrose-inducible β-amylase gene of sweet potato (Maeo et al. 2001). In addition, LjHb1 contains ABRE at a proximal region (–191 to –183) of its promoter. Hobo et al. (1999) mentioned that most of the promoters of ABA-inducible genes contain an ABRE motif within 300 bp upstream of the transcription start site. Arabidopsis AHB2, which is induced under low temperature stress, has an ABRE at a similar position to that in the LjHb1 promoter. Moreover, it is known that low temperature stress could trigger the production of ABA (Yamaguchi-Shinozaki and Shinozaki 1994). In fact, the expression of LjHb1 was enhanced in the plants exposed to low temperature. These results indicate that LjHb1 may have a role in ABA-mediated metabolism under low temperature stress in plants.

A class 1 non-sym-Hb gene of A. thaliana (AHB1) is expressed in root and rosette leaves under hypoxia (Trevaskis et al. 1997). Overexpression of class 1 non-sym-Hb increased survival of plants under hypoxic stress and also greatly increased early growth in non-hypoxic conditions (Sowa et al. 1998, Hunt et al. 2002, Dordas et al. 2003a). During hypoxia, NO is generated, resulting in apoptosis (Durner and Klessig 1999). NO–heme complexes were detected in maize cell cultures and alfalfa root cultures (Dordas et al. 2003b). Transgenic alfalfa root cultures that overexpressed barley Hb showed lower amounts of NO and a lower rate of cell death than both wild-type and underexpressing lines when they were exposed to hypoxia (Dordas et al. 2003a). Dordas et al. (2004) suggested that NO is generated by nitrate reductase under hypoxia, and that modulation of NO levels by class 1 Hb may be intimately linked to the short-term survival of plant tissue. In our results, fluorescence microscopy using an NO detector revealed NO in the roots under both hypoxia and low temperature stress. Under these stress conditions, NO might be generated by nitrate reductase as described by Dordas et al. (2004). The expression of LjHb1 increased greatly under those stress conditions. Furthermore, the increase of LjHb1 expression depended on the dose of the NO donor (SNAP). These results suggest that LjHb1 is involved in the modulation of NO levels in L. japonicus. NO reacts very rapidly with oxyhemoglobin and formes nitrate and methemoglobin (Dordas et al. 2004). Effective NO recycling gives plants advantages under some stress conditions by maintaining glycolysis (Dordas et al. 2003b). If LjHb1 has the ability to bind or degrade NO, LjHb1 will be involved in stress adaptation as an NO scavenger to detoxify or recycle NO to nitrate.

NO is also a signal molecule which can induce plant defense responses. NO activates guanylate cyclase and cGMP, which induce the expression of defense genes such as pathogenesis-related-1 protein and phenylalanine ammonia lyase (Durner et al. 1998, Klessig et al. 2000). In addition, NO and NO synthase-like activities have been detected in young and mature nodules, where they have been considered potent inhibitors of bacteroidal nitrogenase activity (Herouart et al. 2002). In our results, enhanced expression of LjHb1 was observed in mature nodules and under NO donor treatment. The increased expression level of LjHb1 in mature nodules is probably due to high rates of generation of NO in nodules, where LjHb1 might act as a NO scavenger in order to maintain effective nitrogen fixation. Interestingly, inoculation of the symbiotic rhizobium M. loti MAFF303099 also induced the specific expression of LjHb1. No significant change could be observed in the expression of LjHb2 and Ljsym-Hb. Fluorescence microscopy using a NO detector (DAF-FM diacetate) revealed that transient NO generation was observed at 4 h after M. loti inoculation in accordance with the induction of LjHb1 expression (Fig. 10). The quick generation of NO after inoculation with rhizobia might be the signal for activation of NO-mediated defense responses in the host plant. If LjHb1 is able to reduce the NO level in epidermis and abort the defense responses, it will provide good conditions for symbiotic rhizobia to establish symbiosis.

In A. thaliana, ABA induced the production NO by activating NO synthase (Guo et al. 2003). From our results, LjHb1 contains ABRE in its 5′-upstream region (Fig. 1b), and was induced by the addition of ABA and NO donor (Fig. 5, 6). It is possible that LjHb1 also plays important roles in ABA-induced NO metabolism in legume–rhizobium symbiosis. Recently, we reported that external ABA reduced the number of nodules (Suzuki et al. 2004). If external ABA induces the generation of NO in roots, NO might inhibit the early stage of nodule formation through a defense mechanism.

In summary, LjHb1 was induced by NO and M. loti and the expression was enhanced in nodules, suggesting that LjHb1 and NO are involved in M. loti–L. japonicus symbiosis. These results will give us a new aspect to understand the function of non-sym-Hbs in plants.

Materials and Methods

Plants and bacteria

L. japonicus MG20 Miyakojima (Kawaguchi 2000) was used throughout the experiments. M. loti MAFF303099 (Kaneko et al. 2000, Saeki and Kouchi 2000) was used as the symbiotic partner of L. japonicus.

Stress treatment of plants

Surface-sterilized L. japonicus seedlings were grown on 1.4% Fåhraues agar plates at 25°C in a 16 h light/8 h dark cycle for 10 days. The plants were transferred to plastic dishes (92 cm×17 cm) containing 10 ml of liquid Fåhraues medium (Fåhraeus 1957). Plants 10 d old were used in the stress treatments. For hypoxic stress, plants put between papers moistened with liquid Fåhraues medium were transferred to plastic bags and flushed with N2 gas for 3 min. After sealing firmly, plants were incubated in N2 gas (hypoxic conditions; Howard et al. 1987, Dolferus et al. 1994). For cold stress, plants were incubated at 4°C. For osmotic stress, plants were put between papers moistened with liquid Fåhraues medium containing 1% sucrose. All stress treatments were carried out for 24 h in the dark. Control plants were incubated at 25°C for 24 h in the dark.

Plant hormone and NO donor treatment of plants

Plant hormone and NO donor treatment were performed with 10-day-old plants. The plants were put between papers moistened with liquid Fåhraues medium containing 10 µM IAA, 10 µM BA, 10 µM GA3 or 10 µM ABA. All treatments were performed at 25°C for 24 h in the dark.

For experiments with SNAP, plants were put between papers moistened with distilled water containing SNAP (0.1, 0.5 and 1 mM) at 25°C for 3 h in the dark. To confirm the effect of c-PTIO as a NO scavenger, plants were put between papers moistened with c-PTIO at the final concentration of 1 mM for 2 h in the dark (pre-treatment), and then transferred to medium containing SNAP or SNAP with c-PTIO (SNAP + c-PTIO).

Inoculation of rhizobia

M. loti MAFF303099 grown in yeast mannitol liquid medium (Keele et al. 1969) was harvested and then suspended in sterilized distilled water (107 cells/ml). Each 10-day-old plant was inoculated with 5 µl of the bacterial suspension.

Isolation of total RNA from L. japonicus

Whole plants and tissues were quickly frozen in liquid N2 and stored at –80°C. Total RNA was prepared using the RNeasy Plant Mini Kit (Qiagen) or the phenol–SDS procedure (Suzuki et al. 1997).

Analysis of the promoter regions of LjHb1 and LjHb2

The sequences of the 5′-upstream regions (up to 1,500 bp) of LjHb1 and LjHb2 were used to identify motif sequences that may be involved in the expression of Hb genes of A. thaliana (AHB1 and AHB2) and O. sativa (HB1 and HB2). These motif searches were performed using the Motif Sampler algorithms, which can be accessed through the PlantCARE database Web site (http://sphinx.rug.ac.be:8080/PlantCARE/cgi/index.html).

Analysis of the expression of Hb genes

The expression of the sym- and non-sym-Hb genes of L. japonicus was measured by quantitative real-time RT–PCR. DNase I-treated total RNA (100 ng) was used as a template in a total volume of 50 µl of reaction mixture containing 25 µl of SYBR-Green PCR master mix (Applied Biosystems), 1 µl of RNase inhibitor (40 U µl–1), 0.25 µl of Superscript II-RT (Invitrogen, 200 U µl–1) and 2 µl of each primer (5 µM). The reverse transcriptase reaction and PCR were performed in a 7700 Sequence Detection System (Applied Biosystems). After the reverse transcriptase reaction at 48°C for 30 min followed by heating at 95°C for 10 min, target genes were amplified in 40 cycles of 95°C for 15 s and 60°C for 1 min. Primers for real-time RT–PCR were designed with Primer Express software (Applied Biosystems). Their sequences were as follows: for LjHb1, CCTTTGGAGGAGAACCCCAA and AGACTGCTGATTCACAAGTCATG; for LjHb2, TCAAAAAAGGTGTAATTCCG and CTAAGACTCTGGTTTCATTTC. Primers for sym-Hb genes were designed based on the conserved region of three sym-Hb genes (LjLb1, LjLb2 and LjLb3). The sequences of primers for sym-Hb genes were as follows: TCTGGRCCYAMGCAYAGTC and CRTCRCGWGTCAGTSCAAAA.

Detection of NO accumulation by fluorescence microscopy

A stock solution of DAF-FM diacetate (5 mM in dimethylsulfoxide) was diluted 500-fold in water before use. The 10-day-old plants were placed for 30 min on filter paper soaked with the DAF-FM diacetate solution, and then the fluorescence of the plants was observed to estimate autofluorescence. Plants that generated strong autofluorescence were not used for further experiments. After the selection, plants were transferred onto new filter paper containing SNAP or SNAP mixed with c-PTIO (SNAP + c-PTIO) and DAF-FM diacetate solution. DAF images were taken 30 min after treatments through a Leica DMLB microscope equipped with a Leica DC2000 digital camera. For detection of DAF-FM fluorescence, filter sets of 470 nm (excitation) and 525 nm (emission) were used. For observation of stress-treated (24 h) plants and rhizobial-inoculated (4 h) plants, plants were placed for 30 min on filter paper soaked with the DAF-FM diacetate solution, then the fluorescence of the plants was observed.

Chemicals

The SNAP used as a NO donor and the c-PTIO used as a NO scavenger were purchased from Sigma-Aldrich. SNAP and c-PTIO were used at final concentrations of 1 mM and 100 µM. The DAF-FM diacetate used as a NO detector was purchased from Daiichi Pure Chemicals.

Acknowledgments

This works was supported in part by Special Coordination Funds for Promoting Science and Technology.

Fig. 1 Schematic illustration of LjHb1 and LjHb2 in the L. japonicus genome. (a) Restriction map of genomic TAC clone LjT07I01a. The numbers indicate the position of the initiation and stop codons (in bp). P, PstI; E, EcoRI; H, HindIII. (b) Cis-element searches were performed using the Motif Sampler algorithms. The numbers indicate the position from the translation initiation codon ATG. Hatched boxes indicate the regions including highly conserved CT and AG motifs. Gray and black boxes represent ABRE (abscisic acid-responsive element) and SURE (sucrose-responsive element), respectively.

Fig. 1 Schematic illustration of LjHb1 and LjHb2 in the L. japonicus genome. (a) Restriction map of genomic TAC clone LjT07I01a. The numbers indicate the position of the initiation and stop codons (in bp). P, PstI; E, EcoRI; H, HindIII. (b) Cis-element searches were performed using the Motif Sampler algorithms. The numbers indicate the position from the translation initiation codon ATG. Hatched boxes indicate the regions including highly conserved CT and AG motifs. Gray and black boxes represent ABRE (abscisic acid-responsive element) and SURE (sucrose-responsive element), respectively.

Fig. 2 Phylogenetic tree based on the predicted amino acid sequences of plant hemoglobins. The tree was constructed by the neighbor-joining method in ClustalW. The numbers on the branches show bootstrap probabilities determined from 1,000 resamplings. The database accession numbers are indicated in parentheses after plant names.

Fig. 2 Phylogenetic tree based on the predicted amino acid sequences of plant hemoglobins. The tree was constructed by the neighbor-joining method in ClustalW. The numbers on the branches show bootstrap probabilities determined from 1,000 resamplings. The database accession numbers are indicated in parentheses after plant names.

Fig. 3 Expression of LjHb1 and LjHb2 in different tissues. Total RNA of each tissue was isolated from 6-week-old plants. The amounts of transcripts in different tissues were estimated by quantitative real-time RT–PCR. The amounts were normalized to the amount of LjeIF-4A transcripts. The numbers on the bars indicate the amount relative to the roots. The values indicate the average of three independent experiments. L, leaf; S, stem; R, root; N, root nodule.

Fig. 3 Expression of LjHb1 and LjHb2 in different tissues. Total RNA of each tissue was isolated from 6-week-old plants. The amounts of transcripts in different tissues were estimated by quantitative real-time RT–PCR. The amounts were normalized to the amount of LjeIF-4A transcripts. The numbers on the bars indicate the amount relative to the roots. The values indicate the average of three independent experiments. L, leaf; S, stem; R, root; N, root nodule.

Fig. 4 Expression of LjHb1 and LjHb2 under stress conditions. Total RNAs were isolated from whole plants (10 d after germination) after 24 h stress treatments. The amounts of transcripts were estimated by means of quantitative real-time RT–PCR normalized to LjeIF-4A transcripts. The values indicate the average of three independent experiments with standard deviations. ‘Cont.’ indicates the contents (amounts) of transcripts in untreated roots.

Fig. 4 Expression of LjHb1 and LjHb2 under stress conditions. Total RNAs were isolated from whole plants (10 d after germination) after 24 h stress treatments. The amounts of transcripts were estimated by means of quantitative real-time RT–PCR normalized to LjeIF-4A transcripts. The values indicate the average of three independent experiments with standard deviations. ‘Cont.’ indicates the contents (amounts) of transcripts in untreated roots.

Fig. 5 Expression of LjHb1 and LjHb2 after treatment with plant hormones. Plants 10 d old were treated with plant hormones for 24 h in the dark, and total RNAs were isolated from whole plants. The amounts of transcripts were estimated by means of quantitative real-time RT–PCR normalized to LjeIF-4A transcripts. The values indicate the average of three independent experiments with standard deviations. ‘Cont.’ indicates the content (amounts) of transcripts in untreated roots. IAA, indoleacetic acid; BA, benzylaminopurine; GA, gibberellic acid; ABA, abscisic acid.

Fig. 5 Expression of LjHb1 and LjHb2 after treatment with plant hormones. Plants 10 d old were treated with plant hormones for 24 h in the dark, and total RNAs were isolated from whole plants. The amounts of transcripts were estimated by means of quantitative real-time RT–PCR normalized to LjeIF-4A transcripts. The values indicate the average of three independent experiments with standard deviations. ‘Cont.’ indicates the content (amounts) of transcripts in untreated roots. IAA, indoleacetic acid; BA, benzylaminopurine; GA, gibberellic acid; ABA, abscisic acid.

Fig. 6 Expression of LjHb1 and LjHb2 in whole plants treated with an NO donor (SNAP). Plants 10 d old were treated with SNAP for 3 h in the dark, and total RNAs were isolated from whole plants. The amounts of transcripts were estimated by means of quantitative real-time RT–PCR normalized to LjeIF-4A transcripts. The values indicate the average of three independent experiments with standard deviations.

Fig. 6 Expression of LjHb1 and LjHb2 in whole plants treated with an NO donor (SNAP). Plants 10 d old were treated with SNAP for 3 h in the dark, and total RNAs were isolated from whole plants. The amounts of transcripts were estimated by means of quantitative real-time RT–PCR normalized to LjeIF-4A transcripts. The values indicate the average of three independent experiments with standard deviations.

Fig. 7 Expression of LjHb1 in whole plants treated with an NO donor (SNAP) and NO scavenger (c-PTIO). Plants 10 d old were pre-treated with c-PTIO for 2 h in the dark, and then treated with SNAP and c-PTIO. Total RNAs were isolated from whole plants. The amounts of transcripts were estimated by means of quantitative real-time RT–PCR normalized to LjeIF-4A transcripts. The values indicate the average of three independent experiments with standard deviations.

Fig. 7 Expression of LjHb1 in whole plants treated with an NO donor (SNAP) and NO scavenger (c-PTIO). Plants 10 d old were pre-treated with c-PTIO for 2 h in the dark, and then treated with SNAP and c-PTIO. Total RNAs were isolated from whole plants. The amounts of transcripts were estimated by means of quantitative real-time RT–PCR normalized to LjeIF-4A transcripts. The values indicate the average of three independent experiments with standard deviations.

Fig. 8 Expression of LjHb1, LjHb2, and Ljsym-Hb in response to rhizobial inoculation. Plants 10 d old were inoculated with M. loti MAFF303099. Total RNAs were isolated from whole plants. Time indicates the sampling time after inoculation with M. loti. The amounts of transcripts were estimated by means of quantitative real-time RT–PCR normalized to LjeIF-4A transcripts. The values indicate the average of three independent experiments with standard deviations. Hatched and gray bars show with and without inoculation of M. loti, respectively.

Fig. 8 Expression of LjHb1, LjHb2, and Ljsym-Hb in response to rhizobial inoculation. Plants 10 d old were inoculated with M. loti MAFF303099. Total RNAs were isolated from whole plants. Time indicates the sampling time after inoculation with M. loti. The amounts of transcripts were estimated by means of quantitative real-time RT–PCR normalized to LjeIF-4A transcripts. The values indicate the average of three independent experiments with standard deviations. Hatched and gray bars show with and without inoculation of M. loti, respectively.

Fig. 9 Detection of NO using DAF-FM diacetate in roots treated with SNAP. After 30 min incubation with DAF-FM diacetate, SNAP or SNAP + c-PTIO was added. The middle parts of roots were observed by bright field (BF) and fluorescence (DAF) microscopy 30 min later. As a control, distilled water (DW) was added instead of SNAP solution. The intensity of fluorescence was dramatically increased by SNAP in a dose-dependent manner. For SNAP + c-PTIO, the fluorescence was still detectable under the conditions employed.

Fig. 9 Detection of NO using DAF-FM diacetate in roots treated with SNAP. After 30 min incubation with DAF-FM diacetate, SNAP or SNAP + c-PTIO was added. The middle parts of roots were observed by bright field (BF) and fluorescence (DAF) microscopy 30 min later. As a control, distilled water (DW) was added instead of SNAP solution. The intensity of fluorescence was dramatically increased by SNAP in a dose-dependent manner. For SNAP + c-PTIO, the fluorescence was still detectable under the conditions employed.

Fig. 10 Detection of NO using DAF-FM diacetate in stressed and inoculated roots. After stress treatment (24 h) or M. loti inoculation (4 h), the middle parts of the roots were observed by bright field (BF) and fluorescence (DAF) microscopy. Strong fluorescence was observed in roots treated with hypoxia and cold stress. Inoculation with M. loti also increased the level of fluorescence in epidermal cells.

Fig. 10 Detection of NO using DAF-FM diacetate in stressed and inoculated roots. After stress treatment (24 h) or M. loti inoculation (4 h), the middle parts of the roots were observed by bright field (BF) and fluorescence (DAF) microscopy. Strong fluorescence was observed in roots treated with hypoxia and cold stress. Inoculation with M. loti also increased the level of fluorescence in epidermal cells.

4
Corresponding author: E-mail, uttan@sci.kagoshima-u.ac.jp; Fax, +81-99-285-8164.

References

Andersson, C.R., Jensen, E.O., Llewellyn, D.J., Dennis, E.S. and Peacock, W.J. (
1996
) A new hemoglobin gene from soybean: a role for hemoglobin in all plants.
Proc. Natl. Acad. Sci. USA
 
93
:
5682
–5687.
Andersson, C.R., Llewellyn, D.J., Peacock, W.J. and Dennis, E.S. (
1997
) Cell-specific expression of the promoters of two nonlegume hemoglobin genes in a transgenic legume, Lotus corniculatus.
Plant Physiol.
 
113
:
45
–57.
Appleby, C.A. (
1992
) The origin and functions of haemoglobin in plants.
Sci. Prog.
 
76
:
365
–398.
Arredondo-Peter, R., Hargrove, M.S., Moran, J.F., Sarath, G. and Klucas, R.V. (
1998
) Plant hemoglobins.
Plant Physiol.
 
118
:
1121
–1125.
Brüne, B., von Knethen, A. and Sandaru, K.B. (
1998
) Nitric oxide and its role in apoptosis.
Eur. J. Phalmacol.
 
351
:
261
–272.
Dolferus, R., Jacobs, M., Peacoch, W.J. and Dennis, E.S. (
1994
) Differencial interactions of promoter elements in stress responses of the Arabidopsis Adh gene.
Plant Physiol.
 
105
:
1075
–1087.
Dordas, C., Hasinoff, B.B., Lgamberdiev, A.U., Manach, N., Rivoal, J. and Hill, R.D. (
2003
) Expression of a stress-induced hemoglobin affects NO levels produced by alfalfa root culture under hypoxic stress.
Plant J.
 
35
:
763
–770.
Dordas, C., Hasinoff, B.B., Rivoal, J. and Hill, R.D. (
2004
) Class-1 hemoglobins, nitrate and NO levels in anoxic maize cell-suspension cultures.
Planta
 
219
:
66
–72.
Dordas, C., Rivoal, J. and Hill, R.D. (
2003
) Plant hemoglobins, nitric oxide and hypoxic stress.
Ann. Bot.
 
91
:
173
–178.
Durner, J. and Klessig, D.F. (
1999
) Nitric oxide as a signal in plants.
Curr. Opin. Plant Biol.
 
2
:
369
–374.
Durner, J., Wendehenne, D. and Klessig, D.F. (
1998
) Defense gene induction in tobacco by nitric oxide, cyclic GMP, and cyclic ADP-ribose.
Proc. Natl. Acad. Sci. USA
 
95
:
10328
–10333.
Fåhraeus, G.M. (
1957
) The infection of clover root hair by nodule bacteria studied by a single glass slide technique.
J. Gen. Microbiol.
 
16
:
374
–381.
Gardner, P.R., Gardner, A.M., Martin, L.A. and Salzman, A.L. (
1998
) Nitric oxide dioxygenase: an enzymic function for flavohemoglobin.
Proc. Natl. Acad. Sci. USA
 
95
:
10378
–10383.
Guo, F.Q., Okamoto, M., Crawford, N.M. (
2003
) Identification of plant nitric oxide synthase gene involved in hormone signaling.
Science
 
302
:
100
–103.
Herouart, D., Baudouin, E., Frendo, P., Harrison, J., Santos, R, . Jamet, A., van de Sype, G., Touati, D. and Puppo, A. (
2002
) Reactive oxygen species, nitric oxide and glutathione: a key role in the establishment of legume–Rhizobium symbiosis?
Plant Physiol. Biochem.
 
40
:
619
–624.
Hill, R.D. (
1998
) What are hemoglobins doing in plants?
Can. J. Bot.
 
76
:
707
–712.
Hobo, T., Asada, M., Kowyama, Y. and Hattori, T (
1999
) ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.
Plant J.
 
19
:
679
–689.
Howard, E.A., Walker, J.C., Dennis E.S. and Peacock, W.L. (
1987
) Regulated expression of alcohol dehydrogenase-1 chimeric gene introduced into maize protoplast.
Planta
 
170
:
535
–540.
Hunt, P.W., Watts, R.A., Trevaskis, B., Llewelyn, D.J., Burnell, J., Dennis, E.S. and Peacock, W.J. (
2001
) Expression and evolution of functionally distinct haemoglobin genes in plants.
Plant Mol. Biol.
 
47
:
677
–692.
Hunt, P.W., Klok, E.J., Trevaskis, B., Watts, R.A., Ellis, M.H., Peacock, W.J. and Dennis E.S. (
2002
) Increased level of hemoglobin 1 enhances survival of hypoxic stress and promotes early growth in Arabidopsis thaliana.
Proc. Natl Acad. Sci. USA
 
99
:
17197
–17202.
Kaneko, K., Nakamura, Y., Sato, S., Asamizu, E., Kato, T., Sasamoto, S., Watanabe, A., Idesawa, K., Ishawa, A., Kawashima, K., Kimura, T., Kishida, Y., Kiyokawa, C., Hohara, M., Matsumoto, M., Matsuno, A., Mochizuki, Y., Nakayama, S., Nakazaki, N., Shimpo, S., Sugimoto, M., Takeuchi, C., Yamada, M. and Tabata, S. (
2000
) Complete genome structure of the nitrogen-fixing symbiotic bacterium Mesorhizobium loti.
DNA Res.
 
7
:
331
–338.
Kawaguchi, M. (
2000
) Lotus japonicus ‘Miyakojima’ MG-20: an early-flowering accession suitable for indoor handling.
J. Plant Res.
 
113
:
507
–509.
Keele, B.B., Jr, Hamilton, P.B. and Elkan, G.H. (
1969
) Glucose catabolism in Rhizobium japonicum.
J. Bacteriol.
 
97
:
1184
–1191.
Klessig, D., Durner, J., Noad, R., Navarre, D.A., Wendehenne, D., Kumar, D., Zhou, J.M., Shah, J., Zhang, S., Kachroo, P., Trifa, Y., Pontier, D., Lam, E. and Silva, H. (
2000
) Nitric oxide and salicylic acid signaling in plant defense.
Proc. Natl. Acad. Sci. USA
 
97
:
8849
–8855.
Kubo, H. (
1939
) Über hämoprotein aus den wurzelknöllchen von leguminosen.
Acta Phytochimica
  (Tokyo)
11
:
195
–200.
Maeo, K., Tomiya, T., Hayashi, K., Akaike, M., Morikami, A., Ishiguro, S. and Nakamura, K. (
2001
) Sugar-responsible elements in the promoter of gene for beta-amylase of sweet potato.
Plant Mol. Biol.
 
46
:
627
–637.
Saeki, K. and Kouchi, H. (
2000
). The Lotus symbiont, Mesorhizobium loti: molecular genetic techniques and application.
J. Plant Res.
 
113
:
457
–465.
Sato, S., Kaneko, T., Nakamura, Y., Asamizu, E., Kato, T. and Tabata, S. (
2001
) Structural analysis of a Lotus japonicus genome. I. Sequence features and mapping of fifty-six TAC clones which cover the 5.4 Mb regions of the genome.
DNA Res.
 
8
:
311
–318.
Seregélyes, C. and Dudits, D. (
2003
) Phytoglobins and nitric oxide: new partners in an old signaling system in plants.
Acta Biol. Hung.
 
54
:
15
–25.
Seregélyes, C., Mustárdy, L., Ayaydin, F., Sass, L., Kovács, L., Endre, G., Lukács, N., Kovács, I., Vass, I., Kiss, G.B., Horváth, G.V. and Dudits, D. (
2000
) Nuclear localization of a hypoxia-inducible novel non-symbiotic hemoglobin in cultured alfalfa cells.
FEBS Lett.
 
482
:
125
–130.
Sowa, A.W., Duff, S.M.G., Guy, P.A. and Hill, R.D. (
1998
) Altering hemoglobin levels changes energy status in maize calls under hypoxia.
Proc. Natl Acad. Sci. USA
 
95
:
10317
–10321.
Suzuki, A., Akune, M., Kogiso, M., Imagama, Y., Osuki, K., Uchiumi, T., Higashi, S., Han, SY., Yoshida, S., Asami, T. and Abe, M. (
2004
) Control of nodule number by the phytohormone abscisic acid in the roots of two leguminous species.
Plant Cell Physiol.
 
45
:
914
–922.
Suzuki, A., Suzuki, T., Tanabe, F., Toki, S., Washida, H., Wu, C.Y. and Takaiwa, F. (
1997
) Cloning and expression of five myb-related genes from rice seed.
Gene
 
198
:
393
–398.
Trevaskis, B., Watts, R.A., Andersson, C.R., Llewellyn, D.J., Hargrove, M.S., Olson, J.S., Dennis, E.S. and Peacock, W.J. (
1997
) Two hemoglobin genes in Arabidopsis thaliana: the evolutionary origins of leghemoglobins.
Proc. Natl Acad. Sci. USA
 
94
:
12230
–12234.
Uchiumi, T., Shimoda, Y., Tsuruta, T., Mukoyoshi, Y., Suzuki, A., Senoo, K., Sato, S., Kato, T., Tabata, S., Higashi, S. and Abe, M. (
2002
) Expression of symbiotic and nonsymbiotic-globin genes responding to microsymbionts on Lotus japonicus.
Plant Cell Physiol.
 
43
:
1351
–1358.
Wang, R., Guegler, K., LaBrie, S.T. and Crawford, N.M. (
2000
) Genomic analysis of a nutrient response in Arabidopsis reveals diverse expression patterns and novel metabolic and potential regulatory genes induced by nitrate.
Plant Cell
 
12
:
1491
–1509.
Watts, R.A., Hunt, P.W., Hvitved, A.N., Hargrove, M.S., Peacock, W.J. and Dennis, E.S. (
2001
) A hemoglobin from plants homologous to truncated hemoglobins of microoganisms.
Proc. Natl. Acad. Sci. USA
 
98
:
10119
–10124.
Yamaguchi-Shinozaki, K. and Shinozaki, K. (
1994
) A novel cis-acting element in an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-salt stress.
Plant Cell
 
6
:
251
–264.