Photosynthesis down-regulation precedes carbohydrate accumulation under sink limitation in Citrus

Abstract

Photosynthesis down-regulation due to an imbalance between sources and sinks in Citrus leaves could be mediated by excessive accumulation of carbohydrates. However, there is limited understanding of the physiological role of soluble and insoluble carbohydrates in photosynthesis regulation and the elements triggering the down-regulation process. In this work, the role of non-structural carbohydrates in the regulation of photosynthesis under a broad spectrum of source–sink relationships has been investigated in the Salustiana sweet orange. Soluble sugar and starch accumulation in leaves, induced by girdling experiments, did not induce down-regulation of the photosynthetic rate in the presence of sinks (fruits). The leaf-to-fruit ratio did not modulate photosynthesis but allocation of photoassimilates to the fruits. The lack of strong sink activity led to a decrease in the photosynthetic rate and starch accumulation in leaves. However, photosynthesis down-regulation due to an excess of total soluble sugars or starch was discarded because photosynthesis and stomatal conductance reduction occurred prior to any significant accumulation of these carbohydrates. Gas exchange and fluorescence parameters suggested biochemical limitations to photosynthesis. In addition, the expression of carbon metabolism-related genes was altered within 24 h when strong sinks were removed. Sucrose synthesis and export genes were inhibited, whereas the expression of ADP-glucose pyrophosphorylase was increased to cope with the excess of assimilates. In conclusion, changes in starch and soluble sugar turnover, but not sugar content per se, could provide the signal for photosynthesis regulation. In these conditions, non-stomatal limitations strongly inhibited the photosynthetic rate prior to any significant increase in carbohydrate levels.

Introduction

Plants maintain a balance between carbon assimilation, storage and growth in response to developmental and environmental signals (Smith and Stitt 2007). In subtropical regions, Citrus plants accumulate carbohydrates in roots and leaves as reserves during the winter. These reserves are mobilized and used during the main flush of growth and bloom in spring (Goldschmidt and Koch 1996). Fruit set, and further vegetative and fruit development in Citrus are supported mainly by actual photosynthetic rates because carbohydrate reserves in the tree have been depleted after the initial stages of bud sprouting and flowering (Syvertsen and Lloyd 1994).

The improvement of crop yield through enhancing photosynthesis depends on an understanding of the nature of the control mechanisms (Paul and Foyer 2001). It is assumed that photoassimilate production in leaves is modulated by the demand of the sinks (Jang and Sheen 1994, Goldschmidt and Koch 1996), although the sink effects on photosynthesis are not observable in all conditions and species. A positive effect of crop load has been reported in Citrus (Lenz 1978, Syvertsen 1994, Iglesias et al. 2002). In contrast, photosynthesis was reduced in some cases when fruits were eliminated (Bustan et al. 1992, Yamanishi 1995, Okuda et al. 1996, Syvertsen et al. 2003). Furthermore, under regular cropping conditions, the root system seems to be a particularly strong and unsaturable sink (Goldschmidt and Koch 1996). It is not clear to what extent sink demand controls photosynthetic rates of citrus under cropping conditions.

The sink effect on photosynthesis may operate through feedback/feedforward regulatory controls mediated by several sugar-sensitive systems (Paul and Pellny 2003, Rolland et al. 2006). Soluble sugar accumulation in leaves in response to decreased sink demand has been related to the down-regulation of photosynthesis in several species (Paul and Driscoll 1997, Quilot et al. 2004, Urban et al. 2004, Franck et al. 2006). Source–sink imbalances through girdling, defruiting, defoliation and in vivo sucrose supplementation have been created in Citrus to study the role of non-structural carbohydrates of leaves in photosynthesis regulation (Iglesias et al. 2002, Syvertsen et al. 2003). Feedback inhibition of photosynthesis due to starch accumulation has been proposed, although the role of soluble sugars and starch is not well established. The up- and down-regulation of photosynthesis after defoliation and sucrose supplementation could be correlated with the sucrose and starch content when measured after 10 days (Iglesias et al. 2002). However, after 20 days, neither the rate of change in carbohydrate content nor the absolute content of soluble sugars correlated with the photosynthetic rate. In contrast, starch content showed a correlation with photosynthesis at this time. Notably, it is difficult to compare the different techniques used to alter carbohydrate content because other physiological parameters could also be altered. Whether the regulation of photosynthesis depends on sink activity or carbohydrate content is not clear. Furthermore, the kinetics of the down-regulation have not been studied, and it is not known whether there is a starch threshold that triggers the down-regulation process.

The mechanism of photosynthetic inhibition due to excessive starch accumulation could involve CO₂-restricted diffusion or chloroplast rupturing (Schaffer et al. 1986). However, in the above-mentioned experiments, the relatively low starch accumulation appears to preclude its negative effects on CO₂ diffusion, and symptoms of chlorosis were not observed in leaves.

Diverse studies involving different species (Paul and Foyer 2001 and references therein) have cast doubt on the existence of a simple relationship between starch accumulation and feedback regulation. When sinks cannot use all of their assimilated carbon, sugar accumulates in leaves, having direct effects on the expression of ADP-glucose pyrophosphorylase (Müller-Rober et al. 1994) and other carbohydrate-responsive enzymes involved in sucrose and starch metabolism (Koch 1996), resulting in adaptive changes in assimilate partitioning. In general, conditions of limited carbohydrate availability can enhance the expression of genes coding for proteins involved in reserve mobilization and export processes (Koch 1996). This starch turnover may play a role in signalling assimilate abundance and regulating photosynthetic gene expression. Some evidence suggests that hexose, derived from starch during the night, may provide signals for feedback regulation through modulation of gene expression (Cheng et al. 1998). However, sugar signalling is not the only factor responsible, and photosynthesis responds to and is controlled by whole-plant source–sink and nutrient balance, mainly by carbon-to-nitrogen ratio (Paul and Foyer 2001).

In this work, a broad range of source–sink relationships have been examined in field-grown sweet orange trees to investigate the following. (i) The effects of soluble sugar and starch leaf content on the photosynthetic rate in the presence of sinks. Short- and long-term responses have been studied by testing different levels of leaf-to-fruit ratio in girdled branches. (ii) Photosynthetic down-regulation under sink limitation and the role of carbohydrate content. The long-term responses and the kinetics of the process during the first 48 h have been studied. (iii) The expression of genes related to starch and sucrose metabolism in relation to sink activity and carbohydrate content. The responses within the first 24 h for different source–sink relationships have been determined.

Materials and methods

Plant material

The experiments were performed on 40-year-old Salustiana sweet orange trees (Citrus sinensis L.) grafted on Troyer citrange (C. sinensis [L.] Osb. × Poncirus trifoliata Raf.) rootstock. Trees were drip irrigated, and mineral elements were supplied in the irrigation water from February to September. Fertilization was decided based on leaf analysis performed the previous year. Trees present alternate-year bearing habits, and the flowering intensity depends on the fruit load of the previous year. The trees alternated between years of abundant flowering and fruit set (‘on’ year) and years of almost no flowering (‘off’ year). During each year, ‘on’ and ‘off’ trees were found in the same orchard. Experiments were performed on ‘on’ trees.

Gas exchange and fluorescence measurements

Net CO₂ fixation rate (A_N), stomatal conductance (g_s) and substomatal CO₂ concentration (C_i) were measured at steady state under conditions of saturating light (1200 μmol m⁻² s⁻¹) and 400 ppm CO₂ with an LI-6400 (LI-COR, Lincoln, NE, USA). During the experimental period (June to July), midday air temperatures ranged from 26 to 35°C, and water vapour pressure deficit ranged from 1.5 to 3 kPa. To evaluate the presence of chronic photoinhibitory processes, the maximum quantum yield of photosystem II (PSII) (F_v/F_m) was measured on leaves after 30 min in darkness using a portable pulse amplitude modulation fluorometer (MINI PAM; Walz, Effeltrich, Germany). The background fluorescence signal in dark-adapted leaves (F_o) was determined with a 0.5 μmol photon m⁻² s⁻¹ measuring light at a frequency of 600 Hz. The application of a saturating flash of 10,000 μmol photon m⁻² s⁻¹ allowed for estimations of maximum fluorescence (F_m). The electron transport rate (ETR) and non-photochemical quenching (NPQ) were estimated as described in Maxwell and Johnson (2000). Gas exchange and fluorescence measurements were performed from 09:00 to 12:00 h (local time in Spain) on clear, cloudless days. One measurement per tree was performed on a fully expanded mature leaf (third or fourth leaf from the shoot apex). Ten trees were measured for each treatment.

The maximum rate of RuBisCo-mediated carboxylation (V_cmax) and the maximum rate of electron transport (J_max) were estimated in attached leaves from A_N/C_c curves based on the equations of Farqhuar et al. (1980) and modified by Harley and Sharkey (1991). Temperature was maintained at 30°C, irradiance at 1200 μmol photon m⁻² s⁻¹ and ambient CO₂ concentration (C_a) in the cuvette was controlled with a CO₂ mixer across the series 400, 300, 200, 100, 50, 400, 600, 800, 1000, 1200, 1400, 1600, 1800 and 2000 ppm. Measurements were recorded after equilibration to steady state, and CO₂ leakage was determined at each C_a value by placing a dead leaf in the cuvette (Long and Bernacchi 2003). Five independent A_N/C_c curves were produced for each treatment.

Carbohydrate analysis

The determination of soluble sugars and starch (as percentage per dry weight, % DW) was performed as described by García-Luis et al. (2002). Three independent extracts, obtained from nine trees (two leaves per tree and three trees per extract), were assayed for each treatment in all determinations. Unless otherwise stated, leaves were sampled at 12:00 h.

Manipulative treatments of the source–sink balance

In order to study the role of non-structural carbohydrates in the regulation of photosynthesis under a broad spectrum of source–sink relationships, two different treatments were performed.

Variation in leaf-to-fruit ratio in the presence of sinks

Uniform 1-year-old shoots with at least 50 leaves and a single fruit borne in a unifloral leafy inflorescence formed during the current year were girdled on 20 June 2008. A complete ring of bark (2 mm wide) was removed, leaving 10, 25 and 40 fully expanded young leaves (from the spring flush of the current season) along with the fruit above the girdle. The girdle was protected with PVC tape and maintained during the experiments. At the date of girdling, the average diameter of the fruitlet population was 23.0 ± 0.4 mm. No vegetative growth was produced in the girdled shoots during the experiments. Each treatment was replicated 10 times in 10 different trees. Non-girdled unifloral leafy inflorescences were used as controls. Photosynthesis was measured 5, 7, 15 and 35 days after girdling the shoots. Leaf carbohydrates were determined after 7, 15 and 30 days.

Manipulation of sink availability

Uniform 1-year-old vegetative (without fruit) shoots with at least 20 leaves were selected and girdled, leaving 10 fully expanded young leaves distal to the girdle. Girdling was performed between 09:30 and 10:00 h. Measurements were also performed on shoots bearing one fruit and 10 leaves above the girdle. The results were compared with those obtained in non-girdled vegetative and inflorescence (bearing one fruit) shoots. Each treatment was replicated 10 times in 10 different trees.

In a first long-term experiment (28 June 2009), photosynthesis was measured 1, 2, 5, 7, 21 and 35 days after girdling, and carbohydrate levels were determined after 24 and 48 h. The experiment was repeated (3 July 2009), and photosynthesis measurements were performed 1, 2, 3, 5, 8 and 24 h after girdling. Carbohydrate-related gene expression was also studied 2, 8 and 24 h after girdling in this experiment.

Gene expression analysis

Leaf tissue was finely ground in liquid nitrogen and total RNA was extracted using the TRIzol reagent (Invitrogen), purified using the RNEasy Mini Kit (Quiagen) and treated with RNase-free DNase (Quiagen), according to the manufacturer's instructions. RNA was quantified with a UV/VIS spectrophotometer, and first-strand cDNA was synthesized from 1.2 μg of total RNA by using the First Strand cDNA Synthesis Kit AMV (Roche) for real-time PCR (RT-PCR).

Oligonucleotide primers (Table 1) were designed with the Primer Express software (Applied Biosystems, Foster City, CA, USA) after sequence alignments using sequence databases (Citrus HarvEST, University of California and BLAST, NCBI). Citrus sinensis glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the reference gene. The amplification efficiency was tested for all pairs of oligonucleotides (Livak and Schmittgen 2001).

Table 1.

Set of primers used to amplify specific regions of genes implicated in sucrose and starch metabolism in Citrus.

Gene	Accession no.		Sequence
GAPDH	CX672747	F	GGAAGGTCAAGATCGGAATCAA
		R	CGTCCCTCTGCAAGATGACTCT
ADP-glucose pyrophosphorylase	AF184597	F	GTACCGATTAATGGCGAGTATGG
		R	TGCTGCAGTTGACGGAGATG
Sucrose synthase A	AB021745	F	TTGTGGACTTCCGACATTCG
		R	TGACGCACCATGCTCGATAA
Sucrose synthase 1	AB022092	F	TGAGCCATTCAATGCCTCGT
		R	TGGATGCATGCTCTCCTTGTC
Sucrose transporter 1	AY098891	F	TTGCGGAGGTGGCAACAT
		R	CACTTAAGGCAGCCGCAACT
Sucrose transporter 2	AY098894	F	CCCAACGGAACCTCCAATTT
		R	AAGGCCSSCCGAACTGAA
Sucrose-phosphate synthase	CB293478	F	ATTCTAAGAGGTTCCGTAATGTATG
		R	CTTCAAAGCTGCAGACAAATC

Diluted cDNA (3 μg) was used as the template for semi-quantitative RT-PCR amplification in 20-μl reactions containing 0.3 μM each primer (0.15 μM GAPDH) and 10 μl of SYBR Green PCR master mixture (Power SYBR^®Green PCR Master Mix; Applied Biosystems). The PCR mixtures were preheated at 50°C for 2 min and then at 95°C for 10 min, followed by 40 amplification cycles (95°C for 15 s; 60°C for 1 min). Amplification specificity was verified by a final dissociation (95°C for 15 s, 60°C for 20 s and 95°C for 15 s) of PCR products. The levels of PCR products were monitored with an ABI PRISM 7000 sequence detection system and analysed with ABI PRISM 7000 SDS software (Applied Biosystems). At least three independent biological replicates of each sample and two technical replicates of each biological replicate were used for RT-PCR analysis. Relative expression levels of the target genes were calculated using the 2^{− ΔΔC}_T method (Livak and Schmittgen 2001).

Statistical analysis

Analysis of treatment comparisons was performed by ANOVA (Statgraphics Plus 5.1 for Windows, Statistical Graphics Corp.). Mean separations were performed with the Tukey multiple range test. Linear regression analysis was used to evaluate the relationships between parameters.

Results

The effect of leaf-to-fruit ratio

A_N did not change (P < 0.05) in girdled shoots with up to 40 leaves per fruit when compared with ungirdled shoots (Figure 1). There were no differences in A_N (Figure 1) and g_s, C_i and F_v/F_m (data not shown) between shoots with 10, 25 or 40 leaves during the experiment (30 days). During the experiment, changes in the daily A_N values within each treatment were due to changes in the daily environmental conditions. The photosynthetic rate was closely related to the leaf temperatures (r = −0.85; P < 0.05). Total non-structural carbohydrates and soluble sugars showed a similar trend during the course of the experiment in the non-girdled unifloral shoots (Table 2). Both levels decreased initially during the first 7 days and recovered after 35 days. Starch content in the leaves decreased with time, from an initial value of 9.7% DW to a value of 4.5%. Leaf area had no effect on the total sugar content after 7 days of girdling, but at the end of the experiment, the accumulation of total carbohydrates in leaves (Table 2) was closely related to the total leaf area per fruit (r = 0.79; P < 0.01). Notably, carbohydrate content in leaves markedly differed between the control and the girdled shoots with 40 leaves (17.7 and 29% DW, respectively), mainly due to the changes in soluble sugars (13.2 and 20.9% DW, respectively). Despite these differences, photosynthetic rates remained unchanged.

Figure 1.

Effect of leaf-to-fruit ratio on A_N in Salustiana sweet orange trees. Values are mean of 10 determinations in different trees. Measurements on girdled shoots bearing one fruit and 10 (closed circles), 25 (closed triangles) or 40 (closed squares) leaves, and unifloral shoots (open squares).

Table 2.

Influence of leaf-to-fruit ratio on carbohydrate content in Salustiana sweet orange leaves.

	Starch (% DW)			Soluble sugars (% DW)			Total carbohydrates (% DW)
Days	0	7	35	0	7	35	0	7	35
Unifloral shoots	9.7	5.4ab	4.5a	9.9	7.9ab	13.2a	19.6	13.2	17.7a
Girdled
10 leaves		4.9a	6.7ab		7.4a	13.5a		12.2	20.3a
25 leaves		5.4ab	7.1ab		9.0b	15.8a		14.5	22.9a
40 leaves		6.2b	8.2b		8.8b	20.9b		14.9	29.0b

Data are the mean values of three independent extracts and three trees per extract. Shoots with a single fruit were girdled on 20 June above the number of leaves indicated. Measurements were performed after 7 and 35 days. Within each column different letters indicate significant differences (P < 0.05). No letters indicate no differences.

The effect of sink availability

The effect of sink presence on photosynthesis is presented in Figure 2. A_N did not differ between ungirdled vegetative and unifloral shoots and girdled shoots bearing one fruit and 10 leaves during the experiment. However, 24 h after girdling, A_N fell significantly (P < 0.05) in vegetative girdled shoots with 10 leaves (Figure 2). This decrease was maintained over the course of the experiment. In these shoots, the leaves became chlorotic with time, and almost all abscised after 35 days (data not shown).

Figure 2.

Effect of sink availability on A_N in Salustiana sweet orange trees. Values are mean of 10 determinations in different trees. Measurements on girdled shoots with 10 leaves bearing one fruit (closed triangles) or vegetative (open triangles); non-girdled shoots bearing one fruit (closed circles) or vegetative (open circles).

There was also a significant decrease in g_s and the maximum quantum efficiency of PSII photochemistry (Table 3) after 24 h in vegetative girdled shoots. C_i increased after 48 h in these shoots. The decrease in F_v/F_m was due to a significant increase in F_o (Table 3). No changes were observed in F_m, ETR, NPQ or leaf temperatures between treatments (data not shown). The maximum carboxylation rate of RuBisCo fell (P < 0.05) in leaves of vegetative girdled shoots compared with ungirdled shoots (80 and 145 μmol m⁻² s⁻¹, respectively). No changes were observed in the J_max (102 and 119 μmol m⁻² s⁻¹, respectively).

Table 3.

The sink effect on leaf g_s, C_i, maximum quantum efficiency of PSII photochemistry (F_v/F_m) and minimal ground fluorescence intensity (F_o) in Salustiana sweet orange.

		gs, mol m−2 s−1			Ci, μmol mol−1			Fv/Fm			Fo
Days after girdling		0	1	2	0	1	2	0	1	2	0	1	2
Treatment	Shoot
Ungirdled	Unifloral	0.03	0.04a	0.04a	199	241	156a	0.78	0.79a	0.77a	852	822b	834b
	Vegetative	0.03	0.04a	0.05a	180	228	170a	0.78	0.79a	0.79a	876	838b	836b
Girdled	Unifloral		0.06a	0.06a		222	172a		0.78a	0.79a		788b	774b
	Vegetative		0.02b	0.02b		239	202b		0.72b	0.70b		1041a	1165a

In girdled shoots, 10 leaves remained distal to the girdle. Shoots were girdled on 28 June. Values are the mean of nine determinations in different shoots. Within each column, different letters indicate significant differences (P < 0.05). No letters indicate no differences.

Total soluble sugar and starch content did not differ between treatments 24 h after girdling (Table 4). After 48 h, vegetative girdled shoots accumulated starch and soluble sugars. A transient increase in soluble sugars was observed in unifloral girdled shoots after 48 h.

Table 4.

The sink effect on starch, soluble sugars and total carbohydrate content in Salustiana sweet orange leaves.

		Starch (% DW)			Soluble sugars (% DW)			Total carbohydrates (% DW)
Days after girdling		0	1	2	0	1	2	0	1	2
Treatment	Shoot
Ungirdled	Unifloral	10.5	9.6	9.9a	8.1	10.4	9.7a	18.6	20.0	19.6a
	Vegetative	8.6	8.4	8.8a	7.9	10.6	9.1a	16.5	19.0	17.8a
Girdled	Unifloral		8.6	9.2a		11.6	11.2ab		20.2	20.4a
	Vegetative		10.7	16.9b		11.6	15.4b		22.4	32.4b

In girdled shoots, ten leaves remained distal to the girdle. Shoots were girdled on 28 June. Data are the mean values of three independent extracts and three trees per extract. Within each column, different letters indicate significant differences (P < 0.05). No letters indicate no differences.

In a further experiment, photosynthesis was measured within the first 24 h after girdling. A_N did not differ in vegetative and unifloral girdled shoots during the first 8 h (Figure 3), corresponding to the main diurnal light period (from 10:00 to 18:00 h). A_N only fell after 24 h in vegetative girdled shoots.

Figure 3.

Effect of the presence of fruit in girdled shoots on A_N in Salustiana sweet orange trees during the first 24 h after girdling. Values are mean of 10 determinations in different trees. Measurements on girdled shoots with 10 leaves bearing one fruit (closed triangles) or vegetative (open triangles). Girdling was performed between 09:30 and 10:00 h.

Diurnal changes in the relative expression of genes implicated in carbon metabolism have been observed (Figure 4). All analysed genes, except sucrose synthase 1, exhibited increased expression during the day, returning to initial levels the next morning. Gene expression among treatments did not differ 2 h after girdling, with the exception of ADP-glucose pyrophosphorylase. The expression of this gene was strongly suppressed in vegetative girdled shoots. Compared with ungirdled shoots, the expression of sucrose synthase A, sucrose transporter 1 and sucrose phosphate synthase was reduced after 8 h of girdling in vegetative shoots (Figure 4). This decrease was maintained after 24 h, with the exception of sucrose transporter 2, which showed similar expression levels. The expression of ADP-glucose pyrophosphorylase increased with time in girdled vegetative shoots. In contrast, unifloral girdled shoots showed increased levels of the expression of sucrose synthase A, sucrose transporters 1 and 2 and sucrose phosphate synthase after 8 h of girdling, compared with ungirdled vegetative shoots (Figure 4). However, after 24 h, the expression levels of these genes did not differ from those observed in vegetative shoots. Sucrose synthase 1 expression did not change with time or treatment, with the exception of a decrease in unifloral girdled shoots observed after 24 h.

Figure 4.

Relative gene expression in leaves of girdled shoots in Salustiana sweet orange. Leaves of vegetative shoots sampled 2 h after girdling are used as a reference for expression levels. For each date and time, different letters indicate significant differences (P < 0.05). No letters indicates no differences. Each value is the mean of three independent determinations.

Discussion

Effect of leaf-to-fruit ratio

Trunk girdling is widely used in citrus mainly to increase flowering, fruit set and fruit size (Goren 2003). The downward translocation of photoassimilates and metabolites through the phloem is blocked, creating a closed environment for carbon metabolism and transport. Carbohydrates accumulate in the leaves and shoot bark above the girdle in fruitless trees, whereas developing fruit consumes all available carbohydrates (Li et al. 2003a). In this work, imbalances in source–sink ratio have been induced through girdling experiments.

We report an increase in starch and soluble sugars with leaf-to-fruit ratios in girdled shoots, as described previously in several species (Urban et al. 2004, Proietti et al. 2006), including citrus (García-Luis et al. 2002). At high leaf-to-fruit ratios (40), soluble sugars accumulated up to 21% DW and up to 8% starch at the end of the experiment, as compared with 13 and 5% in ungirdled controls, respectively. Approximately 25 leaves per fruit developed naturally in mature Salustiana trees (unpublished data), and at the time of the experiments, root growth did not occur in ‘on’ trees, and carbohydrates did not accumulate in the roots because fruits are the predominant sinks for the available carbohydrates (Goldschmidt and Koch 1996). Despite the sink strength of the fruit, some basipetal transport of sugars cannot be ruled out in the controls because total carbohydrates in girdled shoots bearing 25 leaves per fruit are higher (23 and 18% DW, respectively). The sugar content at lower leaf-to-fruit ratios, although higher than controls, was not significantly different.

Although source–sink ratios altered the carbohydrate content in leaves, no effect of fruit load on photosynthesis was observed in Salustiana sweet orange. These results contrasted with previous reports for apple (Palmer 1992), grapevine (Edson et al. 1995) and mango (Urban and Léchaudel 2005), where a negative correlation was found. Iglesias et al. (2002) reported that non-structural carbohydrates accumulated up to 26% DW after sucrose supplementation in Satsuma mandarin, and photosynthesis was inhibited. These values are close to those presented in our study, but nevertheless, the photosynthetic rate was not repressed. However, the interpretation of sugar-feeding experiments can be complicated, because other metabolites or pathways may also be altered (Paul and Foyer 2001).

Our results suggest that whenever a sink (fruit) is present, the photosynthetic rate is not affected by the fruit load. Since the transport capacity of the phloem is not limiting in the Salustiana sweet orange (García-Luis et al. 2002), the greater availability of photoassimilates with leaf-to-fruit ratio allowed for a higher rate of dry matter accumulation in the fruits (García-Luis et al. 2002). Differences with other species could be explained by the export rate of photoassimilates from leaves to fruits, which could be limited at some point in the pathway linking these organs, as reported by Franck et al. (2006) for Coffea.

An effect of crop load on A_N in relation to starch content has been reported (Syvertsen et al. 2003). However, differences in photosynthesis were only present between fruiting and non-fruiting trees and not between full- and half-crop trees. The non-fruiting trees were very young (5 years old), and therefore the root system could not be a strong and unsaturable sink.

Thus, it can be concluded that whenever a sink was present, the photosynthetic rate remained unchanged relative to the sink demand, and soluble sugar accumulation per se did not provoke down-regulation of the photosynthetic rate. Furthermore, the leaf-to-fruit ratio did not modulate photosynthesis, but did affect photoassimilate allocation to the fruits. In fact, environmental conditions accounted for most of the variation in the photosynthetic rate and g_s during the experiment in Salustiana sweet oranges (Figure 1). A_N was closely related to temperature, and no chronic photoinhibition was caused by the environmental conditions or girdling.

The effect of sink availability

The effect of alternative sinks on photosynthesis was assessed by comparing the photosynthetic rates between girdled and ungirdled unifloral and vegetative shoots (Figure 2). When any strong sink was available (e.g. roots and/or fruits), no differences were observed in A_N or g_s. No effects related to leaf–fruit distance were observed in the Salustiana sweet orange, as photosynthetic rates were similar in fruiting and non-fruiting shoots. In addition, non-structural carbohydrate content did not differ between these treatments. These results could contradict previous observations of a higher photosynthetic rate in non-fruiting shoots (Syvertsen et al. 2003). However, in contrast to the present study, measurements were performed in leaves immediately adjacent to the fruit in that work. The authors reported effects that were opposite to the responses of A_N to crop load in most leaves of the canopy.

A strong reduction in photosynthesis was only observed in girdled vegetative shoots when sink strength was sharply reduced. Similar observations have been noted previously (Goldschmidt and Koch 1996, Iglesias et al. 2002), although the kinetics of the down-regulation and its relationship to carbohydrate content variation have not been previously studied. In our experiments, no changes were observed during the first 12 h (Figure 2), but A_N and g_s fell after the night-time period (Figure 3), and low values were maintained until severe symptoms of chlorosis developed and leaves abscised (Schaffer et al. 1986). Nevertheless, starch and soluble sugars accumulated only after 48 h, and A_N down-regulation preceded any increase in leaf non-structural carbohydrates. Thus, a direct relationship between sugar accumulation and photosynthesis repression must be questioned. Furthermore, soluble sugar levels are lower than those observed in the high leaf-to-fruit ratio experiment, where A_N remained unchanged. Starch accumulation in leaves has been reported to repress photosynthesis (Iglesias et al. 2002). Although A_N was also inversely related to starch content in our study after 48 h, down-regulation of photosynthesis was not a direct consequence of starch accumulation.

DaMatta et al. (2008) proposed that decreased A_N in defruited trees was independent of carbon metabolism and directly related to lower CO₂ availability coupled with lower g_s. Our results indicate that the inhibition of A_N was not attributable to a g_s-associated decrease in C_i within the first 24 h, as described by other authors (Urban et al. 2004, Li et al. 2007), because C_i did not decrease in girdled vegetative shoots. On the contrary, C_i increased in parallel with decreased g_s after 48 h, suggesting non-stomatal limitations to A_N (Pérez-Pérez et al. 2007).

Source–sink manipulations may also alter the fluorescence kinetics of chlorophyll a (Syvertsen et al. 2003, Urban et al. 2004, Rivas et al. 2007). In our study, fluorescence parameters were only altered in the absence of fruits. F_v/F_m declined after 24 h in the leaves of girdled vegetative shoots in response to an increase in F_o, indicating chronic photoinhibition events and a reduction in functional PSII units (Flexas et al. 2001). However, photosynthesis was not impaired through effects on the PSII reaction centres caused by higher leaf temperatures associated with a lower g_s (Li et al. 2007). Furthermore, xanthophyll cycle-mediated quenching (NPQ) did not change in A_N down-regulated leaves, suggesting that another pathway for dissipating excess energy might also have been utilized (Wünsche et al. 2005). Despite the described photoinactivation of PSII, the ETR remained unaltered during the first 48 h, indicating that the inactive PSII-mediated quenching (IPQ) mechanism should be working in Salustiana sweet orange leaves. Inhibition of A_N may also result from a change in the key components of photosynthetic capacity (Urban et al. 2004). The RuBP carboxylation capacity of RuBisCo (V_cmax) was repressed after 24 h in our study, despite J_max remaining unchanged. A lower V_cmax suggested a decrease in the content or activation state of RuBisCo. Araya et al. (2006) proposed that a decrease in RuBisCo content is the main cause of carbohydrate repression during photosynthesis.

Sugar-regulated genes provide a means for integrating cellular responses to transport sugars, and thus information on carbohydrate status, and for coordinating changes in resource utilization and allocation among organs (Koch 1996). When sinks cannot use all of the assimilate generated, sugar accumulation in leaves has a direct effect on the expression of ADP-glucose pyrophosphorylase (Müller-Rober et al. 1994) and other carbohydrate-responsive enzymes involved in sucrose and starch metabolism (Koch 1996). Sugar accumulation also represses the expression of the sucrose transporter (Chiou and Bush 1998, Li et al. 2003b). Sucrose is the main sugar transported through the phloem in Citrus (Zimmermann and Ziegler 1975). We reported higher expression of the sucrose transporter and sucrose synthesis genes and lower expression of the starch synthesis genes in girdled shoots bearing one fruit, indicating that the synthesis and export of sucrose in the leaves is promoted when a strong sink is available to the source. In contrast, the expression of ADP-glucose pyrophosphorylase increased when no strong sinks were present, and the excess of assimilates had to be stored as starch in the leaves. Sucrose synthase A has been associated with starch synthesis (Dejardin et al. 1997, Li et al. 2003a) due to its cleavage activity. We reported a decrease in its expression when starch accumulated in leaves after girdling, suggesting that this isoform is working in the direction of sucrose synthesis. However, this decrease was not observed in sucrose synthase 1, indicating a different regulation (Li et al. 2003c). The expression of both sucrose transporter 1 and sucrose phosphate synthase is strongly repressed after 8 h in vegetative girdled shoots relative to unifloral girdled shoots, indicating inhibition of sucrose synthesis and phloem charge. This reduction was further maintained after 24 h. The repression of the sucrose transporter 1 gene was not triggered by soluble sugars as described by Li et al. (2003b). The expression of sucrose transporter 2 was also inhibited after 8 h, but inhibition was not maintained after 24 h, suggesting a different regulatory mechanism. In addition, expression levels of sucrose transporter 2 isoform in leaves were similar to those of sucrose transporter 1, in contrast to the different physiological roles proposed for these transporters (Li et al. 2003b). From our study, expression of the genes controlling sucrose and starch metabolism in the leaves changed before any changes in the accumulation of these carbohydrates, as described above for some of the photosynthetic parameters. Differences in starch turnover may play a role in sensing photoassimilate availability and regulation of photosynthetic and carbon metabolism gene expression, as suggested by Paul and Foyer (2001).

In conclusion, in the absence of sinks, a rapid modulation of the expression of genes implicated in adaptive changes in assimilate partitioning occurs. Sucrose synthesis and phloem charge are blocked in the leaves, and fixed carbon is channelled to starch production. Changes in starch and soluble sugar turnover, but not sugar content per se, could provide the signal for the regulation of photosynthesis. In these conditions, non-stomatal limitations strongly inhibited the photosynthetic rate prior to any significant increase in carbohydrate levels.

Funding

This work was supported by the Conselleria de Cultura, Educació i Esport de la Generalitat Valenciana [GV/2007/213 and GV/2009/034].

Acknowledgments

We thank Dr Jaume Flexas and Dr Miquel Rivas for their assistance with photosynthetic parameters modelling, and Dr Juan Segura for his critical reading of the manuscript.

Author notes

†

Deceased.